ID: 1078961444

View in Genome Browser
Species Human (GRCh38)
Location 11:16277308-16277330
Sequence CCTCACATGGTGGAGTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 1, 2: 5, 3: 48, 4: 308}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078961444_1078961452 -8 Left 1078961444 11:16277308-16277330 CCCACCCACTCCACCATGTGAGG 0: 1
1: 1
2: 5
3: 48
4: 308
Right 1078961452 11:16277323-16277345 ATGTGAGGATGCCAGGATGCAGG 0: 1
1: 0
2: 1
3: 46
4: 272
1078961444_1078961455 17 Left 1078961444 11:16277308-16277330 CCCACCCACTCCACCATGTGAGG 0: 1
1: 1
2: 5
3: 48
4: 308
Right 1078961455 11:16277348-16277370 GAAGACAGAGATCTTCAAGCAGG 0: 1
1: 0
2: 2
3: 19
4: 285
1078961444_1078961453 -7 Left 1078961444 11:16277308-16277330 CCCACCCACTCCACCATGTGAGG 0: 1
1: 1
2: 5
3: 48
4: 308
Right 1078961453 11:16277324-16277346 TGTGAGGATGCCAGGATGCAGGG 0: 1
1: 0
2: 2
3: 36
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078961444 Original CRISPR CCTCACATGGTGGAGTGGGT GGG (reversed) Intronic
900437606 1:2639021-2639043 CTCCACATGGTGGAGGGGCTTGG + Intronic
900874175 1:5329802-5329824 CCTCACATGGTGGAAGGGGAAGG + Intergenic
901133793 1:6979832-6979854 CCTCTCATGGTGGTGTAGCTGGG + Intronic
901528035 1:9836234-9836256 CCACACATGGTGGAGGGCGGGGG + Intergenic
902311087 1:15582340-15582362 CCTCACATCATGCAGTGAGTAGG + Intronic
902759644 1:18572821-18572843 CCTTAGATGATGGAGTGGCTGGG - Intergenic
902893878 1:19465312-19465334 CCTCACATGGTGGAAGGGGCTGG - Intronic
902899757 1:19506784-19506806 CCCCACATGGTGGAAGGGGCTGG + Intergenic
905945395 1:41897452-41897474 CCTCAGATGGTGGAGGGGTAGGG - Intronic
907008217 1:50937395-50937417 CTTCATATGGTGGGGTGGGGCGG + Intronic
908158935 1:61386953-61386975 CCTCACATGGCAGAAGGGGTGGG + Intronic
908454666 1:64291469-64291491 CCTCACATGGTGGAGAGAGAGGG + Intergenic
909662017 1:78094573-78094595 CCATTCTTGGTGGAGTGGGTTGG + Intronic
911461967 1:98202742-98202764 CCTCACATGGCAGAGAGGGGGGG - Intergenic
912704952 1:111904808-111904830 CCTCACACAGTGGAGCGGGGAGG + Intronic
913050289 1:115111658-115111680 CCTCACATGGTAGAAGGGGAAGG - Intergenic
913153988 1:116076246-116076268 CCTCTCCTGGTGGACTGGATTGG - Intergenic
913386206 1:118260704-118260726 CCTCACATGGTAGAAGGGGCTGG - Intergenic
915476503 1:156155790-156155812 CTTGGCATGGTGGGGTGGGTGGG - Intronic
915518323 1:156426753-156426775 TTTCTGATGGTGGAGTGGGTGGG - Intronic
916354121 1:163885126-163885148 CCACACATAGTGTAGCGGGTAGG + Intergenic
917303307 1:173601800-173601822 CCTAACTTGATGGAGTGGTTTGG + Exonic
917469449 1:175314086-175314108 TCTCCCATGCTGGAGTGGGCAGG - Intergenic
918095145 1:181328239-181328261 CCTCACATGGTGGAAAGGTAAGG + Intergenic
919343861 1:196349624-196349646 CCTCACTTTGTGGAGTAGATGGG + Intronic
920369650 1:205470208-205470230 TCTCCCATGTTGGAGAGGGTGGG + Intergenic
920837775 1:209527933-209527955 CCTGGCATAGTGGAGTGGTTTGG + Intergenic
921771988 1:219051181-219051203 TGTCACATGGTGGAGTAAGTGGG - Intergenic
924183050 1:241458495-241458517 TCTCACATCGTGGAGTGGAACGG - Intergenic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1062909887 10:1205624-1205646 CCTCCCATGGTGGAAGGGGCTGG - Intronic
1063230951 10:4065201-4065223 CCTCACAGGGTGGAAGGAGTGGG - Intergenic
1063600648 10:7477686-7477708 CCTCACACGGTGAAAAGGGTGGG - Intergenic
1063695548 10:8331711-8331733 CCTCACCTGTTCGAGGGGGTCGG - Intergenic
1064796740 10:19020531-19020553 CCTCACATGGTGGAGAAAGAGGG + Intergenic
1064874519 10:19977725-19977747 CCTCACATGGCAGAGGGGGTGGG + Intronic
1064934084 10:20660688-20660710 GCTCACATGGTGGAAGGGGCTGG - Intergenic
1065068728 10:22000768-22000790 CCTCACATGGTGGTACGGGCAGG - Intronic
1066475161 10:35739567-35739589 CCTTACATGGTAGAAGGGGTGGG + Intergenic
1066534882 10:36380816-36380838 CCTGACCTGGTGGCATGGGTGGG + Intergenic
1066579198 10:36861508-36861530 CCTCATATGCTGGAGTAGCTGGG - Intergenic
1067050204 10:43011583-43011605 CCTCACATGGTGGAAGGGACAGG - Intergenic
1067457975 10:46437004-46437026 CTTCACATGGTGGAGCAGGAGGG + Intergenic
1069948887 10:72006013-72006035 CCTTTCAAGGTGGGGTGGGTGGG + Intronic
1070318400 10:75335748-75335770 CCTTCCATGGTGGTGTGGGTGGG + Intergenic
1070745719 10:78932531-78932553 CCTCACAGGGTGCAGTGTGATGG + Intergenic
1070921171 10:80187309-80187331 CCCCACATGGTGGAAAGGGTTGG - Intronic
1071071152 10:81696031-81696053 TCTCACATGGTGAAAGGGGTAGG + Intergenic
1071177237 10:82940722-82940744 CCTCACATGGTAGAAGGGGCAGG + Intronic
1071860232 10:89664828-89664850 CCTCACATGGTGGAAGGAGCAGG - Intergenic
1073300649 10:102469217-102469239 GCTAACATGGAGGAGGGGGTGGG + Intronic
1076005497 10:126945271-126945293 GCTCACATGGTGGTGTTGGCAGG + Intronic
1076915861 10:133422991-133423013 CCTAACATCCTGGAGTGGGTGGG + Exonic
1077119498 11:900284-900306 CCTCACAGGCTGGAGAGGGAGGG + Intronic
1077463867 11:2724295-2724317 CGTCACCTGGTGGAGCGGGAGGG - Intronic
1077998928 11:7477177-7477199 TCTCACATGGTGGAGAGAGAGGG - Intergenic
1078072566 11:8126658-8126680 CCTTACATGGAGGACTGGGAAGG - Exonic
1078961444 11:16277308-16277330 CCTCACATGGTGGAGTGGGTGGG - Intronic
1080698375 11:34622963-34622985 CCTCTCAAGGTAGTGTGGGTAGG + Intronic
1082066383 11:47904100-47904122 CTTCACATGGTGGAGGTGGAGGG - Intergenic
1082959181 11:58902640-58902662 CCTCACATGGTCGGGTGAGGTGG - Intronic
1083265103 11:61542940-61542962 CCTGTCATGTTGGAGTGGGAGGG + Intronic
1083722681 11:64611262-64611284 CCTAAGAGGGTGGAGGGGGTGGG - Intronic
1084208404 11:67609367-67609389 CCTCCCTGGGTGGAGTGGGGTGG + Intronic
1085075624 11:73588943-73588965 CCTCACATGGTGGATTGGAGAGG - Intronic
1089692456 11:120195385-120195407 GCTTACAGGATGGAGTGGGTGGG + Intergenic
1090882946 11:130850202-130850224 CCTCACATGGTGGAGAGAGAAGG - Intergenic
1091397317 12:161904-161926 CCTAACAACGTGGAGTGGGCAGG - Exonic
1092779076 12:11968697-11968719 CCTCCCATGGTGGTGGAGGTGGG + Intergenic
1093214126 12:16343260-16343282 CCTCACATGACGGAGGGGGCAGG - Intergenic
1093288042 12:17290076-17290098 CCTCACATGGTAGAGAGAGAAGG + Intergenic
1093315731 12:17647513-17647535 CTTCACATGGTGGAGCAGGAGGG - Intergenic
1093940070 12:25043281-25043303 CCTAGCATGGTGGGGTGGGGAGG + Intronic
1094435797 12:30419424-30419446 CCTCACATGATGGAGCAGGGAGG - Intergenic
1097504001 12:60441241-60441263 CCTTACATGCTGGAGGGGATTGG + Intergenic
1097853537 12:64437496-64437518 TGTCACATGGTGGATTTGGTGGG + Intronic
1100399941 12:94220747-94220769 CCAGACATGGTGGAGGGGGAAGG + Intronic
1100406562 12:94277195-94277217 CCTCACATGGTGGAAAGGGCAGG + Intronic
1100633240 12:96408765-96408787 CCTCCCATGGTGGAGTGCAGTGG - Intergenic
1101477715 12:105066316-105066338 TCTCTAATGCTGGAGTGGGTGGG - Intronic
1102414322 12:112747305-112747327 CCTCACATGGTGGAAGGGCAAGG - Intronic
1102670540 12:114615157-114615179 CATCACAGGGTGGAGAGGGCAGG + Intergenic
1102933910 12:116881477-116881499 TGTCACATGGTGGAGGGGGGCGG + Intergenic
1103261511 12:119593220-119593242 CCCCACCTGGGGGAGGGGGTCGG + Intergenic
1103939740 12:124495244-124495266 CCCGACATGGTGGTGGGGGTCGG + Exonic
1104021059 12:124992869-124992891 CCCCACATGCTGGAGTTGGTTGG + Intergenic
1104027228 12:125036838-125036860 CTTCACATGGTGGAGTCGAGGGG - Intergenic
1105308481 13:19185722-19185744 CATCACATGGTGGAGAGAGAAGG - Intronic
1105632076 13:22179360-22179382 CCTCACAGGGTGGAGAGAGGAGG + Intergenic
1107869920 13:44736871-44736893 CCTCACATGGTGGAAGGGAGAGG + Intergenic
1108271856 13:48769527-48769549 AATCACATGTTGGAGTGGGAGGG + Intergenic
1108436487 13:50406100-50406122 CATCACATGGTAGAGGGGTTAGG - Intronic
1108677597 13:52750680-52750702 CCTCACATGGTGGAGAGGGTGGG - Intergenic
1109752884 13:66719445-66719467 CCTCACATGGTGGAGGGCCCAGG - Intronic
1110274970 13:73632881-73632903 CCTCACATGGTGTTGTGGGTCGG + Intergenic
1111990172 13:95108575-95108597 CCTCACATGGTGGAAGGTGAAGG - Intronic
1113884530 13:113651759-113651781 CCTCACATGGCGGTGGGGGTGGG - Intronic
1116119362 14:40702860-40702882 GCTCAGCTGCTGGAGTGGGTTGG - Intergenic
1116486240 14:45452657-45452679 CCCAAGATGGTGGATTGGGTTGG + Intergenic
1117744944 14:58860207-58860229 CCTATGATGGTGGAGTGGGATGG + Intergenic
1118179618 14:63479278-63479300 TCTCCCATGGTGCTGTGGGTGGG + Intronic
1118943051 14:70356194-70356216 CCACAGATGGTGGCGGGGGTGGG + Intronic
1121317323 14:92970059-92970081 GGTCACCTGGTGGAGTGGATGGG - Intronic
1121680084 14:95786482-95786504 CCTCATATGGTGGAGAGCTTTGG - Intergenic
1122495847 14:102154371-102154393 CCTCACATGGTGGAGGGGGAAGG + Intronic
1124060896 15:26292883-26292905 CCTCACATGCTGGAGAGGGCTGG - Intergenic
1124395950 15:29301827-29301849 CCTCACATGGTGGAAGGGGCTGG - Intronic
1124577563 15:30923238-30923260 CCTCTCATGGAGGAGGGTGTGGG + Intronic
1125006370 15:34822256-34822278 CCTCACATGCTGAAGCGGGATGG - Intergenic
1125516189 15:40322733-40322755 CCTCACATGGGAAAGTGGGGAGG + Intergenic
1127008988 15:54601927-54601949 TCTCAGATGGGGCAGTGGGTGGG - Intronic
1128703806 15:69823214-69823236 CCTCAGAAGATGGAGTTGGTGGG + Intergenic
1128988743 15:72241110-72241132 CCTCACAAGGGGCAGGGGGTGGG - Intergenic
1129673976 15:77622439-77622461 ACTCACCTGGTGGAGTGGCCGGG - Intronic
1129703358 15:77780773-77780795 CCTCACATGGTGGGGGTGGGGGG - Intronic
1130562742 15:84971524-84971546 CCTCTCATGGTGGAAGGGGAAGG - Intergenic
1130679345 15:85982609-85982631 CCTCGCATAGTGCAGTAGGTTGG - Intergenic
1131345174 15:91640160-91640182 CCTCACATGGTGGAAGGGTGAGG + Intergenic
1131789203 15:95946101-95946123 CCTCACATGGTCGGGCGGGGAGG + Intergenic
1132607133 16:798336-798358 GCTCACAGGATGGAGTGAGTGGG + Exonic
1132607216 16:798614-798636 ACTCACAGGATGGAGTGAGTGGG + Exonic
1133042403 16:3067657-3067679 CCACACAGGGTGGAGTGCCTGGG - Intronic
1134662366 16:15993742-15993764 GCTCACATGCGGGGGTGGGTGGG + Intronic
1135804401 16:25529030-25529052 CCTCATATGGTGCAGGGGGAAGG + Intergenic
1136095908 16:27956501-27956523 GCTCACATGGAGGAATGGGTGGG - Intronic
1137583865 16:49652108-49652130 CAGCTCATGGTGGAGGGGGTGGG + Intronic
1137595158 16:49718738-49718760 CCTCACATGGTGGAAGGAGCTGG + Intronic
1138694352 16:58797866-58797888 CCTCATATGGTGGAAGGGGCAGG + Intergenic
1138730004 16:59184104-59184126 CCTCACATGGTGGAAGGGTGAGG + Intergenic
1139336441 16:66235032-66235054 CCTCACATGGTGAAGGGAGAAGG - Intergenic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1140694030 16:77514082-77514104 CCTCACATGGTGGAAGGAATGGG + Intergenic
1140743536 16:77962216-77962238 CCCCTCCTGGTGGTGTGGGTGGG - Intronic
1142510055 17:387271-387293 CCTCTCATGGTGGGTGGGGTGGG + Intergenic
1143316897 17:6039725-6039747 CCTCACATGGTGGAAGGTGGAGG + Intronic
1144237359 17:13274510-13274532 CCTCTCATGGTGGAAGGGGAAGG - Intergenic
1144728735 17:17514768-17514790 CTGCAGATGGTGGAGTGGGAGGG + Intronic
1144865389 17:18332319-18332341 CCGCACATGCAGGATTGGGTGGG + Intronic
1145837529 17:27965862-27965884 CCTCACATGGTGGAAGGGGCAGG + Intergenic
1149600343 17:57889301-57889323 CCTCACAGGGGGGATGGGGTAGG + Intronic
1150644686 17:66970606-66970628 GCTCACATGGTGGAGAGAGAGGG + Intronic
1151219009 17:72597895-72597917 TCACACATGGGGGAGTGGGATGG - Intergenic
1151414372 17:73952185-73952207 CCTCTCATGGGGGAGAGGTTTGG - Intergenic
1151429912 17:74055496-74055518 CCTCACATGGTGGGGTGGGGTGG - Intergenic
1151913202 17:77098079-77098101 CCTCACATGGAGGAAAGTGTGGG + Intronic
1152133025 17:78488613-78488635 CCACACATGGTACAGTGGGTAGG + Intronic
1152283759 17:79400581-79400603 CCTCACAAGGTGTTGGGGGTGGG + Intronic
1152600612 17:81260378-81260400 CCTCAGGTGGTGCTGTGGGTCGG - Exonic
1155159680 18:23185479-23185501 GGTCACATTGTTGAGTGGGTGGG + Intronic
1155216432 18:23647557-23647579 CCTCCCAGGCTGGAGTGGGATGG + Intronic
1156424791 18:36998186-36998208 CCTAAGGTGGTGGATTGGGTTGG - Intronic
1157576165 18:48745272-48745294 CCTGACATGGTGCACTGGGAAGG - Intronic
1158703169 18:59767298-59767320 CCTCACATGGTGGAAGGCGCTGG - Intergenic
1160082492 18:75742232-75742254 CCTCACATGGTGGCATGGCAGGG + Intergenic
1160669288 19:349347-349369 CCTCACATGGCAGAGGGGATGGG + Intergenic
1161398930 19:4059149-4059171 CCCCCCATGCTGGGGTGGGTAGG - Intronic
1163182176 19:15612285-15612307 TCACACATGGTGGAGTGGCAGGG - Intergenic
1164956770 19:32392978-32393000 TCTCTAATGGTGGAGGGGGTGGG + Intergenic
1166449666 19:42887557-42887579 CCACTCATGGTGGAATGGGAAGG - Intronic
1166478255 19:43147842-43147864 CCACTCATGGTGGAATGGGAAGG - Intronic
1166530587 19:43540866-43540888 CCCCACATGGTGGCTTTGGTAGG + Intergenic
1167800151 19:51735388-51735410 CCTCACATGGTGGTGGGGGCAGG + Intergenic
1168521612 19:57055602-57055624 CCTCACATGGCAGAGGTGGTGGG + Intergenic
926784117 2:16503249-16503271 CCTCACATGGTGGAAGGGATAGG + Intergenic
927601911 2:24450452-24450474 CCTCACATGGCAGAAGGGGTGGG - Intergenic
928309748 2:30199552-30199574 CCTCACATGTTGGAATGGGAAGG - Intergenic
928934632 2:36662777-36662799 TCCCACATGGTGGAGTGGCCGGG - Intergenic
929783847 2:44975143-44975165 CATCACATGGTGGAAAGGGCAGG - Intergenic
930851743 2:55968471-55968493 CCTCACATGGTGGAGGGGTGGGG - Intergenic
932326888 2:70869150-70869172 CATCACATGGTGGAGGGGCCAGG - Intergenic
932639767 2:73432600-73432622 CCTCCCATGGTGGAAGGGGCAGG + Intronic
933238367 2:79890891-79890913 CATCACATGGTGGAAGGGGCAGG + Intronic
933560551 2:83880320-83880342 CTTCACATGGAGGTGTGGGTTGG - Intergenic
935314541 2:101818642-101818664 GCTCAGATGGTGGAGTGGGCAGG + Intronic
935524426 2:104148032-104148054 CCTCACATGGTGGAAGGGGCTGG - Intergenic
935809658 2:106785200-106785222 CCTCACATTGTGGAAGGGGCAGG + Intergenic
936467576 2:112766926-112766948 CCTCCCATGCTGGAGTGCGGTGG - Intergenic
936927698 2:117754580-117754602 ACACACATGCTGGAGTTGGTGGG + Intergenic
937077660 2:119118552-119118574 CCTGAAATGGTGGATGGGGTGGG + Intergenic
937138547 2:119577172-119577194 CCTCACATGGGGTGGTGGGGAGG + Intronic
938015064 2:127859989-127860011 CAGCACATGGTGCAGTGGCTGGG - Intergenic
938382279 2:130843401-130843423 TCCTGCATGGTGGAGTGGGTGGG + Intronic
939976192 2:148719962-148719984 CCCCACAAGGAGGAGTGGATTGG + Intronic
947288640 2:228546569-228546591 GCTCACATGGTGGAAGGGGCTGG + Intergenic
947361788 2:229352848-229352870 CCTCACATGGTGGAAGGGACAGG - Intergenic
947385165 2:229584273-229584295 CCTCACCTGGAGGATGGGGTAGG - Intronic
948317703 2:237041656-237041678 CCTCACATGGTGGAAGGGGCAGG + Intergenic
948371473 2:237492302-237492324 CATCACATAGTGCATTGGGTGGG + Intronic
948398248 2:237663430-237663452 CCTCACATGGCGGGATGGGGGGG - Intronic
1169606277 20:7323134-7323156 CCTCACATGGTGGAGGGTGAGGG + Intergenic
1170064173 20:12292625-12292647 CCTCACATGGTGGAAGGGACAGG - Intergenic
1172911952 20:38416130-38416152 CCTCATATGGTGGAGAGCGAGGG - Intergenic
1174650416 20:52120101-52120123 CCACACATGGTGGAAGGGGAAGG - Intronic
1175393975 20:58646022-58646044 CCCCACACGGTGGACAGGGTAGG + Intergenic
1175466649 20:59194181-59194203 CCTCACACGTTGGAGTGGGCGGG - Exonic
1175828417 20:61949572-61949594 CCTCACATGGTGGAAGGTGAGGG + Intergenic
1176097881 20:63352626-63352648 CCTCAGAAGGTGGAGGGCGTTGG - Intronic
1176691874 21:9921988-9922010 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1178320192 21:31599297-31599319 AGACACATGGTAGAGTGGGTGGG - Intergenic
1178522829 21:33300716-33300738 CCTCACATGGTGGAAGAGATGGG - Intergenic
1179477915 21:41659749-41659771 CCTCAGCTGGGTGAGTGGGTAGG - Intergenic
1180870618 22:19144676-19144698 CGTCACAGGGTGGAGGGGGCGGG + Exonic
1180917907 22:19501752-19501774 TCTCACAGGCTGGAGTGTGTTGG + Intronic
1181450981 22:23020517-23020539 CCTCACATGGTGGAAGGGACAGG - Intergenic
1183943164 22:41308081-41308103 AGTCACATTGTGGACTGGGTAGG - Intronic
1184507819 22:44914693-44914715 CCTCACGTGGTGGATGGGGAAGG + Intronic
1185163877 22:49245742-49245764 CCTCACATGGTGGATAGAGGGGG + Intergenic
949122613 3:404989-405011 CCTCACATCGTGAAAGGGGTAGG + Intronic
950095918 3:10330367-10330389 CCTCACAGGGTGCAGAGGGACGG + Intronic
950157709 3:10736145-10736167 CTTCAAATGGTCGAGTGAGTTGG - Intergenic
950899766 3:16486992-16487014 CCTCACATGGCAGAGAGGGAGGG - Intronic
951735277 3:25856682-25856704 CCTCACATGGTGGAGATGGGAGG + Intergenic
953704314 3:45219821-45219843 CCACACATGGTGAAGGGGTTCGG + Intergenic
954744734 3:52780738-52780760 CCTCATATGCTGGTGTGGTTAGG + Intronic
955153860 3:56396350-56396372 CCAGGCATGGTGGAGTGGCTTGG + Intronic
956459898 3:69461506-69461528 CCTCAGCTGCTCGAGTGGGTGGG - Intronic
956900147 3:73707145-73707167 CCTCCCATGCTGAACTGGGTTGG - Intergenic
957439543 3:80225927-80225949 CCTCCCATGGTGGAAGGGATAGG - Intergenic
958637808 3:96766913-96766935 TCTCTAATGCTGGAGTGGGTGGG - Intergenic
959594234 3:108111638-108111660 CCTCACGTGGTGGAAGGGATGGG + Intergenic
959770186 3:110085665-110085687 CCTCACATGGTGGAAGGGGCAGG - Intergenic
960013478 3:112858961-112858983 TCTCTAATGCTGGAGTGGGTGGG - Intergenic
960514443 3:118588285-118588307 CCACTCATGGTGGAGGGGGAAGG - Intergenic
963713001 3:148768825-148768847 CCTCACATGGTGGAGGGGCAGGG - Intergenic
963828246 3:149979212-149979234 CTTCACATGGTGGAGCGGGAGGG - Intronic
963989368 3:151635419-151635441 CCTCACATGGTGGAAGGGGAGGG + Intergenic
965601009 3:170454647-170454669 CCTCACAGGGTGGGGTGGGGAGG - Intronic
965834667 3:172838221-172838243 ACTCAGGTGGTGGAGTGGATAGG - Intergenic
966003838 3:174983604-174983626 CCTCACATGGTGGAAGGGGCAGG + Intronic
966982219 3:185148260-185148282 CCTCACATGGTGATGTCGGTAGG - Intronic
968046534 3:195626860-195626882 CCTCACATGGGGGATGGGGGAGG - Intergenic
968308119 3:197663181-197663203 CCTCACATGGGGGATGGGGGAGG + Intergenic
968926846 4:3553050-3553072 CCAGGCATGGTGGGGTGGGTGGG - Intergenic
970082366 4:12301940-12301962 ACCCACATGGAGGAGTGGATGGG - Intergenic
971222081 4:24717553-24717575 CCTCACATGGTGGACAGGGAAGG - Intergenic
972404032 4:38730015-38730037 CCTCCCAAGGTGGAAGGGGTGGG + Intergenic
972867683 4:43255038-43255060 ACTCCCATAGTGTAGTGGGTGGG + Intergenic
973904849 4:55518666-55518688 CCTCACATGATGGAAAGGGAGGG - Intronic
975805082 4:78103692-78103714 CCTCACATGGTGAAAGGGGTTGG - Intronic
976397607 4:84572989-84573011 CCTCACATGGTGGAGAGAAAAGG - Intergenic
977823329 4:101501829-101501851 CCTCACATGGTGGAGGGAGAGGG + Intronic
978469871 4:109053508-109053530 CCTCACATGATCGTGAGGGTGGG + Intronic
980364460 4:131782191-131782213 CCTCACATGGTGGAAGAGGGAGG - Intergenic
983871739 4:172831830-172831852 CTTCACATGGTGGAGAGAGAAGG - Intronic
985745101 5:1642402-1642424 CCTCACATGGCGGACGGGGGAGG + Intergenic
986634849 5:9811168-9811190 CCTCGCATGGTGAAGTGTCTGGG - Intergenic
986892510 5:12326731-12326753 TCTCTAATGCTGGAGTGGGTGGG + Intergenic
987003660 5:13687592-13687614 TCTTACATGGTGGAAGGGGTGGG - Intergenic
988393694 5:30669258-30669280 CTTCACATGGTGGTGTCAGTAGG - Intergenic
988713502 5:33802053-33802075 CCTTACATGGTAGAATGGGAAGG - Intronic
989107961 5:37880971-37880993 CCCCAGATGCTGGAGTGCGTTGG + Intergenic
990064213 5:51692601-51692623 CCTCACATGATGGAGAGAGAAGG + Intergenic
990366377 5:55074932-55074954 CATCACAGGGTAGAGTGGGAAGG - Intergenic
990473779 5:56142370-56142392 CCTCACAGGGTGGAATCGCTGGG - Intronic
991042976 5:62194619-62194641 CCTCAGAAGGGGAAGTGGGTAGG - Intergenic
991084780 5:62638700-62638722 TCTCACATGGTGGGAGGGGTGGG - Intergenic
991582813 5:68174465-68174487 CCTCACATGGTGGAAGGGCAAGG + Intergenic
991947763 5:71916308-71916330 CCACTCATGGTGGACTGGGCTGG - Intergenic
993545773 5:89211348-89211370 CCTCACATGGTTGAAGGGATGGG - Intergenic
993699098 5:91097237-91097259 CCTCACATGGTGGAAGGGGCAGG + Intronic
994810227 5:104507865-104507887 CCTCACATGGTAGAAGGAGTAGG - Intergenic
998666995 5:144308746-144308768 CCTCAGATTGTGGGGTGGGGTGG + Intronic
999869297 5:155732472-155732494 TCTCAAATGGTAGAGTGGGGAGG - Intergenic
1001162848 5:169336623-169336645 ACACACATGGTGGTGGGGGTAGG + Intergenic
1001360693 5:171083323-171083345 CCTTACATGGTGGAAGGAGTGGG - Intronic
1001630421 5:173170891-173170913 CCTTGCATGGTGGAAGGGGTCGG - Intergenic
1003233282 6:4273713-4273735 CCTCACAAGGTTGAGAGGATTGG - Intergenic
1003946213 6:11078263-11078285 CCTCACATGGTGGAAGGGCAAGG - Intergenic
1004959676 6:20772844-20772866 CCTTACCTGGTGGACTGGGGAGG - Intronic
1005527494 6:26665315-26665337 CCACAGATGGTGGAGGGGGATGG - Intergenic
1006034408 6:31200312-31200334 CCTCACGTGGTGAAGAGAGTGGG - Intronic
1006830187 6:36963748-36963770 CCTTGCATGGTGGGGTGGGCGGG + Intronic
1009947413 6:70355908-70355930 CCTCACATGGTGGAAGGGCAAGG - Intergenic
1011484109 6:87824330-87824352 CATTTAATGGTGGAGTGGGTGGG + Intergenic
1012926621 6:105274273-105274295 CCTCACATGGTGGAAGGGATGGG + Intergenic
1014074832 6:117223990-117224012 TCTCTAATGCTGGAGTGGGTGGG + Intergenic
1015169890 6:130240762-130240784 CCTCACATGGTGGAAGGGCAAGG - Intronic
1015895348 6:138011389-138011411 CCAAACACGGTGGACTGGGTTGG + Intergenic
1015975590 6:138787286-138787308 CCTCACATGGTAGAAGGGGTAGG - Intronic
1016226272 6:141742333-141742355 CCTGTCATGGTGGAATGGGGAGG + Intergenic
1017480154 6:154845417-154845439 CATTACAGGGTGGAGTTGGTAGG - Intronic
1017595645 6:156025901-156025923 CCTCACATGGTGGAGGGGGAGGG - Intergenic
1017945514 6:159093866-159093888 CCTCACAGGATGGATTGGGGTGG - Intergenic
1018229720 6:161663885-161663907 CTGCACATGGGGGAGTGGCTTGG + Intronic
1018368341 6:163145082-163145104 TCTCTCATGGTGGGTTGGGTGGG - Intronic
1018475314 6:164134778-164134800 ACTCCCATGGTGGCGTGGTTTGG + Intergenic
1018837266 6:167494359-167494381 TTTCACATGGTGGAGTGGCGGGG + Intergenic
1019800294 7:3083415-3083437 CCTCAGCTGGTGGGGTGGGCAGG - Intergenic
1021062462 7:16130933-16130955 CCTCACATGGTGGAAGGGTGTGG - Intronic
1021291481 7:18850860-18850882 CCTCACATGGTGGAAGGGTGAGG + Intronic
1021560068 7:21960881-21960903 CCTCACATGGTGGGGGGTGGGGG - Intergenic
1024259049 7:47560259-47560281 CCTCACATGGTAGAGGGGTGAGG - Intronic
1024390588 7:48807204-48807226 CCTCACATGGTGAAGGGGCAAGG - Intergenic
1024617681 7:51129304-51129326 GCTCACATGGTGGAAGGGGCGGG + Intronic
1028906522 7:96160566-96160588 CCTCACATGGAGGAAGGAGTGGG + Intronic
1029972454 7:104802543-104802565 CCTCACATGGTGGAAGGGGAGGG - Intronic
1031927658 7:127653098-127653120 GGTCACATGGTGGTTTGGGTTGG + Intronic
1031979848 7:128117428-128117450 CATCACATGGGGGAGAGAGTTGG + Intergenic
1032681686 7:134191102-134191124 CCTCAGGTGGTGGAGGGGATGGG + Intronic
1032742045 7:134748938-134748960 CCTCACATGGTGAAAGGGGTGGG - Intronic
1034362249 7:150510305-150510327 CCCCACATGGTGGAAGGGGCGGG - Intergenic
1034530566 7:151693750-151693772 CCTCACATGGTGGAAGGAGGAGG - Intronic
1034949835 7:155289838-155289860 CCTCACATGGTGAAGGGGCCAGG + Intergenic
1035850557 8:2915343-2915365 CCTCCCATCGTGGAATGAGTAGG + Intergenic
1036567272 8:9948252-9948274 CCCCCCAGGGTGGTGTGGGTTGG - Intergenic
1038566309 8:28622636-28622658 CCTCCCAGGGGGCAGTGGGTGGG + Intronic
1039083679 8:33758947-33758969 CCTCACATGGTGGTAAGGGAAGG + Intergenic
1040862061 8:52008931-52008953 CCTTACATGGTGGAGTGGGGAGG - Intergenic
1041156447 8:54992147-54992169 CCTCACATGGTGGTTGGGGTGGG + Intergenic
1042659674 8:71140849-71140871 CCTCACATGATGAAAGGGGTGGG + Intergenic
1042820227 8:72922565-72922587 CCTCACATGGTGGAAAAGGCAGG + Intronic
1042844804 8:73159086-73159108 CCCCACATGGAGGAGTGGGCTGG + Intergenic
1042935223 8:74051703-74051725 CCTCACGTGTTGGAGAGGGAAGG - Intergenic
1045658464 8:104411289-104411311 CCTCACATGGTGGAGGCGAGGGG - Intronic
1046381881 8:113461396-113461418 CCTCGCATGGTGGAAAGGGCAGG - Intergenic
1047776317 8:128073645-128073667 CCTCACAAGTTGAAATGGGTTGG - Intergenic
1048148851 8:131873179-131873201 TCTCAGATGGTGGAGTGGAAGGG + Intergenic
1048750778 8:137671754-137671776 CATCAGATGGTGGATTGGCTGGG - Intergenic
1049459030 8:142713506-142713528 CCTCACATGGTGGAGAGAGAAGG - Intergenic
1052474178 9:28937591-28937613 CCACCCATGGCTGAGTGGGTGGG - Intergenic
1053603381 9:39632459-39632481 ACTAACAGGGTGGAGTGGGGAGG - Intergenic
1053628811 9:39908081-39908103 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1053752376 9:41269413-41269435 TCTCAGGTGGAGGAGTGGGTGGG - Intergenic
1053777257 9:41558263-41558285 CCTCACATGGTGGAAGAGGGAGG + Intergenic
1053801765 9:41768432-41768454 CCGGGCATGGTGGGGTGGGTGGG - Intergenic
1053861013 9:42386179-42386201 ACTAACAGGGTGGAGTGGGGAGG - Intergenic
1054143442 9:61546394-61546416 CCAGGCATGGTGGGGTGGGTGGG + Intergenic
1054190199 9:61980586-61980608 CCGGGCATGGTGGGGTGGGTGGG - Intergenic
1054215076 9:62342621-62342643 CCTCACATGGTGGAAGAGGGAGG + Intergenic
1054250157 9:62709965-62709987 ACTAACAGGGTGGAGTGGGGAGG + Intergenic
1054257904 9:62833745-62833767 TCTCAGGTGGAGGAGTGGGTGGG - Intergenic
1054364475 9:64320223-64320245 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1054564267 9:66744494-66744516 ACTAACAGGGTGGAGTGGGGAGG + Intergenic
1054672405 9:67812728-67812750 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1057684860 9:97222385-97222407 CCTCAGGTGGAGGAGTGGGCGGG - Intergenic
1057977511 9:99621949-99621971 CCTCACATAGTTGCCTGGGTTGG - Intergenic
1059523009 9:114961640-114961662 CATCACCTGATGTAGTGGGTAGG - Intergenic
1062122373 9:134840777-134840799 CCTCACAGGGTGGAGTCTCTCGG + Intronic
1062373473 9:136252025-136252047 CTTCCCAGGGTGGACTGGGTGGG - Intergenic
1062373580 9:136252311-136252333 CTTCCCAGGGTGGACTGGGTGGG - Intergenic
1062725987 9:138073852-138073874 CATCACTTGGTGGAGGGGCTTGG + Intronic
1202800871 9_KI270719v1_random:174635-174657 TCTCAGGTGGAGGAGTGGGTGGG + Intergenic
1203697147 Un_GL000214v1:109271-109293 CCTCAGGTGGAGGAGTGGGCGGG - Intergenic
1203552066 Un_KI270743v1:171758-171780 CCTCAGGTGGAGGAGTGGTTGGG + Intergenic
1185938702 X:4288777-4288799 CCTCACTTGGTGATGTGGTTTGG + Intergenic
1186724062 X:12338062-12338084 CTTCACATGGTGGAGTATGAAGG + Intronic
1187484212 X:19686677-19686699 CTTCCCATGGTGGAGTGGCAAGG + Intronic
1187529678 X:20085016-20085038 CCTCACAATCTGGAGTGGGAAGG + Intronic
1188070427 X:25711631-25711653 CCTGTAATGGGGGAGTGGGTGGG + Intergenic
1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG + Intronic
1188678215 X:32969072-32969094 CCTCACATGGTGGAGGGGAAAGG - Intronic
1188791592 X:34413233-34413255 CCTCACAGGGTGGAGTCTGCTGG + Intergenic
1193136954 X:77983014-77983036 CCTCACATGGTGGAAGGGACAGG + Intronic
1193696392 X:84711476-84711498 TCTCTAATGCTGGAGTGGGTGGG - Intergenic
1194207040 X:91022155-91022177 CCTCACATGATGGAAGGGATAGG - Intergenic
1196695309 X:118605340-118605362 ACTCACATGGTGCAGTTGATAGG - Exonic
1197236181 X:124067270-124067292 CCTCAGAAGGTGGTGGGGGTGGG - Intronic
1198269816 X:135046224-135046246 GTTCACATGGTGGACTGGGTAGG - Intergenic
1199959238 X:152766730-152766752 CCACTCATGCAGGAGTGGGTAGG + Exonic
1200552788 Y:4596925-4596947 CCTCACATGATGGAAGGGATAGG - Intergenic
1200761047 Y:7039421-7039443 CTTCACATGGTGGAATGTGCAGG + Intronic
1201153344 Y:11107328-11107350 CCTCAGGTGGAGGAGTGGGCGGG + Intergenic
1201721953 Y:17108797-17108819 CCTCACTTGGTGGTATGGTTTGG + Intergenic