ID: 1078952327

View in Genome Browser
Species Human (GRCh38)
Location 11:16148238-16148260
Sequence TCTTCATTGTTTGAATAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 339}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078952325_1078952327 -6 Left 1078952325 11:16148221-16148243 CCATAGCCTTTTTTTATTCTTCA 0: 1
1: 0
2: 7
3: 94
4: 1068
Right 1078952327 11:16148238-16148260 TCTTCATTGTTTGAATAATATGG 0: 1
1: 0
2: 1
3: 20
4: 339
1078952322_1078952327 19 Left 1078952322 11:16148196-16148218 CCAATCAGTTGTTGAGTTAGACC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1078952327 11:16148238-16148260 TCTTCATTGTTTGAATAATATGG 0: 1
1: 0
2: 1
3: 20
4: 339
1078952324_1078952327 -5 Left 1078952324 11:16148220-16148242 CCCATAGCCTTTTTTTATTCTTC 0: 1
1: 0
2: 1
3: 83
4: 952
Right 1078952327 11:16148238-16148260 TCTTCATTGTTTGAATAATATGG 0: 1
1: 0
2: 1
3: 20
4: 339
1078952323_1078952327 -2 Left 1078952323 11:16148217-16148239 CCACCCATAGCCTTTTTTTATTC 0: 1
1: 1
2: 2
3: 39
4: 635
Right 1078952327 11:16148238-16148260 TCTTCATTGTTTGAATAATATGG 0: 1
1: 0
2: 1
3: 20
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078952327 Original CRISPR TCTTCATTGTTTGAATAATA TGG Intronic