ID: 1078966412

View in Genome Browser
Species Human (GRCh38)
Location 11:16349651-16349673
Sequence CAGAAGAAAGAGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11542
Summary {0: 1, 1: 16, 2: 200, 3: 1670, 4: 9655}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078966412 Original CRISPR CAGAAGAAAGAGAGGGAGGG AGG Intronic
Too many off-targets to display for this crispr