ID: 1078988322

View in Genome Browser
Species Human (GRCh38)
Location 11:16616093-16616115
Sequence GTGGGTCTATAAATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078988322_1078988326 -1 Left 1078988322 11:16616093-16616115 CCTTTCTCCATTTATAGACCCAC 0: 1
1: 0
2: 0
3: 15
4: 175
Right 1078988326 11:16616115-16616137 CTTGCCTCTTCCCAAATCTGAGG 0: 1
1: 0
2: 6
3: 32
4: 341
1078988322_1078988328 3 Left 1078988322 11:16616093-16616115 CCTTTCTCCATTTATAGACCCAC 0: 1
1: 0
2: 0
3: 15
4: 175
Right 1078988328 11:16616119-16616141 CCTCTTCCCAAATCTGAGGTTGG 0: 1
1: 0
2: 0
3: 14
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078988322 Original CRISPR GTGGGTCTATAAATGGAGAA AGG (reversed) Intronic
901932836 1:12607869-12607891 GTGTGTGTATATATGGAGAGAGG + Intronic
902528755 1:17076879-17076901 GGGGGTCTAGAAATGAGGAAGGG - Intronic
905486503 1:38301078-38301100 GGGCTTCTATAGATGGAGAAGGG + Intergenic
906076327 1:43054832-43054854 GTGGATGAATAAATGGAGAAGGG - Intergenic
907859486 1:58337756-58337778 CTCTGTATATAAATGGAGAAAGG + Intronic
908154673 1:61340714-61340736 GTGCGTGTATAAATTAAGAAGGG + Intronic
910038879 1:82823406-82823428 ATGGGCCTATAAGGGGAGAAAGG + Intergenic
911612802 1:99975575-99975597 GAGGTTCTACAAATAGAGAAGGG + Intronic
912171777 1:107108876-107108898 ATTGGTCTTTAAATGGAGCAAGG - Intergenic
915803370 1:158818259-158818281 GTGGCTATATAAATGTATAAAGG - Intergenic
917814446 1:178693385-178693407 CTGTCTCTATAAATTGAGAATGG + Intergenic
918338889 1:183550840-183550862 ATGGGTCCAAAATTGGAGAATGG - Exonic
921752325 1:218810224-218810246 GGGGGTCTGTGCATGGAGAAAGG - Intergenic
1069169295 10:65204961-65204983 GTCTGTATATAAAGGGAGAAAGG - Intergenic
1072678092 10:97483775-97483797 GTGGGTCTACAGATGCACAAAGG + Intronic
1073729834 10:106274347-106274369 CTGGGCCTATAGAGGGAGAAAGG - Intergenic
1075902090 10:126051386-126051408 ATGGGTATATAAATGGATGATGG - Intronic
1078956164 11:16197499-16197521 GTGAGTCTATAGAGGGAAAATGG + Intronic
1078988322 11:16616093-16616115 GTGGGTCTATAAATGGAGAAAGG - Intronic
1079195584 11:18323526-18323548 CTGGGTCTTCAAATGGACAAAGG - Intronic
1080597532 11:33787591-33787613 GCCTGTCTATAATTGGAGAATGG - Intergenic
1081041683 11:38221941-38221963 GTGGTTCAGTAAATGGAAAAGGG - Intergenic
1086036113 11:82416955-82416977 GTGTGTATATAAATATAGAATGG - Intergenic
1087043498 11:93824302-93824324 GTTGGTCAAGATATGGAGAAAGG - Intronic
1087173160 11:95070930-95070952 ATGGGTGTAGAAATTGAGAAAGG + Exonic
1091187383 11:133658556-133658578 GTGGGTGTATAGATGGATGATGG + Intergenic
1094752996 12:33435552-33435574 GTAGGTCTATAAAAGAATAATGG - Intronic
1100642053 12:96491489-96491511 GTGTGTGTGTAAATGGAGAAGGG + Intronic
1101110250 12:101479667-101479689 GCCTGTCTATAATTGGAGAACGG + Exonic
1102620273 12:114189045-114189067 GTGGGGCAATAAGTGCAGAAGGG + Intergenic
1105601142 13:21888384-21888406 ATCTGTCTATAAATGCAGAAAGG + Intergenic
1105944123 13:25175342-25175364 GTGGGTCTTTAAAGGGATAATGG + Intergenic
1106113146 13:26794507-26794529 GTGTGTTTAAAAATGCAGAATGG + Intergenic
1108339342 13:49482014-49482036 GTGGATCTGTAAATGGGGAGTGG - Intronic
1108868092 13:54946480-54946502 AATGATCTATAAATGGAGAATGG - Intergenic
1110032891 13:70639306-70639328 GTAGGTCAATAAATAGAGAGTGG + Intergenic
1111624182 13:90762813-90762835 ATGAGGCTATCAATGGAGAAAGG + Intergenic
1112050054 13:95636054-95636076 GGGGATCTATAAATTAAGAAAGG + Intronic
1113398663 13:109972029-109972051 GTGGGTGTATTTAAGGAGAAGGG - Intergenic
1114925735 14:27395417-27395439 GAGGTTCTATATATGGAGGAAGG + Intergenic
1118151177 14:63192467-63192489 GTGAGTCTATAAATCCAGGATGG - Intergenic
1118495882 14:66307843-66307865 GTGGGACTATATTTGGAGATGGG - Intergenic
1118887671 14:69879963-69879985 GTGGGTCAAGAAAGGGAGAGTGG - Intronic
1120062384 14:79999466-79999488 CTGAGTCTTCAAATGGAGAAGGG + Intergenic
1120287312 14:82520342-82520364 CTGTGTCTTTAAATGGTGAAAGG - Intergenic
1120639085 14:86987971-86987993 TTGCCTCTGTAAATGGAGAAAGG - Intergenic
1120917090 14:89719765-89719787 GGGGGTCTAGGAGTGGAGAAGGG - Intergenic
1121403362 14:93702348-93702370 CTGTGTTTATAAATGGAGTATGG - Intronic
1121424884 14:93843210-93843232 ATGGGTCTGTGATTGGAGAAAGG + Intergenic
1123486406 15:20743696-20743718 ATGGGTATATAAACGTAGAACGG + Intergenic
1123542895 15:21312746-21312768 ATGGGTATATAAACGTAGAACGG + Intergenic
1123952913 15:25300646-25300668 GTAGGAGTATAAAGGGAGAAAGG + Intergenic
1124559497 15:30758581-30758603 GTGGGTCTAGAAATACTGAAAGG + Intronic
1124671753 15:31647137-31647159 GTGGGTCTAGAAATACTGAAAGG - Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1127016374 15:54693048-54693070 GTGTATCTGTAACTGGAGAAAGG + Intergenic
1129986710 15:79924737-79924759 GTGAGTCAATAAACGGAGAAAGG - Intergenic
1130968504 15:88714880-88714902 GTGGGTCTTTAAATAGAGCCTGG + Intergenic
1131571954 15:93546881-93546903 GTTTATCTATAAATGGAGAGAGG - Intergenic
1131940397 15:97558498-97558520 GAGGGTCCTTAAATGGTGAAAGG - Intergenic
1202951214 15_KI270727v1_random:39876-39898 ATGGGTATATAAACGTAGAACGG + Intergenic
1133384192 16:5355510-5355532 CTGGGTTTAAAAATGGAGACTGG + Intergenic
1134106074 16:11486725-11486747 GTGGGTGGATGAATGGATAATGG + Intronic
1134106140 16:11486938-11486960 GTGGGTGGATCAATGGATAATGG + Intronic
1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG + Intronic
1138774356 16:59703674-59703696 GTGGGTTTATGGAGGGAGAAAGG - Intergenic
1142482962 17:229819-229841 GTGGGTCTGGAAAGGGAGAAAGG + Intronic
1144538942 17:16120050-16120072 CTGGTACTATAAATTGAGAAAGG - Intronic
1145115422 17:20205682-20205704 GAAGGGCTAAAAATGGAGAATGG + Exonic
1153007085 18:506513-506535 GTGGGTTTAGAAATGGAGCCTGG + Intergenic
1157427577 18:47597111-47597133 GTAGGTCTTTAAATCTAGAAGGG + Intergenic
1160526564 18:79542096-79542118 GTGGGTGAATAAATGGATGAAGG - Intergenic
1161592928 19:5136832-5136854 CTGGGTCTGGAAATGGGGAAAGG - Intronic
1164201507 19:23022811-23022833 ATGGGTCTATAAAAGCAGAAAGG - Intergenic
1164670370 19:30068948-30068970 GTGGATGGATAAATGGAGGAAGG - Intergenic
1165281247 19:34799586-34799608 GTGTGACTATATTTGGAGAAAGG + Intergenic
1165695280 19:37895984-37896006 TGGGGACTATAATTGGAGAAAGG + Intronic
1166177224 19:41082720-41082742 GTGTCTCTTTAAATGTAGAAAGG - Intergenic
1166201441 19:41240095-41240117 ATGGGTGGATATATGGAGAATGG + Intronic
1166600721 19:44092393-44092415 GTGTGTGTATAAATTGAAAACGG - Intergenic
1167101313 19:47405934-47405956 GTGGGTGGATATATGGATAATGG + Intronic
1168251713 19:55145855-55145877 CTGGGCATATAAATAGAGAAAGG - Intronic
925160387 2:1679379-1679401 GTGTGTCTATAAATGGTGGGTGG + Intronic
925181796 2:1822259-1822281 GTGGGTTTATAAGAGGAGAGTGG + Intronic
928441882 2:31299068-31299090 GTGAGTGTTTAAATGAAGAAGGG - Intergenic
930632549 2:53769538-53769560 GTGATTCTTTAAAAGGAGAAAGG + Intronic
931311454 2:61084975-61084997 GTAGTGCTATTAATGGAGAAAGG + Intronic
931570448 2:63663574-63663596 CTGGCTATAGAAATGGAGAAAGG + Intronic
931851252 2:66252562-66252584 GTGGGATTCTCAATGGAGAATGG - Intergenic
932260572 2:70323474-70323496 CAGGGTCTCTTAATGGAGAAGGG + Intergenic
933209288 2:79548542-79548564 GTGATTCTCTAGATGGAGAAAGG - Intronic
936652759 2:114448432-114448454 ATGGGTCTACAAATGAAGCATGG + Intronic
936972984 2:118192456-118192478 GTGGGGCTATGGATGGATAAAGG + Intergenic
937021126 2:118656826-118656848 GTGGGGATATAAATGGTGAAGGG + Intergenic
938737592 2:134200587-134200609 ATGAGTGAATAAATGGAGAAAGG - Intronic
942802303 2:179889802-179889824 GAGATTCTATAAAAGGAGAAAGG - Intergenic
945047617 2:205795847-205795869 GTGGGTCTAGAATTAGCGAATGG - Exonic
945853913 2:215044435-215044457 GTGAATCTGTAAAAGGAGAAGGG - Intronic
946299591 2:218814528-218814550 CTGGGTCTATAAAGGAAGATTGG - Exonic
946654636 2:221933215-221933237 GTGTGTCTATAATTGGAGATGGG - Intergenic
1170544651 20:17425271-17425293 GTGGGTCTTTTAATGGTGAATGG - Intronic
1175407375 20:58743968-58743990 GTGGGTGGATACATGGAGGAGGG + Intergenic
1176265294 20:64206134-64206156 GTGTGTCTGTAAGTGGGGAAGGG + Intronic
1181537103 22:23552068-23552090 ATGGGAAGATAAATGGAGAATGG - Intergenic
1181848491 22:25732555-25732577 ATGGGTCTGTAATTTGAGAAGGG + Intergenic
1181959004 22:26609601-26609623 ACGTGTGTATAAATGGAGAATGG + Intronic
1182586456 22:31346590-31346612 GGGGGTGTATAAATAGGGAAGGG - Intergenic
951977026 3:28522468-28522490 ATGGATTTATAAATGGACAAAGG + Intronic
952576353 3:34778705-34778727 GTGGGGAAATAAATGGAGAAAGG + Intergenic
953946820 3:47156480-47156502 ATGTGTCAATAAAAGGAGAATGG + Intronic
954838296 3:53490490-53490512 GTGGGAGGAAAAATGGAGAATGG + Intergenic
957755322 3:84477613-84477635 GGGGGTCCATAAATGGAGACTGG - Intergenic
960058898 3:113298392-113298414 TTGGATCTAGAGATGGAGAAAGG + Intronic
960714863 3:120564928-120564950 GGGGGTATATATAAGGAGAAGGG - Intergenic
961872276 3:129997305-129997327 GTGGGTGTATAAATTGGGAGCGG - Intergenic
963749081 3:149156390-149156412 CTGGGTCTTGAACTGGAGAAGGG - Intronic
963762058 3:149294284-149294306 CTGGGCCTATAGAAGGAGAAAGG - Intergenic
964891827 3:161545676-161545698 GTGGGTATATAAATATAGTAGGG + Intergenic
966200539 3:177356583-177356605 GTGGCAGTATAGATGGAGAAGGG + Intergenic
969992377 4:11277849-11277871 GTAGGTCTAGAGAGGGAGAAAGG + Intergenic
972561632 4:40233982-40234004 GTAGGGCCATAAATTGAGAATGG - Intronic
973278986 4:48340734-48340756 GTGAGTCAATAAACGGAGAAAGG + Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
975891358 4:79032601-79032623 GTAGGTTTATGAATGGAGATTGG + Intergenic
978768369 4:112428599-112428621 GAGAGACAATAAATGGAGAAGGG - Intronic
979229995 4:118337708-118337730 GTGGGTGGATAAAAGTAGAAAGG + Intronic
979264088 4:118681694-118681716 GTGGTTATAGAAATGAAGAATGG + Intergenic
979741005 4:124150994-124151016 ATGGTCATATAAATGGAGAAAGG + Intergenic
982533468 4:156577721-156577743 GTGGGTCTAGAAGTGAAGAGAGG + Intergenic
982551562 4:156807708-156807730 TTGGGACTATAAATGGATATCGG - Intronic
983014706 4:162599048-162599070 GCGAGACTACAAATGGAGAAAGG + Intergenic
985149572 4:186932615-186932637 ATGTGTCTAAAAATGGAGGAAGG - Intergenic
987436202 5:17896656-17896678 ATGGGTGAATAAATGGGGAAGGG - Intergenic
987780658 5:22430057-22430079 GGGGGTATATAAAAGGAAAATGG - Intronic
987975363 5:25008933-25008955 ATGGGTCTATAAATGTGTAAGGG - Intergenic
989561583 5:42858333-42858355 GAGTGTCTCTAAATGGAGAATGG - Intronic
991522334 5:67514984-67515006 GTGGGACTAGAAATGGATGAAGG + Intergenic
993507756 5:88732316-88732338 GTGTGTCCTTAAATGAAGAAAGG + Intronic
994243220 5:97448316-97448338 GTGTGTGTATAAAGAGAGAAGGG + Intergenic
995745409 5:115397214-115397236 GTAGGTCTGGAAAAGGAGAATGG + Intergenic
996305389 5:122040497-122040519 GAGGGTCAATAAAGGGAGGAGGG + Intronic
998236502 5:140402467-140402489 GTGGGTCTACGAATGGTGACGGG - Intronic
998815011 5:146004987-146005009 GTGTTTATATAAATGGATAAAGG + Intronic
999671939 5:153965877-153965899 GTGGGTGGGTAAATGGAGACAGG - Intergenic
999764782 5:154731442-154731464 GGGGGTGTATAAATAGAGGAAGG - Intronic
999985015 5:156995392-156995414 GTGGGTGTATGAATAGTGAAAGG + Intergenic
1000962935 5:167621583-167621605 TTGGGTGTAGGAATGGAGAAAGG + Intronic
1001752755 5:174144205-174144227 GTGGGTCAGGAATTGGAGAATGG + Intronic
1002600512 5:180352022-180352044 GTGGCTCTACACATGGAGAATGG + Intronic
1006286642 6:33101088-33101110 GGGGGTCTATGAATAGGGAATGG + Intergenic
1009473004 6:64051451-64051473 CAGGGTCTATCAATGTAGAACGG + Intronic
1012728769 6:102852404-102852426 GTGTGTGTACAAATGGAGTAAGG - Intergenic
1016273416 6:142318686-142318708 ATGGATCTAGAAATGGAGAAGGG + Intronic
1018880707 6:167877092-167877114 GTGGGACTGTAAAGAGAGAAGGG + Intronic
1020283378 7:6663137-6663159 ATGGGTCATTGAATGGAGAAAGG + Intergenic
1020768268 7:12353368-12353390 GTGTGGCTATATTTGGAGAAAGG - Intronic
1023268127 7:38430305-38430327 ATGGGTGTTTAGATGGAGAATGG + Intronic
1024781198 7:52851201-52851223 TTGAATCTATAAATGGAAAATGG + Intergenic
1025275539 7:57579035-57579057 GTGTTTCTATAGATGGAGAGGGG - Intergenic
1025771262 7:64509682-64509704 GTGGGTCTAGAAATCCAGCAGGG + Intergenic
1026365748 7:69646702-69646724 CTGGGTCTACAAAAGGAGAGAGG - Intronic
1027130997 7:75591360-75591382 GTGGGTGTGTATATGGAGAGGGG - Intronic
1028330173 7:89580418-89580440 TTGGGCCTAAAAATTGAGAATGG + Intergenic
1030627365 7:111858834-111858856 ATGTGTCTATACATGGAGGAAGG - Intronic
1031659143 7:124398584-124398606 GTGGGAAAATAAATGGAAAAGGG + Intergenic
1033815064 7:145061068-145061090 GTTGATCTTGAAATGGAGAAGGG + Intergenic
1036991626 8:13604713-13604735 TGGGGTCAACAAATGGAGAATGG - Intergenic
1037927809 8:22858183-22858205 GTGGGTGTTGAAATGGTGAAAGG + Intronic
1038806177 8:30794239-30794261 GTGTGTCTATGGATGGAGAGAGG + Exonic
1042993755 8:74669921-74669943 GTGTGTCTATATCTGGAGACAGG + Intronic
1043055138 8:75428207-75428229 GTGGGTGTATGATTGGAGAGAGG + Intronic
1043109706 8:76165285-76165307 TGGGGTCTGTAAATGGTGAATGG - Intergenic
1043589954 8:81819215-81819237 GTACTTCTAAAAATGGAGAATGG + Intronic
1044020411 8:87099180-87099202 GTTGTTTTAAAAATGGAGAAAGG + Intronic
1047751650 8:127885501-127885523 TTGGGTCTTTATATGGTGAAAGG + Intergenic
1047874160 8:129116709-129116731 CTGGGTCTCTAAATGGAAGATGG + Intergenic
1048200031 8:132364914-132364936 GTTTGTCTGTAAAAGGAGAAAGG - Intronic
1048979837 8:139697312-139697334 GTGGGTGGATGAATGGTGAATGG + Intronic
1051177559 9:14376341-14376363 GTGGGCTTATAAATGAAAAAAGG + Intronic
1052581521 9:30361575-30361597 GTAGGTCTAGAAAAAGAGAATGG - Intergenic
1053365550 9:37520156-37520178 GTGGGTCGGGAAATGGAGGAAGG - Intronic
1054650218 9:67618917-67618939 GTGGGTGGATAGATGGATAATGG - Intergenic
1055612544 9:78038013-78038035 GAGGGTCTATAAATTGATATAGG + Intergenic
1058197976 9:102001973-102001995 GTGGGATTAGAAATAGAGAAGGG + Intergenic
1058577129 9:106415703-106415725 GAGGGTCCTTAAATGTAGAAAGG + Intergenic
1059835532 9:118147898-118147920 TTGACTCAATAAATGGAGAATGG - Intergenic
1060448580 9:123715446-123715468 GTGGGTGAATGAATGAAGAAAGG - Intronic
1187343729 X:18444224-18444246 ATGGTTCCATAAATGGAAAATGG - Intronic
1188330765 X:28868498-28868520 ATGGTTATAGAAATGGAGAAGGG - Intronic
1194821695 X:98515339-98515361 TTGGGTGTTTAAATTGAGAAGGG + Intergenic
1202052978 Y:20799662-20799684 GTTGTTCTGTAAATTGAGAAAGG + Intergenic