ID: 1078965464

View in Genome Browser
Species Human (GRCh38)
Location 11:16335217-16335239
Sequence CTATTCAGTGATTCAAGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078965461_1078965464 -1 Left 1078965461 11:16335195-16335217 CCATGAGTCTTCCTAGAAAATAC 0: 1
1: 0
2: 0
3: 24
4: 210
Right 1078965464 11:16335217-16335239 CTATTCAGTGATTCAAGGTAAGG 0: 1
1: 0
2: 0
3: 4
4: 114
1078965460_1078965464 0 Left 1078965460 11:16335194-16335216 CCCATGAGTCTTCCTAGAAAATA 0: 1
1: 0
2: 3
3: 25
4: 264
Right 1078965464 11:16335217-16335239 CTATTCAGTGATTCAAGGTAAGG 0: 1
1: 0
2: 0
3: 4
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078965464 Original CRISPR CTATTCAGTGATTCAAGGTA AGG Intronic
905056375 1:35097488-35097510 GTATTCAGTGATGCATGGTATGG - Exonic
910364579 1:86450889-86450911 ATCCTCAGTGATTCATGGTAGGG + Intronic
910435374 1:87200692-87200714 GTATTCAGTGGGTCAGGGTAGGG + Intergenic
910883138 1:91940620-91940642 CCAATGAGTGACTCAAGGTAGGG + Intergenic
912006769 1:104912705-104912727 ATAATCAGAGATACAAGGTAAGG + Intergenic
912585752 1:110763296-110763318 GAATTCAGAGATACAAGGTATGG + Intergenic
918036804 1:180881591-180881613 CTATGCAGTACTTCAATGTATGG + Intronic
924662341 1:246032721-246032743 ATTTTTAGTGATTCAAGGTCAGG + Intronic
1066542856 10:36467832-36467854 ATATTCAGAGCTCCAAGGTAGGG + Intergenic
1068713829 10:60164624-60164646 CTACTCATTGATTCAAGCTTTGG - Intronic
1076398478 10:130160053-130160075 CTTTTCTGTTTTTCAAGGTAAGG + Exonic
1078965464 11:16335217-16335239 CTATTCAGTGATTCAAGGTAAGG + Intronic
1079306388 11:19327191-19327213 CCAATCAGTGAGTCAAGGCAAGG - Intergenic
1081099410 11:38983379-38983401 CTATTGAATTATTCAAGGTTGGG - Intergenic
1081731820 11:45377104-45377126 ATATTCAGTGAGACAATGTATGG + Intergenic
1084299705 11:68239981-68240003 CTATTCAGTCATTCAAAAGAAGG - Intergenic
1088712514 11:112521482-112521504 CTATTCATTCATTCAAAGAAAGG - Intergenic
1089755635 11:120684398-120684420 CCATTCAGTTATTCATAGTATGG + Intronic
1090172931 11:124620683-124620705 CTATTCAGTGATTAGCTGTAAGG - Intergenic
1093979591 12:25461182-25461204 ATATTCAGTATTTCACGGTATGG + Intronic
1096116252 12:49057177-49057199 CCATTCAGTCATTCAAGGCCTGG + Intronic
1097161711 12:57050757-57050779 CTATTCAGTGAGGCAATGCAAGG - Exonic
1099037073 12:77601888-77601910 TTAATAAGTGATTGAAGGTAGGG + Intergenic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1102422423 12:112814547-112814569 CTACTCAGTGGTTCCAGGTCTGG + Intronic
1108959099 13:56200895-56200917 GTATTCTGTGATTAAAGATAAGG - Intergenic
1109357990 13:61257108-61257130 CTGTTTAGTGATTCAAATTAGGG - Intergenic
1112994998 13:105563173-105563195 ATATTCAGAGATTTAAGGTAGGG + Intergenic
1114036235 14:18631161-18631183 CTATTCACTGATGCACTGTATGG - Intergenic
1114122401 14:19683874-19683896 CTATTCACTGATGCACTGTATGG + Intergenic
1114849790 14:26370119-26370141 CCATTCAGTACTTCAATGTAAGG - Intergenic
1117948975 14:61061683-61061705 CTATTCAGTGCTACAAAGAAAGG - Intronic
1121582628 14:95042177-95042199 CTATTCAGTGGTCCAAGGCGAGG - Intergenic
1123131705 14:105991932-105991954 CTATTCAGTGATTTAGGTTCGGG + Intergenic
1125156836 15:36597172-36597194 CTATTCGGTGATTCACTGAAAGG + Intronic
1125287768 15:38112489-38112511 TGGTTCAGGGATTCAAGGTAAGG - Intergenic
1129049850 15:72771686-72771708 CTATTCCTTGATTCAACTTATGG - Intronic
1129206203 15:74038342-74038364 CTATACAGTGAATTAAGGGAGGG + Intronic
1133938650 16:10289415-10289437 CTATTCAGAGATTCAACTTCTGG + Intergenic
1135979006 16:27132093-27132115 CTGTACAGTGATTCAGGGAAAGG - Intergenic
1138779213 16:59762635-59762657 CTATTCAGAGATTCTACTTAGGG - Intergenic
1139681716 16:68570099-68570121 CTATTGAGTGATGCAAGAAATGG - Intronic
1149085217 17:52708753-52708775 CCTTTGAGTGATACAAGGTAAGG + Intergenic
1155495120 18:26435369-26435391 ATATTCAATGATTCATGTTAAGG + Intergenic
1163147336 19:15389348-15389370 CTATTAAGTGATCCAACATACGG + Intronic
1164098588 19:22034201-22034223 CTATTAGCTGATTCCAGGTATGG + Intergenic
1164118464 19:22244432-22244454 CTATTGGCTGATTCCAGGTACGG + Intergenic
925632619 2:5910765-5910787 GTATTTAGGGAATCAAGGTATGG - Intergenic
926642145 2:15248761-15248783 CTATTCAGGGATTCAACTTCTGG - Intronic
929479184 2:42286714-42286736 CTTTTCTATGATTCAAGGTAAGG - Intronic
932039167 2:68280906-68280928 ATTTTCAGAGATTCATGGTAAGG + Intergenic
933902574 2:86860644-86860666 CAATTCAGTGGTTCAAAGTCAGG - Intronic
935250244 2:101254323-101254345 CTATACAGTGAGTCAAGGCTAGG + Intronic
935777973 2:106488624-106488646 CAATTCAGTGGTTCAAAGTCAGG + Intergenic
938119236 2:128622262-128622284 TTATTCAGTGATGCATGTTAGGG - Intergenic
940143914 2:150524712-150524734 CTATACAATGCTTCAAGGGATGG + Intronic
941158319 2:162005227-162005249 CTATTCAGTGATTTAGGTTTAGG + Intronic
943916877 2:193646007-193646029 TTATTCAGTTATTCAAAGCATGG + Intergenic
944150445 2:196552820-196552842 CTCTTCAGTGAATCAGGGAAAGG + Intronic
947302127 2:228700026-228700048 CTTTTCAGTGATTCCAGATGAGG + Intergenic
948113010 2:235472013-235472035 CTCTTAGGTGATTAAAGGTAGGG - Intergenic
1173465547 20:43278371-43278393 CTACTGAGTGATTCTAGGTCTGG + Intergenic
1175597890 20:60250007-60250029 CTATTGATTGATTCATTGTAGGG - Intergenic
1179088965 21:38245903-38245925 CAGTACAGTGATTCAAGGTGAGG + Intronic
1179682153 21:43030375-43030397 CTAATTAGGGATTCAAGGTGGGG - Exonic
1180371984 22:12047952-12047974 ATTTACAGTGTTTCAAGGTATGG + Intergenic
1180460363 22:15558221-15558243 CTATTCACTGATGCACTGTATGG - Intergenic
1183137724 22:35905707-35905729 CTGTTCAGTGTTTCACTGTATGG - Intronic
949929772 3:9069502-9069524 CTATTCAGGGAGTCTAGGGAAGG + Intronic
950930880 3:16787847-16787869 CTATTCCCTGCTTCAAGGGAAGG + Intergenic
957512750 3:81210924-81210946 CTTTTCAGTGAGTGGAGGTAGGG - Intergenic
959806305 3:110558204-110558226 CCATTCACTGATACAAGATATGG + Intergenic
967709036 3:192684641-192684663 CTTTTCAGTGATTCAAAATCAGG + Intronic
971772839 4:30920834-30920856 CTATTCAGTGATCATAGGAAAGG - Intronic
976741013 4:88357662-88357684 CTTTTCAGTCATTCGTGGTATGG - Intergenic
976921481 4:90449411-90449433 CTATTCCCAGATTCAAGGTGGGG + Intronic
984141793 4:176012768-176012790 ATATTCAGTGATTCATGGATTGG + Intergenic
986926803 5:12764478-12764500 CTGTTCTATGATTCTAGGTACGG - Intergenic
990106488 5:52269922-52269944 AGATTCAATGATTCAATGTAGGG - Intergenic
990657956 5:57978822-57978844 ATATTCAGTGGTTGAAGGTTGGG - Intergenic
993167846 5:84381781-84381803 CTATTAAATTATTCACGGTATGG - Intronic
994001091 5:94780152-94780174 CTATTCAGAGATACAAGATCAGG - Intronic
994980125 5:106863517-106863539 CTATTTACTGATTCATGTTACGG + Intergenic
997076561 5:130685867-130685889 TTATTAAGTGATTCATGGAAAGG + Intergenic
1000479838 5:161758478-161758500 CTATTCAGTGCAACAAGGCAAGG + Intergenic
1002397388 5:178968723-178968745 CTTCTCAGGGATTCAAGGTAAGG - Intergenic
1003268443 6:4587023-4587045 GTCTTCAGTGTTACAAGGTAGGG - Intergenic
1005171710 6:22993520-22993542 CTGTTCAGTGTTTCTGGGTAGGG + Intergenic
1005230365 6:23694451-23694473 CTAGACAGTGAGTTAAGGTATGG - Intergenic
1009526054 6:64747672-64747694 CTATTAAGTGATTCTAGGGCTGG - Intronic
1010557411 6:77300818-77300840 ATATTCAGTGACTCAAGTGAAGG - Intergenic
1012778058 6:103522487-103522509 CTCTTCAGAGATTCTAGGCAGGG - Intergenic
1016355387 6:143212550-143212572 CTATTCAGGAATTCATGGTCTGG - Intronic
1017552277 6:155521934-155521956 ATATTCACTGAGTCAAGGAATGG + Intergenic
1018691796 6:166352005-166352027 CTACTCAGGGATTTAAGCTATGG - Intergenic
1018698788 6:166411353-166411375 CTCTTCAGTGATGCAGGGTGAGG + Exonic
1020288041 7:6700908-6700930 TGATTCAGTCATTCAAGGAAGGG - Intronic
1021135796 7:16963921-16963943 ATATTCAATGATTGAAGGTGGGG - Intergenic
1021164090 7:17312558-17312580 TTATTCAGTGCTTCAAGTAAAGG + Intronic
1022810718 7:33865207-33865229 CGATTCAGTGAGTCTGGGTAGGG - Intergenic
1025122795 7:56319491-56319513 CAATTCAGTTATACAACGTATGG + Intergenic
1027771793 7:82416308-82416330 CTATTCAGTCATTTAAGGACTGG - Intronic
1037059832 8:14493741-14493763 ATATTTAGGGATTCCAGGTAAGG - Intronic
1037205544 8:16315262-16315284 CTATTCTATGATATAAGGTAAGG - Intronic
1037411242 8:18600064-18600086 CTATTAAGTGATTAAAGGATGGG + Intronic
1041669265 8:60476588-60476610 CTATGAAGTGGTTCAAGGGAAGG - Intergenic
1042550613 8:69991088-69991110 CCATTCAAGGATTCAATGTAGGG + Intergenic
1044779930 8:95733848-95733870 TTTTTAAGTGACTCAAGGTAAGG - Intergenic
1045373307 8:101546879-101546901 CTATTCTGAGATACCAGGTAGGG + Intronic
1050654261 9:7808931-7808953 CAATTCATTGACTCAAGCTAAGG - Intronic
1055379598 9:75691454-75691476 TTATTGATTGATTCAAGGGAGGG + Intergenic
1056184024 9:84114359-84114381 CCATTCAGTAATACAAGCTATGG + Intergenic
1057008004 9:91577646-91577668 TTCTGCAGGGATTCAAGGTAAGG - Intronic
1061815689 9:133193572-133193594 CAATTCAGTAATACATGGTAGGG - Intergenic
1187134766 X:16536846-16536868 CTTTGGAATGATTCAAGGTAGGG - Intergenic
1187537221 X:20153200-20153222 CTATTCAGTGTTTCAAACTTTGG - Exonic
1190486443 X:50930179-50930201 CTATTTAGTGCTTCAAAGGACGG + Intergenic
1192657840 X:73010912-73010934 CTATTCAGAGATTCAACTTCTGG + Intergenic
1201700431 Y:16875478-16875500 CTATTCAGTTATACAACCTATGG + Intergenic