ID: 1078955933

View in Genome Browser
Species Human (GRCh38)
Location 11:16195064-16195086
Sequence GCCAATCCTGCAATACTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 66}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078955933_1078955936 12 Left 1078955933 11:16195064-16195086 CCACCAAGTATTGCAGGATTGGC 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1078955936 11:16195099-16195121 AGCTCCATGAGCGTTAGGAGAGG 0: 1
1: 0
2: 3
3: 7
4: 100
1078955933_1078955939 17 Left 1078955933 11:16195064-16195086 CCACCAAGTATTGCAGGATTGGC 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1078955939 11:16195104-16195126 CATGAGCGTTAGGAGAGGAAGGG 0: 1
1: 0
2: 2
3: 15
4: 180
1078955933_1078955935 7 Left 1078955933 11:16195064-16195086 CCACCAAGTATTGCAGGATTGGC 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1078955935 11:16195094-16195116 CTAGAAGCTCCATGAGCGTTAGG 0: 1
1: 0
2: 1
3: 12
4: 134
1078955933_1078955938 16 Left 1078955933 11:16195064-16195086 CCACCAAGTATTGCAGGATTGGC 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1078955938 11:16195103-16195125 CCATGAGCGTTAGGAGAGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 119
1078955933_1078955940 21 Left 1078955933 11:16195064-16195086 CCACCAAGTATTGCAGGATTGGC 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1078955940 11:16195108-16195130 AGCGTTAGGAGAGGAAGGGAAGG 0: 1
1: 0
2: 11
3: 50
4: 585

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078955933 Original CRISPR GCCAATCCTGCAATACTTGG TGG (reversed) Intronic
900459611 1:2796548-2796570 CCCAAGCCTGCAACACTTGGGGG + Intronic
903031176 1:20465377-20465399 GCCACTCCTGCAGAGCTTGGTGG - Intergenic
907691930 1:56677506-56677528 GCCAACCCTGAAAGACTTTGAGG + Intronic
910252847 1:85216159-85216181 GACAATCCAGAATTACTTGGAGG + Intergenic
918198188 1:182242342-182242364 GCTAATCCTGCAGCATTTGGGGG + Intergenic
918242092 1:182629709-182629731 GCCAATCCTGCCACACTATGTGG - Intergenic
919027501 1:192195933-192195955 GACAATCCTGAGAAACTTGGAGG - Intergenic
924718147 1:246597848-246597870 GACAATCCTGCAAGACATGTAGG - Intronic
1065096587 10:22287066-22287088 GCCAGCCTTGCAAGACTTGGGGG + Intergenic
1067940706 10:50653095-50653117 GTCAATCCTGCAGTAATTGCTGG - Intergenic
1078955933 11:16195064-16195086 GCCAATCCTGCAATACTTGGTGG - Intronic
1079852228 11:25549691-25549713 GCCAATACTTCAATATTTAGTGG + Intergenic
1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG + Intronic
1088274659 11:108072381-108072403 GCCAATGTTGAAAGACTTGGAGG + Exonic
1090646917 11:128773792-128773814 GACAATCCTTCCATACTTAGGGG - Intronic
1092003650 12:5050988-5051010 GCCAATCCTGCCTTAATTGGAGG - Intergenic
1093258307 12:16900656-16900678 GCCAGTCCTGAAAAATTTGGCGG + Intergenic
1094184552 12:27626851-27626873 GCAAATCCTGCCAGACATGGTGG - Intronic
1094281067 12:28739225-28739247 GCCAATCCTTCAAGACTTCAGGG - Intergenic
1094359763 12:29617724-29617746 GGCAATCAAGCAAGACTTGGAGG + Intronic
1096753355 12:53777744-53777766 GCAAATCATGCAAGACTTTGTGG + Intergenic
1101241155 12:102841393-102841415 GCCACTCTTGCCAAACTTGGAGG - Intronic
1111676688 13:91397362-91397384 GACAATCTTTCCATACTTGGTGG + Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1114814615 14:25942793-25942815 GCAACTCCAGCAATACGTGGTGG - Intergenic
1114884920 14:26836846-26836868 GCCAATCCTTCTACTCTTGGAGG + Intergenic
1117325666 14:54666814-54666836 GCCATTCCTCCAACATTTGGGGG - Intronic
1118604629 14:67493734-67493756 GCCAATCCTGAGATTCTTGTTGG + Intronic
1122020667 14:98835093-98835115 GGCAATCCTGCAATGCTTAGGGG + Intergenic
1131325030 15:91434757-91434779 GCCAATTCAGGAATACCTGGAGG + Intergenic
1131576755 15:93599935-93599957 GCTAATCCTGTGATATTTGGAGG - Intergenic
1140770915 16:78203253-78203275 GCCCATCCTGCAATGGTTTGGGG + Intronic
1141814551 16:86400731-86400753 GTCAAGCTTGGAATACTTGGAGG + Intergenic
1142179549 16:88661179-88661201 GGCAATCCTGTACAACTTGGAGG + Intronic
1143984040 17:10895793-10895815 GCCAAGCTACCAATACTTGGAGG + Intergenic
1144311249 17:14016131-14016153 CCCAATCCTGCAAGACTTGCTGG - Intergenic
1155905125 18:31441570-31441592 GTCATTCCTGAAATCCTTGGAGG + Intergenic
1161118592 19:2512878-2512900 GCCATTCCTGCTATGCGTGGTGG + Exonic
1162231560 19:9270909-9270931 GCCAAGCCTGCAGTGATTGGAGG - Intergenic
1162365065 19:10243578-10243600 GTCAGGCCTGCAATACTGGGGGG - Intergenic
928759599 2:34566513-34566535 GCAAATCTTGCTATATTTGGAGG - Intergenic
932221651 2:70004128-70004150 GCCAAGGCTCCAATTCTTGGAGG + Intergenic
939388998 2:141542620-141542642 CATTATCCTGCAATACTTGGAGG - Intronic
942520065 2:176794463-176794485 GCAAATCCTAAAATACTTGGAGG + Intergenic
943546374 2:189284591-189284613 GCCCCTCCTACAATACATGGGGG + Intergenic
952488054 3:33835959-33835981 ACCAATGCTTAAATACTTGGTGG + Intronic
962806153 3:138929154-138929176 GCCTATCCTGCGATCTTTGGCGG + Intergenic
970952038 4:21767513-21767535 GCCAATTATGCAATACTTTTAGG + Intronic
975861058 4:78677393-78677415 TCCATTCCTGCATTACTTGTAGG - Intergenic
981233037 4:142380878-142380900 CCCAATCATGCAATATTTTGTGG + Intronic
984088749 4:175344139-175344161 CCCTAACCTGCAAAACTTGGGGG + Intergenic
993021830 5:82601282-82601304 GCCACTCCTGCTATAATTTGTGG - Intergenic
994969029 5:106712065-106712087 GCCATTCCTGTACGACTTGGAGG - Intergenic
1003728661 6:8794798-8794820 TCCAATCGTGCAAGACTTGAAGG - Intergenic
1010432055 6:75788787-75788809 GATAAACCTGGAATACTTGGAGG + Intronic
1012412854 6:98979409-98979431 GCCAATCCTGGACTATTTTGAGG - Intergenic
1016262522 6:142189248-142189270 GTCAAGCCTTAAATACTTGGTGG + Intronic
1017686460 6:156918317-156918339 GCCAATCCTGCAGATTTTGGGGG + Intronic
1030313782 7:108093430-108093452 TACAATACTGAAATACTTGGAGG + Intronic
1040032533 8:42839291-42839313 ACAAATACTGCTATACTTGGTGG + Exonic
1042186057 8:66137220-66137242 ACCAAGCCTGCAATGCCTGGGGG + Intronic
1043211480 8:77524529-77524551 TCCAATCATGCAAAACTTGAGGG + Intergenic
1044151345 8:88779444-88779466 GCAAATAATGCAATACTTAGGGG - Intergenic
1050759976 9:9056720-9056742 GCCAAACATGGAAGACTTGGTGG - Intronic
1051621211 9:19051086-19051108 GCCAGTCAAGCAATACTTGTGGG - Intergenic
1058505972 9:105666444-105666466 TTCAATCCTAAAATACTTGGTGG - Intergenic
1058813514 9:108663468-108663490 TCCTTTCCAGCAATACTTGGAGG - Intergenic
1058998284 9:110321267-110321289 GGCAATCCTGAGATTCTTGGCGG + Intronic
1062238117 9:135522295-135522317 GCCCCTCCTGCAATGCTTGAGGG + Intronic
1186392290 X:9173082-9173104 ACCAATTCTCCAATTCTTGGTGG - Intergenic
1188387381 X:29577767-29577789 GCAGAACCAGCAATACTTGGAGG - Intronic
1192338885 X:70245400-70245422 CCAAATACTGCCATACTTGGGGG + Intergenic
1192928430 X:75780366-75780388 GCCAAAACTTCAATACTTGGTGG + Intergenic
1195489860 X:105454820-105454842 GCCAGTTCTGAAGTACTTGGGGG - Intronic