ID: 1078987413

View in Genome Browser
Species Human (GRCh38)
Location 11:16609220-16609242
Sequence CAGTATGCACAAGGTGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078987413 Original CRISPR CAGTATGCACAAGGTGAGGT TGG Intronic
900724589 1:4207739-4207761 CAGTATGGACAATGTGAGCCAGG - Intergenic
901892945 1:12283652-12283674 CATTCTGCACAACGTGAAGTTGG + Exonic
902114399 1:14108991-14109013 CAGAATGCACAGGCTGAGCTAGG + Intergenic
903453306 1:23469800-23469822 CAGTTTGCTCAAGGTCATGTAGG + Intronic
904369908 1:30041898-30041920 CACTATGCACAGGGTGAACTGGG + Intergenic
908139977 1:61174174-61174196 CATTATGCAGATGGAGAGGTCGG + Intronic
912111166 1:106345090-106345112 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
912958817 1:114176842-114176864 CAGGATGGGCAAGGAGAGGTGGG - Intergenic
914222236 1:145691497-145691519 CAGGAGGCAGAAGATGAGGTGGG - Intronic
915824044 1:159056678-159056700 CAGTTTGCACAAGGAGAGGGAGG + Intergenic
916906611 1:169292569-169292591 CAGTATACAGAAGGTGAGGCAGG + Intronic
917076821 1:171214467-171214489 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
920211391 1:204331422-204331444 CTGTTTGCCCAAGGTGGGGTTGG - Intronic
920394985 1:205638542-205638564 GAGTAAGCAGAAGGTGAGGATGG - Intergenic
921161109 1:212472667-212472689 CAGTATGAACAAGGTAATGTGGG - Intergenic
922567780 1:226612123-226612145 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
922707376 1:227796513-227796535 CAGTAGGCCCAAGGGGAGTTTGG - Intergenic
1067047658 10:42993722-42993744 CTGCATGCAAAAGATGAGGTTGG + Intergenic
1067256455 10:44647396-44647418 GAGAATGGACAAGGTGAGGCAGG - Intergenic
1067831892 10:49615225-49615247 CAGCAAGGACAAGGTCAGGTTGG - Intronic
1071012298 10:80953051-80953073 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1075543741 10:123337771-123337793 AAGCATGCAAAAGGTGATGTGGG - Intergenic
1075704095 10:124488657-124488679 AAGGATGCAGAAGGGGAGGTGGG + Intronic
1077554885 11:3221139-3221161 CTCCATGCACCAGGTGAGGTGGG - Intergenic
1078987413 11:16609220-16609242 CAGTATGCACAAGGTGAGGTTGG + Intronic
1079073274 11:17366937-17366959 CAGTTAGCATAAGGTGTGGTGGG + Intronic
1081341067 11:41928446-41928468 CAATATGGACAAGATCAGGTGGG - Intergenic
1081972272 11:47207701-47207723 CTCTGTGCCCAAGGTGAGGTTGG - Intergenic
1083479565 11:62934888-62934910 CATTATCCTCAAGGTGAGGAAGG - Intergenic
1085660989 11:78366626-78366648 GAATATGCACAAAGTGAGGATGG + Intronic
1086922482 11:92603027-92603049 CAGTATGCATACTGTGAGATAGG + Intronic
1087044078 11:93829928-93829950 AAGTTTGCAGAAGGTGAGGAAGG + Intronic
1087504804 11:99005880-99005902 CATTCTGTAGAAGGTGAGGTGGG - Intergenic
1087894174 11:103569640-103569662 CAGTACCCAAAAGATGAGGTTGG - Intergenic
1088319274 11:108538465-108538487 CAGAATGTATAAGGTGAGGGAGG - Intronic
1088862444 11:113814449-113814471 CAGTATGCACAATGTAAAATTGG - Intronic
1089082976 11:115792932-115792954 CAGGATGGATAAGGTAAGGTGGG - Intergenic
1089458897 11:118641353-118641375 CAGCCTGCATAAGGGGAGGTTGG + Intronic
1090226846 11:125076826-125076848 CAGTATCGTCAAGGTGAGGCTGG + Exonic
1090353555 11:126123544-126123566 CAGTAAGCTCAAGGTAAGTTTGG + Intergenic
1092585692 12:9899081-9899103 CAGTTTGCACAGGGAGAGGCAGG + Intronic
1094850279 12:34379297-34379319 CAGGATGCACAGGGTGACGAGGG + Intergenic
1095873457 12:47055412-47055434 AAGTATGCACAAGGTGCTGTAGG - Intergenic
1096535643 12:52270958-52270980 CAGGCTGCACAAGGTCAGGTAGG - Intronic
1098065985 12:66616676-66616698 AAGTATACAAAAGGTGAGGGAGG + Intronic
1098805507 12:75016468-75016490 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1099293228 12:80798466-80798488 CAGTAGGCCCCAGGGGAGGTTGG - Intronic
1099953037 12:89325176-89325198 CAGTAAGCACAAGGTAATGTTGG + Intergenic
1100980067 12:100156778-100156800 GAGTCTGCACAAGGAGAGGCGGG - Intergenic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1103073960 12:117967646-117967668 CAGAATGCGCAAGGTCACGTGGG + Intronic
1108309109 13:49168218-49168240 CAGTTTGAAAAAGGTTAGGTTGG - Intronic
1109013016 13:56974655-56974677 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1113287446 13:108867471-108867493 TAGATTGCACAGGGTGAGGTTGG - Intronic
1114212192 14:20624865-20624887 CAGTTTGAGCAAGGAGAGGTTGG - Intergenic
1114613956 14:24058657-24058679 CTGCAGGGACAAGGTGAGGTAGG - Intronic
1117023572 14:51597153-51597175 CAGAATGCACTAGGTGATATGGG + Intronic
1121595505 14:95158651-95158673 CTGTGTGCACATTGTGAGGTAGG + Intergenic
1122292748 14:100688339-100688361 CAGGAAGCAGAGGGTGAGGTGGG - Intergenic
1128093202 15:64933041-64933063 CAGAAACCACAAGCTGAGGTTGG - Intronic
1130134212 15:81168400-81168422 CAGTATGCAAATGATGAGCTTGG - Intronic
1130231515 15:82100820-82100842 CAGAAAGCACAGGGTGAGGGAGG - Intergenic
1135525429 16:23210231-23210253 CAGCAACCACAAGGGGAGGTGGG + Intronic
1135588598 16:23689867-23689889 CAGTGGGCACAAGATGAGCTTGG - Exonic
1135764676 16:25167185-25167207 CATTATTCACCAGGTGAGGGTGG - Intronic
1137067395 16:35862721-35862743 CAGTCTGCATGAGGTGGGGTGGG + Intergenic
1137488818 16:48913723-48913745 CAGAATGCAAAGGGAGAGGTAGG + Intergenic
1139531450 16:67544598-67544620 CAGCATGCACTGGGGGAGGTTGG - Intronic
1145017958 17:19411284-19411306 CGGTAGGTAGAAGGTGAGGTCGG - Exonic
1145777148 17:27537111-27537133 CAGAGTGCACAAGGTAAGGGTGG - Intronic
1147599162 17:41735005-41735027 CCGTATGCACAACGTTGGGTTGG - Intergenic
1153763721 18:8355430-8355452 CAGTATGAACCAGGGGAGATAGG + Intronic
1158518126 18:58147668-58147690 CAGTTTGCATATGGTGAGGAGGG + Intronic
1163658446 19:18561985-18562007 CACTAGTCACCAGGTGAGGTGGG - Intronic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1166767862 19:45263154-45263176 CAGCCTGCAGAAGGTGAGGCTGG + Exonic
925868579 2:8250045-8250067 CTGTATGCACAAAGGGTGGTAGG + Intergenic
926926994 2:17996825-17996847 CAGTTTGCACAGGGAGAGGGAGG - Intronic
927243863 2:20941413-20941435 CATCATGAGCAAGGTGAGGTGGG - Intergenic
927293012 2:21422918-21422940 CTGCATGCACAAGGTGAGCCTGG - Intergenic
928357430 2:30631884-30631906 CAGTATGCACTTGCTGAGGCTGG - Intronic
928459335 2:31456248-31456270 CAGTTTGCACAGGGAGAGGAAGG + Intergenic
930605241 2:53486461-53486483 CAGGATCCACTAGGTGAGGCCGG + Intergenic
931134171 2:59377894-59377916 CAGGATGCAGTAGGTGGGGTTGG - Intergenic
933332680 2:80914316-80914338 GAGTATGTAGAAGGTGAGGATGG - Intergenic
941249866 2:163148315-163148337 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
945496719 2:210516681-210516703 CTGCATGCAAAAGATGAGGTGGG - Intronic
946815898 2:223578241-223578263 GTGTATGCACAAGGTGAGAAAGG + Intergenic
946884363 2:224208348-224208370 CAGTGTGAGCAAGGAGAGGTTGG + Intergenic
948014134 2:234673942-234673964 CAGTTGGCACATGGAGAGGTAGG + Intergenic
948032557 2:234831009-234831031 CAGTGAGCACAAGGTCAGCTGGG + Intergenic
948999095 2:241602140-241602162 CCGTATCCACAGGGTGAAGTGGG - Intronic
1169166909 20:3431919-3431941 CTGGATGAACAAGGAGAGGTGGG + Intergenic
1169338819 20:4780348-4780370 CAAGATGCACAAGCTGTGGTGGG - Exonic
1170222275 20:13953185-13953207 CAGTTTGCACAGGGAGAGGGAGG - Intronic
1171090938 20:22285352-22285374 CAGAATGCACAGGGAGGGGTTGG - Intergenic
1171174841 20:23043939-23043961 CATAGTGAACAAGGTGAGGTGGG - Intergenic
1172861395 20:38056014-38056036 TAGTATGCGCAAAGTGAGGACGG + Intronic
1175750588 20:61494278-61494300 CAGTATGCACGAGCAGAGGTGGG - Intronic
1175824476 20:61929618-61929640 CAGGATGCGCAAGCTGAGTTGGG - Exonic
1178346952 21:31837649-31837671 CACTCTGTACATGGTGAGGTTGG + Intergenic
1178619533 21:34161614-34161636 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1180657232 22:17432837-17432859 CTGTAATCACAGGGTGAGGTGGG - Intronic
1181388725 22:22563803-22563825 CAGTATGCACTAAGTGTCGTGGG - Exonic
1182437495 22:30340186-30340208 GTGTACGCACCAGGTGAGGTGGG - Exonic
1184388344 22:44188819-44188841 CAGGCTGATCAAGGTGAGGTGGG + Intronic
951345973 3:21547308-21547330 CAGTTTGCACAGGGAGAGGGAGG - Intronic
955752922 3:62200796-62200818 CAGTACACAAAAGGTAAGGTGGG + Intronic
958691055 3:97466782-97466804 CAATATGCACAAGAGGAAGTTGG - Intronic
958942486 3:100331529-100331551 CAGTCTCCCCAAGGTGAGGAAGG + Intergenic
960269422 3:115658380-115658402 CAGAACGCAGAAGGTGGGGTAGG - Intronic
962382496 3:134909095-134909117 CAGTACACACAAGGTGGGGGCGG + Intronic
963841036 3:150106653-150106675 CAGAATGAACACTGTGAGGTAGG + Intergenic
964304378 3:155325202-155325224 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
966523742 3:180899523-180899545 CAGTTTGCACAGGGAGAGGGAGG - Intronic
970406862 4:15772510-15772532 GAGTTTGCACAAGGCTAGGTTGG - Intergenic
970495832 4:16625013-16625035 CATTGTGCTCAAGATGAGGTCGG + Intronic
975756643 4:77578128-77578150 CAGTTTGCACAGGGAGAGGGAGG - Intronic
976345361 4:83993735-83993757 CAGTTTGCATAGGGTGAGGGAGG - Intergenic
976966223 4:91044524-91044546 CAGTCTGCACAAAATGAGGCTGG - Intronic
977188434 4:93970130-93970152 CAGTCTGTTCAAGGTGAGGTAGG - Intergenic
979507425 4:121514302-121514324 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
981770069 4:148299043-148299065 CAGTATTCAATACGTGAGGTGGG + Intronic
982477620 4:155872637-155872659 CAGTTTGCACAGGGAGAGGGAGG + Intronic
984575782 4:181446703-181446725 TGGTGTGCACAAGATGAGGTTGG + Intergenic
986178995 5:5376130-5376152 CAGCAAGAGCAAGGTGAGGTGGG + Intergenic
988899602 5:35718124-35718146 CAGTTTGCACAGGGAGAGGTAGG + Intronic
988906734 5:35798266-35798288 CAGAATGCACAAGGCCTGGTTGG - Intronic
994505821 5:100641834-100641856 CAGTTTGCACAGGGAGAGGCAGG - Intergenic
994601287 5:101908622-101908644 CAGTCTGCTCAATGTGAGGGTGG + Intergenic
994981840 5:106885163-106885185 CAGTATGGAAATGGTGAGGAGGG + Intergenic
996433207 5:123403307-123403329 GAGTAAGCACAAGATGAGCTTGG + Intronic
996837406 5:127808723-127808745 GAATATGCACAAGGAGAGGTTGG - Intergenic
1003062931 6:2876422-2876444 CAGTCTGCACAAGGGGAGGGAGG + Intergenic
1004566253 6:16800778-16800800 GAATATGCATAAGGTAAGGTCGG - Intergenic
1007154807 6:39732217-39732239 CAGGATGAATAAGGTGTGGTTGG - Intergenic
1009715250 6:67384710-67384732 CAGAATGCACTAGTTGGGGTAGG + Intergenic
1009907852 6:69891164-69891186 CAGTTTGCACAGGGAGAGGGAGG + Intronic
1012595373 6:101032272-101032294 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1014331587 6:120073540-120073562 CAGTAAGCACAAACTGAAGTAGG + Intergenic
1017019814 6:150130982-150131004 GAGTATGCACCTGGGGAGGTGGG + Intergenic
1017074963 6:150609524-150609546 CAGTAAGCAGGAGATGAGGTGGG + Intronic
1018967717 6:168501542-168501564 CATTCTGCAGAATGTGAGGTGGG + Intronic
1021428765 7:20535759-20535781 CAGCAGGCACCAGGTGAGCTAGG + Intergenic
1029375394 7:100174275-100174297 CAGGAGGCAGAAGGTGAGGCTGG + Intronic
1030245854 7:107383995-107384017 CAGTTTGCACAGGGAGAGGGAGG - Intronic
1032251465 7:130261532-130261554 CAGTTTGCACAAGGAGAGGCAGG - Intergenic
1032803288 7:135333614-135333636 CAGGATGGACAATGTGAGGCTGG + Intergenic
1033559880 7:142521021-142521043 CAGGATGCAGAAGGTGATGATGG - Intergenic
1033999586 7:147395798-147395820 AAGTTTGGACAACGTGAGGTAGG - Intronic
1039148686 8:34479167-34479189 CAGAATGCAAGAGTTGAGGTTGG - Intergenic
1040758441 8:50808811-50808833 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1041118054 8:54559865-54559887 GAGTATGGACAAGATGAGATGGG + Intergenic
1041512236 8:58664806-58664828 CAGAAAACACAAGGTGAGGCCGG - Intergenic
1041830010 8:62143483-62143505 CAGTGGGCACAAGGTGAGCTTGG + Intergenic
1048684815 8:136892652-136892674 CATTATGGGCAAGCTGAGGTAGG + Intergenic
1057745721 9:97749350-97749372 CAAAATGCACAAGATGAGTTTGG - Intergenic
1058597451 9:106630197-106630219 CAGAGTGCAGAAGGTGGGGTGGG + Intergenic
1058880387 9:109280613-109280635 CAGTTTTCCCAAGGAGAGGTGGG - Intronic
1061375716 9:130223147-130223169 CATGATGGATAAGGTGAGGTGGG + Exonic
1061852837 9:133425957-133425979 CAGCAGGGACGAGGTGAGGTTGG - Exonic
1186506622 X:10098597-10098619 AAGTAAGCAGAAGGCGAGGTTGG - Intronic
1188142967 X:26575047-26575069 GTGTATACACAAGGTGAGGCAGG - Intergenic
1189963734 X:46350596-46350618 CAGAATGCATAGGCTGAGGTGGG - Intergenic
1193945036 X:87724313-87724335 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1194131168 X:90084094-90084116 CAGTTTGCACAGGGAGAGGGAGG + Intergenic
1197062351 X:122196142-122196164 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1197509268 X:127350698-127350720 CAGTTTGCACAGGGAGAGGGAGG - Intergenic
1198149892 X:133897868-133897890 GAGTATTCACAAGGACAGGTGGG + Intronic