ID: 1078969011

View in Genome Browser
Species Human (GRCh38)
Location 11:16384363-16384385
Sequence ATGACATCCTAGAAGAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078969007_1078969011 -4 Left 1078969007 11:16384344-16384366 CCCTGTTCAAATCACCTCCATGA 0: 1
1: 0
2: 1
3: 16
4: 285
Right 1078969011 11:16384363-16384385 ATGACATCCTAGAAGAATAAAGG 0: 1
1: 0
2: 0
3: 21
4: 257
1078969008_1078969011 -5 Left 1078969008 11:16384345-16384367 CCTGTTCAAATCACCTCCATGAC 0: 1
1: 0
2: 1
3: 11
4: 154
Right 1078969011 11:16384363-16384385 ATGACATCCTAGAAGAATAAAGG 0: 1
1: 0
2: 0
3: 21
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078969011 Original CRISPR ATGACATCCTAGAAGAATAA AGG Intronic
902271558 1:15308679-15308701 ATCACATCCCTGAAGAATGAGGG + Exonic
904243594 1:29168631-29168653 ATAACAGACTAGAAGAATAGAGG + Intronic
905354835 1:37374231-37374253 ATGAAAGTCTAGAAGAATTAAGG - Intergenic
907317030 1:53579016-53579038 ATGAGTTCCTAGAAGTATCATGG - Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
907576751 1:55533566-55533588 ATTAAATCCTAAAAGAATAGAGG + Intergenic
907995325 1:59625592-59625614 ATGACAGCCTAGATCAAGAAGGG + Intronic
908776177 1:67642618-67642640 ATGAAATCCTGCAAAAATAATGG + Intergenic
910313209 1:85851752-85851774 AAGACAGCCCAGTAGAATAACGG - Intronic
910327194 1:86023732-86023754 ATGTCATCTTAGAAGACAAAGGG + Intronic
910997447 1:93122235-93122257 ATGAAGTGCTAAAAGAATAATGG - Intronic
912238408 1:107878443-107878465 ATGTCATTAAAGAAGAATAAAGG - Intronic
912478008 1:109953996-109954018 ATGGCATTATAGAAGAAAAATGG + Intergenic
913408732 1:118526582-118526604 CTGACATGCTTGAAAAATAATGG - Intergenic
917882225 1:179348491-179348513 ATGACATTCTAGTAGGGTAAGGG + Intronic
918602275 1:186377478-186377500 GTGACACCCTAGAAGAAATAAGG + Intronic
919310092 1:195896063-195896085 TTGACATCCAAGAATAAGAAAGG + Intergenic
919440734 1:197630178-197630200 ATACCATCCTAAGAGAATAAAGG - Intronic
921860463 1:220037546-220037568 GTGACAACTTAGAAAAATAAAGG + Intronic
924093224 1:240523764-240523786 ATAAACTCCTAGAAGAAAAATGG + Intronic
924364552 1:243277746-243277768 ATAAAATACTAGAAGAAGAAAGG - Intronic
924786156 1:247201962-247201984 ATAACATCCCAGAAGAAAAGAGG + Intergenic
1064192853 10:13222566-13222588 AGGACATGCAAGAAAAATAAGGG + Intronic
1065824739 10:29560218-29560240 ATTACAAACTAGAGGAATAAGGG + Intronic
1067121999 10:43480935-43480957 ATGATATTCTAGATGAATAAAGG + Intronic
1068035420 10:51754064-51754086 ATGACAGCCCAGAAGAAGAAAGG - Intronic
1069282810 10:66676844-66676866 ATGACATTGTAGAAAAATGAAGG - Intronic
1069311782 10:67046481-67046503 ATATCTTCCTAGAAGAACAAGGG + Intronic
1069392474 10:67950999-67951021 AGGAAATGCTTGAAGAATAATGG + Intronic
1069758761 10:70792934-70792956 ATTCCATTCTAGAAGAAAAAGGG - Intergenic
1070450065 10:76549108-76549130 TTGTCATCTTAGAAGAAGAAGGG - Intronic
1071383057 10:85089728-85089750 ATGACATTTTATAATAATAAAGG + Intergenic
1071510651 10:86260577-86260599 ATGACATCCTAGAAGGCTCAAGG + Intronic
1072733280 10:97862750-97862772 AACAAATACTAGAAGAATAAGGG + Intronic
1072877972 10:99193691-99193713 AGGTCATCATATAAGAATAAAGG + Intronic
1073054547 10:100690786-100690808 ATGACTTCCTAGGAGAAGAGAGG + Intergenic
1075885709 10:125897037-125897059 CTGACATTTTAGAAGAAAAATGG - Intronic
1078247473 11:9588333-9588355 ATTACATCTTAGAATAATGATGG + Intronic
1078969011 11:16384363-16384385 ATGACATCCTAGAAGAATAAAGG + Intronic
1079646858 11:22874741-22874763 ATGGCAGCCTAGCAGAATGAAGG - Intergenic
1079768554 11:24427672-24427694 ATAAAATCCTAGAAAAAAAAAGG + Intergenic
1080486840 11:32717364-32717386 ATAACACCCTGGAAAAATAAGGG + Intronic
1082010587 11:47447580-47447602 GTGACTTCCTGGAGGAATAATGG - Intronic
1082831368 11:57620542-57620564 ATGACATCATTGTAGAATACAGG + Intergenic
1084342776 11:68518370-68518392 CTGACATCTTTGAAGAATATGGG - Intronic
1088196852 11:107283738-107283760 ATGACATTTTTGAAGAGTAAGGG + Intergenic
1088495048 11:110424158-110424180 CTGACATCCTATTGGAATAATGG - Intergenic
1092580612 12:9836833-9836855 ATGACACCTTAGAAAAATTAAGG + Intronic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1095216211 12:39552396-39552418 TTGACATACCAGAAGAATATTGG - Exonic
1095556389 12:43510877-43510899 AGGACATCCAAGTAGAATTATGG - Intronic
1096675319 12:53222847-53222869 ATGAAATGCTAGAAGGCTAATGG - Intronic
1096923710 12:55118248-55118270 ATGAAATCCTCAAAGCATAATGG + Intergenic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1098673089 12:73254676-73254698 AGGACATCCTTGAAGAACAGAGG + Intergenic
1099019609 12:77387223-77387245 ATTACACCTTAGCAGAATAATGG - Intergenic
1099734748 12:86552322-86552344 GTGATTTCCTAGAAGTATAAAGG + Intronic
1100052945 12:90472276-90472298 ATGGCATCCAAGATGGATAAGGG + Intergenic
1100061480 12:90581827-90581849 CTGACTTCCTAGAAGAACCAAGG - Intergenic
1100104507 12:91153057-91153079 ATGACATTCTATCAGAACAATGG - Intronic
1100686944 12:96996707-96996729 GTGAGATCCTAGAGGAATATTGG - Intergenic
1100796708 12:98189566-98189588 ATGACATCCAAGAAGGCCAAAGG + Intergenic
1101853260 12:108421370-108421392 ATTACATCCTGGAGGAAAAATGG - Intergenic
1104365409 12:128172297-128172319 ATGACATTTTAGAAGAATAGAGG + Intergenic
1104524998 12:129512878-129512900 ATGAACTCCTAGCAGAATGATGG - Intronic
1106300326 13:28458530-28458552 AGGACATCCTAGGAGAATACAGG + Intronic
1107732230 13:43359538-43359560 ATTACATCCAGTAAGAATAATGG + Intronic
1108020424 13:46122308-46122330 ATGCTGTCCTAGAAGAATAAAGG - Intergenic
1108218505 13:48209104-48209126 ATAATATCCTGTAAGAATAAAGG - Intergenic
1108484180 13:50908358-50908380 ATCCCATCCTACAGGAATAATGG + Intergenic
1108577146 13:51800396-51800418 AGGAAATACTAGAAGAGTAAAGG - Intronic
1108853919 13:54770163-54770185 ATAACATTCTAGAATAATAAGGG + Intergenic
1110060316 13:71031860-71031882 ATTACACCCTACAAGAATGAGGG - Intergenic
1110703178 13:78573456-78573478 ATGGCATGCTATAAAAATAATGG + Intergenic
1110996540 13:82117155-82117177 AAGACAACCTAGAAGAGCAAGGG + Intergenic
1114681098 14:24483903-24483925 TTGACATCCTAGAATAAAAAGGG + Intergenic
1114819216 14:25996301-25996323 ATGAAAACATAGAAGAATGAAGG - Intergenic
1115561103 14:34583680-34583702 ATGACATCATAAATGAATTAGGG + Intronic
1115687437 14:35810617-35810639 ATAACATAATAGAAAAATAAGGG + Intergenic
1116112099 14:40598445-40598467 ATGATATGATAGAAAAATAATGG - Intergenic
1116462718 14:45196284-45196306 ATGACCACCTACAAGAATACAGG - Exonic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116598862 14:46892396-46892418 ATACAATCCTAGAAGAAAAAGGG + Intronic
1119101665 14:71885551-71885573 ATCACATCCTAGGAGAACCACGG - Intergenic
1121751531 14:96362426-96362448 ATGACATTCTGGAAGGATTAAGG - Intronic
1123050950 14:105541836-105541858 GTAACATCCTTGAAGAATTAAGG + Intergenic
1123463569 15:20496382-20496404 AAGACATCCTAGAAGCAGCAAGG + Intergenic
1123654493 15:22504043-22504065 AAGACATCCTAGAAGCAGCAAGG - Intergenic
1124308403 15:28599239-28599261 AAGACATCCTAGAAGCAGCAAGG - Intergenic
1126891091 15:53205076-53205098 GTGATTTTCTAGAAGAATAATGG + Intergenic
1127235814 15:57050374-57050396 ATGACATCCTTTAAGCATGAAGG - Intronic
1127346871 15:58109846-58109868 GAAACATTCTAGAAGAATAATGG + Intronic
1127993752 15:64139842-64139864 ATGACATTTTTGAAGAATACAGG + Exonic
1128031900 15:64488484-64488506 GTGACATCCTTGAAGCAAAATGG + Intronic
1129186376 15:73909636-73909658 ATGCCACCCTAGAAGAAAGAAGG - Intergenic
1129956094 15:79638128-79638150 ATGACATCCTGCCAGAACAAGGG + Intergenic
1131802384 15:96084466-96084488 CTGACATCCTGGAAGTCTAAGGG - Intergenic
1131909040 15:97176261-97176283 ATGAAATCCAAGAGGATTAATGG + Intergenic
1133189081 16:4120060-4120082 TTGACCTCCCAGAAGCATAAAGG + Intergenic
1134361336 16:13533667-13533689 GTGATATCCTTGAAGAAGAAGGG - Intergenic
1137459454 16:48646925-48646947 AAGACATTCTATAATAATAAAGG - Intergenic
1139181319 16:64751791-64751813 ATGACATTCTAGCAGAATTCTGG + Intergenic
1140029681 16:71325507-71325529 ATGAGATCCTAGAATGAAAAAGG + Intergenic
1141304258 16:82846173-82846195 ATGACAACCTCTAAGAACAAAGG - Intronic
1148511704 17:48176555-48176577 ATGAGATCCTAAAAAAATCAAGG + Intronic
1148767795 17:50049381-50049403 GTGACCTCCTGGAAGAATAGAGG + Intergenic
1149854181 17:60065113-60065135 ATGAGAACCTAGGAGAAAAATGG - Intronic
1155381014 18:25222869-25222891 ATGACATCTCCTAAGAATAAGGG - Intronic
1158924751 18:62243980-62244002 TTCAAATCCAAGAAGAATAATGG - Intronic
1159001348 18:62978247-62978269 TTGCCATCCTGGAAGAACAAGGG - Exonic
1159208802 18:65288271-65288293 ATCAAATCCTAGGAGAATTAAGG - Intergenic
1159229909 18:65593170-65593192 ATAACATCCTAAAAGCATTATGG + Intergenic
1160551829 18:79698364-79698386 TTGACATCCTAGCAACATAAAGG - Intronic
1166587406 19:43961748-43961770 TTGACATCCTTGAAGTATATAGG + Intronic
1167951683 19:53032664-53032686 AGGACATCCCTGAAGAATAGTGG + Intergenic
926617709 2:15014056-15014078 ATGACATTATATAGGAATAAAGG + Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
929838598 2:45431819-45431841 AAAACATCCTACAAGAAAAAAGG + Intronic
930264962 2:49189013-49189035 CTGACAGCCAAGGAGAATAAAGG - Intergenic
930325763 2:49915161-49915183 ATGTGATACTAGAAGAATGAAGG + Intergenic
931206912 2:60156595-60156617 GTGACTTCCAAGAAGAATCACGG + Intergenic
931865737 2:66409099-66409121 ATGACATCTGAGAAGATTAGTGG - Intergenic
934055710 2:88249926-88249948 ATGCTTTCCTAGAAAAATAAAGG + Intergenic
934723498 2:96598961-96598983 ATGTGATTCTAAAAGAATAATGG + Intronic
936904256 2:117518485-117518507 ATGACAGCCTAGAAGAGAAGAGG + Intergenic
938309614 2:130279908-130279930 ATTACATCCTATAAGCATAATGG - Intergenic
938445314 2:131372471-131372493 ATTACATCCTATAAGCATAATGG + Intergenic
939587341 2:144021119-144021141 TTGAGTTCCTAGAATAATAAAGG + Intronic
940914344 2:159238172-159238194 AGGACAACCTAGTAGAAAAATGG - Intronic
941109103 2:161397738-161397760 ATGAAATCCCAGCAGAATTAGGG + Intronic
941544158 2:166826537-166826559 ATGAGTTCCTAGGAGAAAAAAGG - Intergenic
942161134 2:173188717-173188739 ATGATAACCTAGAAGAGGAAAGG - Intronic
943053839 2:182950387-182950409 ATGAGATAATAGAAGAATTATGG - Intronic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944255116 2:197617812-197617834 ATGCCATCGTAGTAGAACAATGG - Exonic
945641151 2:212431660-212431682 ATGTCATCATAGAATAATAGGGG - Intronic
948800619 2:240431845-240431867 ATGACCTCCTTTGAGAATAATGG + Intergenic
1170489488 20:16858129-16858151 ATGACTTCCCAGAAGGAAAATGG + Intergenic
1171224778 20:23433206-23433228 ATGAAATCCATGAATAATAAGGG - Intergenic
1173036007 20:39411192-39411214 ATGAAGTCCTAGAAGGTTAATGG + Intergenic
1174789949 20:53468915-53468937 ATCAGACCCTTGAAGAATAAGGG - Intronic
1175146759 20:56902594-56902616 ATGACAACCTAGAAGAGAAATGG + Intergenic
1175386995 20:58603737-58603759 ATGACAGCCTGGAAGGAGAAGGG - Intergenic
1176274006 20:64253440-64253462 ATGACCTCCAAGAAGAAAAGTGG - Intergenic
1177646295 21:23903652-23903674 ATAACATCGTATAAGATTAAGGG + Intergenic
1177958807 21:27635869-27635891 ATGACATTCTGAAAAAATAATGG - Intergenic
1180285737 22:10742573-10742595 CTGACATTTTAGAAGAAAAATGG - Intergenic
1182552545 22:31107908-31107930 AGGACATCCAAGAAAAAAAAAGG + Intronic
1182807030 22:33081457-33081479 ATGGCATCTTTGAGGAATAAAGG + Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1185018665 22:48360367-48360389 ATGACATCCTTCAGGAAGAAGGG + Intergenic
949869137 3:8572133-8572155 TTGACATCTTAGAAGATTAAAGG + Intergenic
950840693 3:15965746-15965768 AAGACAACCCAGAAGAAAAATGG + Intergenic
951964103 3:28363289-28363311 ATGACAACCAAGTAGAAAAATGG + Intronic
952056397 3:29452067-29452089 TTGACATCCTTCAAGCATAATGG - Intronic
953120983 3:40041540-40041562 ATGACATTTTTGAAGAATACAGG - Intronic
954533420 3:51340248-51340270 ATGACATCTGAAAAGAATATAGG + Intronic
956635041 3:71355555-71355577 ATGACATCTGAGAAGAGTAATGG + Intronic
957143445 3:76391474-76391496 ATGACATTTTGGAAGAAAAATGG - Intronic
957414781 3:79887408-79887430 ATGACAGCCTACTAGAATAAGGG - Intergenic
957846835 3:85747595-85747617 AGAACATCATAGAAGAATAAAGG - Intronic
960940795 3:122932540-122932562 ATGACATCCCACGGGAATAAGGG + Intronic
961858793 3:129897464-129897486 GGGACATCCCTGAAGAATAATGG - Intergenic
963374129 3:144441381-144441403 ATGAGATCCTGGAAGAGAAAAGG + Intergenic
964451648 3:156818257-156818279 ACTACATTCTAGAAGAGTAAAGG - Intergenic
965909841 3:173759746-173759768 CTGACATCCTAGTAGAAAACTGG - Intronic
968774947 4:2535248-2535270 ATACCATCCTAGACGAAAAAAGG - Intronic
970075861 4:12218946-12218968 ATTAAATCCTAGAACGATAAGGG + Intergenic
970219665 4:13797765-13797787 ATAACATACAAGAAGAAAAAAGG - Intergenic
970431406 4:15992420-15992442 GTGACATTCTTGGAGAATAAGGG - Intronic
970562281 4:17294186-17294208 ATGACAGCCTTGAAGAATGATGG + Intergenic
971171196 4:24234923-24234945 ATCACACTCTAGAGGAATAATGG + Intergenic
974460689 4:62184078-62184100 ATGACATCCTACAATTAAAATGG + Intergenic
978587450 4:110289185-110289207 AGGACATGCTTGAAGAATTATGG + Intergenic
978878489 4:113671238-113671260 ATAACAATTTAGAAGAATAAAGG + Intronic
978935198 4:114366091-114366113 AGGAAATCTTAGAAGAAAAAAGG - Intergenic
980460279 4:133101942-133101964 ATTACATACTAGAAGAATATGGG + Intergenic
981162364 4:141513844-141513866 ATGGGATCATAGAAGAATAATGG + Intergenic
984070543 4:175106505-175106527 ATGACAGTCTAGAAGAAATAAGG + Intergenic
985117636 4:186607184-186607206 ATGAAATTTCAGAAGAATAATGG - Intronic
986036983 5:3950023-3950045 ATGACATCCCTGAAGGATAGTGG - Intergenic
989229444 5:39069842-39069864 TTGACTTCTTAAAAGAATAATGG - Intronic
989347168 5:40441974-40441996 AGGACATCCTGGAAACATAAAGG + Intergenic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
990457870 5:56005438-56005460 ATGACATCCAAGAACCACAAAGG - Intergenic
990737247 5:58877751-58877773 ATGATATCCTAGATGAATCTTGG + Intergenic
992786764 5:80177436-80177458 ATGACATTCAAGAAGGACAAAGG + Intronic
993077838 5:83256826-83256848 ATGACAAAATATAAGAATAAAGG + Intronic
993981852 5:94552175-94552197 ATGACATTATACAATAATAAAGG + Intronic
996352421 5:122560062-122560084 ATGGGATCCAAGAAGAAAAAAGG - Intergenic
996879763 5:128282867-128282889 ATGACAGCCTAGAGGAAAACAGG + Intronic
997728602 5:136145095-136145117 ATTACATCTTAGAAGAAATACGG - Intronic
999360865 5:150985642-150985664 ATGACATCCCACCAGAAAAAGGG - Intergenic
999566324 5:152866543-152866565 ATGACATCACCCAAGAATAATGG + Intergenic
999614610 5:153408993-153409015 TTGACATTCTTGAAGAATACTGG - Intergenic
999875025 5:155794996-155795018 CTGACATGCTAGCAGAACAATGG + Intergenic
1000099293 5:157999508-157999530 TTGACATTTTGGAAGAATAAAGG + Intergenic
1002964351 6:1947781-1947803 ATTAAATGCTAGAAGAATAATGG - Intronic
1006846351 6:37064457-37064479 ATGACATGGTACAATAATAAAGG - Intergenic
1008000529 6:46355510-46355532 ATGACCTCCTAGAGGGAGAACGG - Intronic
1008863586 6:56181709-56181731 ATGACATCATAGAAAAGGAATGG + Intronic
1011036253 6:82978879-82978901 ATGACCTCCTAAAAAAAGAAAGG - Intronic
1012152068 6:95766540-95766562 ATGACAAACTATAAGAAAAAAGG - Intergenic
1012642195 6:101632840-101632862 ATGACATCTCAGGAGAAGAAGGG + Intronic
1012867903 6:104640122-104640144 ATGACAAACTAAAAGAATACAGG + Intergenic
1012949194 6:105499994-105500016 AAGCCATCCTAGAAGAGAAATGG + Intergenic
1013024368 6:106255246-106255268 AAGACATGTTAGAAGAAGAAGGG - Intronic
1013153159 6:107466181-107466203 ATGACAGCTTAGAAGTATGAGGG - Intergenic
1013194165 6:107830790-107830812 ATGACATTTTAATAGAATAAAGG - Intergenic
1013335488 6:109155006-109155028 ATTACATACAAGAAGAACAAAGG - Intronic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1015193556 6:130499747-130499769 ATCAAATCCCAGAAAAATAATGG - Intergenic
1015762801 6:136683250-136683272 ATGAAATACTAGAAGCATGAAGG + Intronic
1015985119 6:138876820-138876842 AAGACATCCTAGTACCATAAAGG - Intronic
1016393250 6:143596240-143596262 ATGAAGACCTAGAGGAATAAAGG - Intronic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1020341059 7:7111669-7111691 AAGACATTATAGAATAATAAAGG + Intergenic
1020468886 7:8513093-8513115 AAGACATCATAGAAGAAGGAGGG + Intronic
1021508053 7:21406951-21406973 ATGAGATCCTTGGAGAAAAAAGG + Intergenic
1022450110 7:30506188-30506210 AAGTCATCCTAAATGAATAATGG + Intronic
1022914865 7:34938011-34938033 ATTACATTCTAGAAGAGTCATGG - Exonic
1023403481 7:39808007-39808029 ATGACATGCTGGTAGAAAAATGG + Intergenic
1023781328 7:43658703-43658725 ATGACATACTAGAATATGAAAGG + Intronic
1024082608 7:45867430-45867452 ATGACATCCTAAATCAATTAAGG + Intergenic
1025226621 7:57170578-57170600 ATTAAATCCTATAAGCATAATGG - Intergenic
1027789182 7:82617379-82617401 CTGACATCCTAGCAGAGCAAGGG - Intergenic
1028379324 7:90181053-90181075 ATGAACTCCTTGAATAATAATGG - Intronic
1029545763 7:101209841-101209863 ATCACATCTTAAAAGAAGAATGG - Intronic
1030021063 7:105275747-105275769 CAGACATCCTAGGAGAAAAACGG + Intronic
1031771180 7:125846460-125846482 TTGGCAGCCTAGAAGAATATGGG + Intergenic
1033106005 7:138524098-138524120 ATGTCATATTAAAAGAATAAAGG + Intronic
1033781459 7:144675280-144675302 ATGACATTCTAGAAGTCTACAGG + Intronic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1034053581 7:148010446-148010468 AAGACATCATAAAAGAAAAAAGG - Intronic
1035235017 7:157491226-157491248 ATAACATCTTAGAAGAAAACAGG - Intergenic
1038839820 8:31173805-31173827 CTGACATCCTGGAAAAATAAAGG - Intergenic
1038862603 8:31403663-31403685 ATGAAAGGCTAGAAGAATGAGGG - Intergenic
1039520147 8:38163772-38163794 AAGAAATTCTAGAAGAACAAAGG - Exonic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1040835309 8:51724479-51724501 ATGACATCGCAGAAAAAAAAAGG + Intronic
1041726168 8:61019608-61019630 AAGACATTCTAGAATGATAATGG - Intergenic
1042757160 8:72227750-72227772 ATGACATAATAGCACAATAAAGG + Intergenic
1043234312 8:77842465-77842487 ATGACAACCTAGGAAAAGAAGGG - Intergenic
1043355662 8:79409388-79409410 TTGAGCTCCTAGAAGAAGAATGG - Intergenic
1043560875 8:81491825-81491847 ATGAGATCACAGAAGAATTATGG - Intergenic
1044274897 8:90287731-90287753 ATGACCTCTTTGAAGAATCAAGG - Intergenic
1045783343 8:105894237-105894259 ATATCATTCTAGAAAAATAAGGG + Intergenic
1045877457 8:106999175-106999197 ATGACATCCAATAAGGAAAATGG + Intergenic
1046262515 8:111787672-111787694 GTGAAAACCTAGAAGAGTAATGG - Intergenic
1047457516 8:125029406-125029428 ATGACAGCCCAGGAGAATCAGGG - Intronic
1050292263 9:4167144-4167166 ATGACATCCAAAGAGGATAAGGG + Intronic
1050299952 9:4248069-4248091 TTGAATTCATAGAAGAATAATGG - Intronic
1055438645 9:76317716-76317738 ATGACATGTTAGCAGAAGAAAGG + Intronic
1056780440 9:89545346-89545368 TTGACATCCTGGAAGAATGTGGG + Intergenic
1057756010 9:97836299-97836321 ATGACATATTAATAGAATAAAGG + Intergenic
1058112748 9:101049242-101049264 AAGATATTCTAGAAAAATAAGGG + Intronic
1058290311 9:103233192-103233214 ATGAGACCCTATAAGAATGAGGG - Intergenic
1058405673 9:104670904-104670926 AAGACAACCTAGTAGAAGAATGG + Intergenic
1058643367 9:107108284-107108306 AAGAGATCACAGAAGAATAAAGG + Intergenic
1060559433 9:124530508-124530530 ATGGGAACCTAGAAGAAGAATGG - Intronic
1187587485 X:20679640-20679662 ATGAGTTGCTAGAAAAATAAAGG + Intergenic
1188266250 X:28079335-28079357 AAGACATCAGAGAACAATAATGG + Intergenic
1190321468 X:49182343-49182365 AAGACAGCCTGGAGGAATAAGGG - Intronic
1190325055 X:49201431-49201453 ATGAATTCCTAGAAGTATGAAGG - Intergenic
1193458871 X:81765753-81765775 ATAGCATGCTAGAAAAATAAAGG + Intergenic
1193500002 X:82263694-82263716 ATACTATTCTAGAAGAATAAGGG - Intergenic
1193541448 X:82777235-82777257 ATGAAATCATAGCAAAATAATGG - Intergenic
1193847107 X:86486252-86486274 ATGACTTCATAGAAAAAAAAGGG - Intronic
1193962519 X:87943319-87943341 ATTACATTCTAGGAGAATAAAGG - Intergenic
1195373736 X:104204983-104205005 ATGACATACAAGCTGAATAAAGG - Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1196062628 X:111427361-111427383 ATGACTTCTTAGAAGGAGAAAGG + Intergenic
1196926946 X:120642779-120642801 ATGAGATTCTTGAAGAATTACGG + Intergenic
1196966435 X:121061281-121061303 ATGTCATCATATAATAATAAAGG - Intergenic
1197566227 X:128090482-128090504 ATGAGAGACTAGAAAAATAATGG + Intergenic
1198094953 X:133370655-133370677 AGAACATCCAAGGAGAATAAAGG - Intronic
1199033340 X:143026336-143026358 ATGACATCCCACCAGAAAAAGGG - Intronic
1199034459 X:143033625-143033647 ATGACATCCCACAGGAAAAAGGG - Intronic
1201506492 Y:14706702-14706724 ATTACATCCTAAAAGAACTAAGG - Intronic