ID: 1078957106

View in Genome Browser
Species Human (GRCh38)
Location 11:16211400-16211422
Sequence CATTGCTATCACCTTGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078957106_1078957109 -8 Left 1078957106 11:16211400-16211422 CCTGGACCAAGGTGATAGCAATG 0: 1
1: 0
2: 3
3: 23
4: 146
Right 1078957109 11:16211415-16211437 TAGCAATGGCAAATTTAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 155
1078957106_1078957110 3 Left 1078957106 11:16211400-16211422 CCTGGACCAAGGTGATAGCAATG 0: 1
1: 0
2: 3
3: 23
4: 146
Right 1078957110 11:16211426-16211448 AATTTAAGCTGGATAATTTGAGG 0: 1
1: 0
2: 2
3: 38
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078957106 Original CRISPR CATTGCTATCACCTTGGTCC AGG (reversed) Intronic
900465756 1:2824752-2824774 CATTGATACCACCTTGGTTTGGG + Intergenic
900565115 1:3328365-3328387 CAGAGCTATCTCCTTGGTCGTGG + Intronic
903475659 1:23617620-23617642 CATTGCCATTACCTTGGTTCAGG + Intronic
906187657 1:43873202-43873224 CACTGCTTCCACCGTGGTCCAGG - Intronic
907109360 1:51912709-51912731 CATTGGCATGACCTTGGTCCAGG - Exonic
910094568 1:83506297-83506319 CTTTGCTCTTTCCTTGGTCCAGG + Intergenic
913253934 1:116937451-116937473 CAGTGCTGTCACCCTGGCCCCGG - Intronic
916814747 1:168340802-168340824 CATTGCAATCTCCCTGGTCCTGG + Intergenic
918138463 1:181699717-181699739 CACTGCTGTCACCCTAGTCCAGG - Intronic
919162496 1:193849181-193849203 CTTTGTTAGGACCTTGGTCCAGG + Intergenic
919528260 1:198680719-198680741 CATTGCCTTTACCCTGGTCCAGG - Intronic
921991148 1:221369422-221369444 CATTTCTATCATCTTGGTGTTGG + Intergenic
923135294 1:231111805-231111827 CATCTCTGTCACCTTGGTGCTGG - Intergenic
1063770260 10:9189405-9189427 CATCACTATCACCTTGGTGAGGG - Intergenic
1068941257 10:62683449-62683471 CATTTCTACCACCTTGGTCCAGG + Intergenic
1070132511 10:73665210-73665232 CATTGCTATCTCCTTTGGGCAGG + Intergenic
1071478183 10:86042475-86042497 CCCTGCTCTCCCCTTGGTCCTGG - Intronic
1071609172 10:87018866-87018888 CATTGCTATCTCCTTTGGGCAGG - Intergenic
1071718283 10:88118587-88118609 CTTTACTAGCACCCTGGTCCAGG - Intergenic
1075300445 10:121317834-121317856 TATTGTTATCTCGTTGGTCCTGG + Intergenic
1075904950 10:126072986-126073008 CAGTGTTATCAGTTTGGTCCTGG - Intronic
1078832182 11:14988398-14988420 CATTGGTTTCACCTTGGCCACGG - Intronic
1078957106 11:16211400-16211422 CATTGCTATCACCTTGGTCCAGG - Intronic
1083563278 11:63691758-63691780 CATTGCTACCACCCTGGTCCAGG + Intronic
1088113018 11:106283477-106283499 CACTGCTATCACTCTGGTCCAGG + Intergenic
1088432917 11:109778282-109778304 CCTTGCTGACACCTTGATCCTGG - Intergenic
1088937599 11:114419387-114419409 CATGGCTATCAACTTGGGGCTGG + Intronic
1089188376 11:116636511-116636533 CATTCCTAACATCTTTGTCCAGG + Intergenic
1089669231 11:120040981-120041003 CATTGCTAACACCTTGATCTTGG + Intergenic
1091187917 11:133663153-133663175 CATTGCCAATACCTTAGTCCAGG - Intergenic
1094066397 12:26365077-26365099 CATTGGTATCACACTGGCCCAGG + Intronic
1094771911 12:33672350-33672372 CATTGCAATCTCCGTGGCCCAGG + Intergenic
1097371394 12:58785751-58785773 CCTTGCTTTCACCTGGCTCCTGG + Intronic
1101224847 12:102677885-102677907 CATTGCTATTTCCGTGGTCCAGG + Intergenic
1103200173 12:119081738-119081760 CATGGCTAGCGCCCTGGTCCAGG - Intronic
1103845668 12:123900552-123900574 CATTGCCATCATCCTTGTCCAGG + Intronic
1106924688 13:34601421-34601443 CATTGTTATCACCATCCTCCTGG - Intergenic
1108490259 13:50974766-50974788 CATTCCTATCACCTTCCTGCTGG + Intergenic
1109005443 13:56869732-56869754 CAGTGCTATCACTCTGGTCAAGG - Intergenic
1112046592 13:95603876-95603898 CATTGCCAGCACGTTTGTCCTGG - Intronic
1114617602 14:24076517-24076539 CTTTGCTATCAACTTTGACCCGG + Exonic
1116455823 14:45119657-45119679 ACTTGCTATCAACTTGGTACGGG + Intronic
1117309000 14:54503510-54503532 CACTGTTTCCACCTTGGTCCAGG - Intergenic
1117660283 14:57997297-57997319 CATTTCTGCAACCTTGGTCCAGG + Intergenic
1120092008 14:80342791-80342813 CATTGCTAACACCCTGATCTAGG + Intronic
1120159977 14:81135506-81135528 CATTGCTACCACCTTAGTTTAGG - Intronic
1120821045 14:88912195-88912217 CATTGCCATCACTCTGCTCCAGG - Intergenic
1122548954 14:102539731-102539753 CACTGCTTTCACCTCTGTCCTGG - Intergenic
1123987416 15:25657857-25657879 CATCGCTGTCTCCTTGGTCTGGG + Intergenic
1126510506 15:49466680-49466702 CATTGCCATCACATTAGTCCAGG - Intronic
1130391974 15:83464747-83464769 TGCTACTATCACCTTGGTCCTGG + Intronic
1131303600 15:91221634-91221656 CATGGCCACCACCTTTGTCCAGG + Intronic
1131971944 15:97902359-97902381 CATTCCCCTCACCTTAGTCCTGG + Intergenic
1136867216 16:33767968-33767990 CACAGCCATCACCCTGGTCCGGG + Intergenic
1141964441 16:87432460-87432482 CCTGGCTAGCACCTTGGGCCGGG + Intronic
1142171527 16:88625077-88625099 CCTTGCTACCACCTTGGAACAGG - Intronic
1203104946 16_KI270728v1_random:1348235-1348257 CACAGCCATCACCCTGGTCCGGG - Intergenic
1203128568 16_KI270728v1_random:1614133-1614155 CACAGCCATCACCCTGGTCCGGG + Intergenic
1143887130 17:10073043-10073065 CCTTGCTGTCACTCTGGTCCTGG - Intronic
1144855150 17:18263405-18263427 CAACGCTACCACCTTGCTCCAGG - Intronic
1147763842 17:42819453-42819475 CATCTCTATCACCTGGCTCCAGG + Intronic
1147906848 17:43829104-43829126 GACTGCTATCACTTTGGTCCTGG - Intronic
1152319163 17:79598254-79598276 CATTGCCACCACCTTCCTCCTGG - Intergenic
1155659951 18:28237051-28237073 CCATGCTGTCACCTTGTTCCTGG + Intergenic
1155664383 18:28290610-28290632 CATTGCCAGTACCTTGGTCTTGG - Intergenic
1156316557 18:35973907-35973929 CATTGCTACTACCCTGCTCCAGG + Intronic
1157299712 18:46470772-46470794 CACTGCTACCAACCTGGTCCGGG + Intergenic
1158012247 18:52742121-52742143 CCTTGCTAACACCTTGATCCTGG + Intronic
1159871535 18:73763704-73763726 CACTGCCATCCCCTTGGTCTAGG - Intergenic
1160988479 19:1851083-1851105 CAGTGCAATCACCTTGGCCCTGG - Intergenic
1164249405 19:23464079-23464101 AAGTGACATCACCTTGGTCCTGG - Intergenic
1165169613 19:33882520-33882542 CACTGCCATCATCCTGGTCCTGG + Intergenic
1165273860 19:34732314-34732336 CCTTGCCATCAGCGTGGTCCAGG - Intergenic
1167702010 19:51054385-51054407 TACGGCCATCACCTTGGTCCAGG + Intergenic
1168519525 19:57037424-57037446 CATTGCTAACACCCTGGACCAGG + Intergenic
927981921 2:27379879-27379901 TATTCCTATCACCTTTGACCAGG + Intronic
931679995 2:64738463-64738485 CATTGGAATCACCTATGTCCAGG - Intronic
932242412 2:70167812-70167834 CATTACTACCACCTTTGTCCAGG - Intronic
932740718 2:74289016-74289038 CATTGCCACCATCTTGGTTCTGG + Intronic
933948422 2:87308235-87308257 GATTGCTATTGCCTTGGACCTGG + Intergenic
937326741 2:120993958-120993980 CATTGCTAGTGTCTTGGTCCTGG - Intergenic
943103196 2:183511312-183511334 CATTCCTATCAGCAGGGTCCAGG - Intergenic
943260215 2:185649924-185649946 AATTGACATCACCTTGGTCTTGG + Intergenic
943461746 2:188177640-188177662 AATTGATTTCACCTTGGTACAGG + Intergenic
944159186 2:196640768-196640790 CGCTGCTGTCACCTTGGTTCTGG + Intronic
945053008 2:205843296-205843318 CATGGCTGTCACCATGGTCCTGG + Intergenic
947919887 2:233860751-233860773 CCTTGCTAGCACCTTGATCTTGG - Intergenic
1168931249 20:1626239-1626261 CATTACTAGCACCTGGGTCATGG + Intergenic
1170080985 20:12475445-12475467 CAGTGCTAACTCCTTGGTCTTGG + Intergenic
1172965301 20:38829990-38830012 CATTGTTCTCACCTTTCTCCAGG + Intronic
1173093965 20:40006322-40006344 CATTGCTACCATCCTAGTCCAGG - Intergenic
1174306671 20:49618346-49618368 CATGGCCACCACCCTGGTCCAGG + Intergenic
1175808628 20:61845468-61845490 CACTGCTTTCACCATGGCCCAGG - Intronic
1178962741 21:37082472-37082494 CATTTCTATCAGCTTTGTCTGGG + Exonic
1179224866 21:39444657-39444679 CACTGTCACCACCTTGGTCCAGG - Intronic
1182923982 22:34105575-34105597 CATTGCCAACTGCTTGGTCCAGG + Intergenic
1183269365 22:36851017-36851039 TATTTCAATCACCTGGGTCCTGG + Intergenic
1183875247 22:40774951-40774973 CAGTGCCACCACCGTGGTCCAGG + Intronic
953461911 3:43088354-43088376 CATTGGTGGCACCTTGGGCCTGG + Intronic
957120368 3:76082900-76082922 CATGGTGATCGCCTTGGTCCGGG - Intronic
958158088 3:89781501-89781523 CATTGCTGACACTTTGGTCTTGG - Intergenic
958549353 3:95593941-95593963 TATTCCTATCAGCTGGGTCCAGG - Intergenic
962184559 3:133244323-133244345 CATTGCTAGGACCTTGTTCCTGG + Intronic
964407534 3:156364947-156364969 CTTTGCTATTACCTTTTTCCTGG - Intronic
965410201 3:168320608-168320630 CATTCCTATCACCTAGCTTCTGG - Intergenic
967107819 3:186268476-186268498 CCTGGCTATCACCTAGGGCCGGG - Intronic
967604741 3:191432241-191432263 CAATGCTGGCACCTTGATCCTGG - Intergenic
967760020 3:193213360-193213382 CACTGCCATCACCTGGGACCTGG - Intergenic
968180816 3:196593880-196593902 CACTGCCATCACCTTGCTCTTGG - Intergenic
970673667 4:18423613-18423635 CATTGCCATCACCTTCTACCAGG + Intergenic
970881706 4:20939879-20939901 CATTGCTAAAAGCTTGGACCAGG - Intronic
971367818 4:25991774-25991796 CATTTCTATCATGTTGCTCCTGG + Intergenic
971459543 4:26879917-26879939 CATTGCCATCACTCTGGTCTGGG + Intronic
971818489 4:31521463-31521485 AATTGCTGTAACCTTGGTCAAGG + Intergenic
977860229 4:101949026-101949048 CATTTGTCTCACCTTGGTCCTGG + Intronic
978645986 4:110932191-110932213 CACTGCTCCCACCTTGGTCAAGG - Intergenic
980740055 4:136938895-136938917 CATGGCTAACACCTTGATCGTGG + Intergenic
981071357 4:140543529-140543551 CATCTCTATAACCTTGTTCCTGG + Exonic
982428483 4:155295359-155295381 CTTTGCTAACACCTTGGTCTCGG - Intergenic
987362643 5:17121107-17121129 CTTTGCTATCACCTTAGTTCAGG - Intronic
991386248 5:66093521-66093543 CAATGATATCACCTTGACCCTGG + Intergenic
992615027 5:78539253-78539275 CACTGCTGGCACCTTGGTCTTGG + Intronic
995858925 5:116621582-116621604 CTTTGCTATCAGCTGGGCCCAGG + Intergenic
996826214 5:127684019-127684041 CCTTGCTGACACCTTGATCCTGG - Intergenic
996951433 5:129130902-129130924 CATTTCTATGACATTGGTCTGGG - Intergenic
998168449 5:139857913-139857935 CATTGCTTCCAACTTAGTCCAGG + Intronic
998457326 5:142283431-142283453 CACTCATCTCACCTTGGTCCTGG + Intergenic
999644647 5:153705720-153705742 CTTAACTATCACTTTGGTCCGGG + Exonic
1002123283 5:177022463-177022485 CATGGCTCTCACCTTGCTCACGG - Intronic
1003560231 6:7173872-7173894 CATTGCTGTCTCCTTAGACCTGG + Intronic
1004176038 6:13341050-13341072 CACTGCTGTCCCCCTGGTCCTGG - Intergenic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1004879484 6:19993171-19993193 CACTGCAATCACCATAGTCCAGG - Intergenic
1008494465 6:52118598-52118620 CATACCTATCACCTTTGACCTGG + Intergenic
1009786467 6:68346572-68346594 CATTGCTAGCACCTTGATCTTGG + Intergenic
1011706098 6:90003013-90003035 CACTGCTATCACCCTGGTGTAGG + Intronic
1012356363 6:98319092-98319114 CAGTGCTACCACTTTGTTCCTGG + Intergenic
1013107052 6:107034661-107034683 CATTGTTTTCACCGTGGGCCAGG - Intronic
1013254455 6:108370586-108370608 CATTGCCATCACCTTGTACCTGG - Intronic
1013520489 6:110928309-110928331 CTTTGCTCTCACCTAGGTACAGG - Intergenic
1016363493 6:143292023-143292045 CATTTCTACCACCAGGGTCCAGG - Intronic
1018482092 6:164201188-164201210 CATTGATTGCCCCTTGGTCCTGG + Intergenic
1020397388 7:7731419-7731441 CACTGCTATCACTTTAGTCCAGG - Intronic
1022297520 7:29069725-29069747 CATTGCTATCCCCTGGGGCTCGG + Intronic
1023752925 7:43388989-43389011 CATCACTGGCACCTTGGTCCAGG - Intronic
1027905438 7:84174329-84174351 CATTGCTGGCAACTTGGACCTGG - Intronic
1027981033 7:85222750-85222772 CATAGTTATCTCCTAGGTCCTGG - Intergenic
1028586773 7:92459723-92459745 CACTCCTATCCCTTTGGTCCTGG + Intergenic
1029133501 7:98351435-98351457 CTTTGCTAGCAGCTGGGTCCTGG + Intronic
1029185299 7:98734105-98734127 CACTTCTCTCACCTTAGTCCTGG + Intergenic
1030136375 7:106254724-106254746 CATTGCTGTCACTGTGGTTCTGG + Intronic
1036757631 8:11481765-11481787 CATTGCTATCAGCTGGGACGAGG - Intergenic
1037898525 8:22674120-22674142 CTTTGCTCCCACCTTGGTGCTGG + Intergenic
1038207252 8:25478326-25478348 CATTCCTATCAGTGTGGTCCAGG + Intronic
1040957722 8:52996597-52996619 CATTGCCAGCACCTTGATCTTGG - Intergenic
1041009903 8:53531417-53531439 CATTGCTACTACCTCCGTCCTGG - Intergenic
1043064803 8:75555137-75555159 CATTGCTACCACCCTAGTCCAGG - Intronic
1043588391 8:81796249-81796271 CCTTGCCATCACCTTGATCTTGG + Intergenic
1044655103 8:94539959-94539981 GATTGCTGTCACCTTGATACTGG + Intronic
1046975539 8:120271981-120272003 CATTGCTACCACCCTAGTCCAGG - Intronic
1050354584 9:4770630-4770652 CATTGCCATCACCATGATCCAGG + Intergenic
1054752301 9:68920191-68920213 CATTACTATCCCCCTGGTACAGG - Intronic
1058323837 9:103670215-103670237 CACTGCTTTGACCCTGGTCCTGG - Intergenic
1058754341 9:108070561-108070583 CATTGCTCCCCCCTTGGTACAGG - Intergenic
1058848662 9:108988395-108988417 ACTTTCTACCACCTTGGTCCAGG + Intronic
1059112301 9:111568862-111568884 CCCTGCTACCACCCTGGTCCAGG - Intronic
1061750364 9:132772869-132772891 CACAGCTACCACCCTGGTCCAGG + Intronic
1186376340 X:9005792-9005814 CATTGTTATTACCTTAGTTCTGG + Intergenic
1189808743 X:44761532-44761554 CATCGCTATCCACTTGTTCCAGG + Intergenic
1191709939 X:64139042-64139064 CATTGCTACCACCTTAGTCCAGG + Intergenic
1199419792 X:147631737-147631759 CACTGCCAACACCTTGGTCTCGG - Intergenic
1200327430 X:155256653-155256675 CATTGATACCACGTTTGTCCAGG - Intergenic
1200501138 Y:3951233-3951255 CTTTGCTAACATCTTGATCCTGG + Intergenic