ID: 1078952324

View in Genome Browser
Species Human (GRCh38)
Location 11:16148220-16148242
Sequence GAAGAATAAAAAAAGGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1037
Summary {0: 1, 1: 0, 2: 1, 3: 83, 4: 952}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078952324_1078952327 -5 Left 1078952324 11:16148220-16148242 CCCATAGCCTTTTTTTATTCTTC 0: 1
1: 0
2: 1
3: 83
4: 952
Right 1078952327 11:16148238-16148260 TCTTCATTGTTTGAATAATATGG 0: 1
1: 0
2: 1
3: 20
4: 339
1078952324_1078952328 -4 Left 1078952324 11:16148220-16148242 CCCATAGCCTTTTTTTATTCTTC 0: 1
1: 0
2: 1
3: 83
4: 952
Right 1078952328 11:16148239-16148261 CTTCATTGTTTGAATAATATGGG 0: 1
1: 0
2: 1
3: 31
4: 272
1078952324_1078952329 -1 Left 1078952324 11:16148220-16148242 CCCATAGCCTTTTTTTATTCTTC 0: 1
1: 0
2: 1
3: 83
4: 952
Right 1078952329 11:16148242-16148264 CATTGTTTGAATAATATGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078952324 Original CRISPR GAAGAATAAAAAAAGGCTAT GGG (reversed) Intronic