ID: 1078993873

View in Genome Browser
Species Human (GRCh38)
Location 11:16676932-16676954
Sequence CTAGATTACCAGGAATATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 2, 1: 9, 2: 26, 3: 51, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078993869_1078993873 -2 Left 1078993869 11:16676911-16676933 CCTGGGCATGCAGTTGGCCTTCT 0: 2
1: 0
2: 3
3: 43
4: 338
Right 1078993873 11:16676932-16676954 CTAGATTACCAGGAATATGTGGG 0: 2
1: 9
2: 26
3: 51
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078993873 Original CRISPR CTAGATTACCAGGAATATGT GGG Intronic
902751512 1:18515225-18515247 CCAGATTCCCAGGGATATGTTGG - Intergenic
904372055 1:30054703-30054725 CTAGATTCCCAGGAATACCTTGG - Intergenic
904546960 1:31282452-31282474 ATAGATAGCCAGGAATATGTCGG - Intronic
906697645 1:47834367-47834389 CTAGATTCTCAGGAATATGTTGG - Intronic
907608392 1:55842649-55842671 CTAGATTCTCAGGAATATGTTGG - Intergenic
908982608 1:69976950-69976972 GGAGATTACCAGGAATCAGTTGG - Intronic
910483482 1:87684105-87684127 GTTGATTATCAGGAAAATGTGGG + Intergenic
910785807 1:90997122-90997144 CTAGAGTCTCAGGAATATGTTGG - Intronic
912784716 1:112589898-112589920 CTTGATTCCCAGAAACATGTGGG + Intronic
914442927 1:147722780-147722802 CTAGAATCCTAGGAATATGGAGG + Intergenic
915116705 1:153605930-153605952 CCACATTGCCAGGAACATGTGGG - Intergenic
915339805 1:155170663-155170685 TTAGGTTACCTGGAATATGATGG + Intronic
915864031 1:159478735-159478757 CTACCTTACCAGGAATATTAAGG + Intergenic
916238765 1:162617589-162617611 CTAGATTACCAAGAATATGTAGG + Intergenic
916861277 1:168808134-168808156 CTAGAATCCCAAGAATAAGTAGG + Intergenic
917399079 1:174626253-174626275 CTAGATTACTTAGAATCTGTGGG + Intronic
918380223 1:183946350-183946372 CTAGATTCTCAGGGATATTTTGG - Intronic
918771629 1:188568052-188568074 ATATATTGCCAGGAATATTTTGG - Intergenic
921228661 1:213046513-213046535 CTAGATTCTCAAGAATATATTGG + Intergenic
922970495 1:229732459-229732481 GTAGATTCCCAGGATTGTGTTGG - Intergenic
923831268 1:237560169-237560191 CTAGAGTCCCAGGAATATGTTGG + Intronic
924906175 1:248454787-248454809 CAATATTTCCAGGAATATATTGG - Intergenic
924921714 1:248637250-248637272 CAATATTTCCAGGAATATATTGG + Intergenic
1063279983 10:4617690-4617712 CTAGATTCCCAGGAATAAGCTGG + Intergenic
1064594881 10:16933756-16933778 CTAGATTTCCAGAAACATGTCGG + Intronic
1064801789 10:19083395-19083417 CTAGATTTGCAGGAATATGTTGG + Intronic
1065063520 10:21933442-21933464 CTAGTTTCCAAGGAATATGTAGG - Intronic
1065422675 10:25564325-25564347 CTAGATTCCCAGAAATATATTGG + Intronic
1066110073 10:32187898-32187920 CCATATTGCCAGGAACATGTGGG + Intergenic
1066585229 10:36926228-36926250 CTAGTTTGACAGGAATAAGTTGG - Intergenic
1068198487 10:53749507-53749529 CTAGATTCCTAGGAATATATTGG + Intergenic
1073721626 10:106179216-106179238 CTAGATTTCCAGGGATGGGTGGG + Intergenic
1074014544 10:109520792-109520814 CTAGTTTACCAGGACTATCAGGG + Intergenic
1077759334 11:5074552-5074574 CCAAATTACCATGAATTTGTAGG - Intergenic
1078119112 11:8488346-8488368 CTAGATTCCTAGGAATATGTTGG - Intronic
1078965325 11:16333226-16333248 CTAGATCAGCAGGAATAAGATGG - Intronic
1078993873 11:16676932-16676954 CTAGATTACCAGGAATATGTGGG + Intronic
1079333687 11:19553232-19553254 CTAGATTTCCAGGAATTTTGGGG - Intronic
1080501382 11:32874601-32874623 CTAGATTTCAAGGAATATCTCGG + Intergenic
1080763054 11:35271263-35271285 CTATATTACCAGCCATCTGTGGG - Intronic
1081539981 11:44027337-44027359 CTAGATTCCCAGAAATAAATTGG + Intergenic
1082632356 11:55557538-55557560 CTAGATTAGCAGAAGAATGTGGG + Intergenic
1083133540 11:60649462-60649484 CTAGATTATCAGAAATATGTGGG - Intergenic
1084398057 11:68927550-68927572 CTAGATTCCCAGGAATATGTTGG + Intronic
1085366562 11:75951803-75951825 CTAGAACACCAAGAAAATGTTGG - Intronic
1085478277 11:76801511-76801533 CTGGACTGCCAGGAATATGGGGG + Intergenic
1086345610 11:85892855-85892877 CTGTATAAACAGGAATATGTAGG + Intronic
1087377540 11:97363665-97363687 CTGTATTACCAGAAATATATGGG - Intergenic
1087854487 11:103075253-103075275 CTAGGTGACTAGGAATAGGTAGG + Intronic
1088128249 11:106455459-106455481 TCAGATTCCTAGGAATATGTAGG + Intergenic
1090169965 11:124592626-124592648 CTAGGTTCCCAGGAATACGTGGG + Intergenic
1090302058 11:125651053-125651075 TTAGATTCCCAGGTATATGTTGG + Intronic
1092086367 12:5766088-5766110 ATAGCTTACCAGAACTATGTGGG - Intronic
1092572738 12:9743020-9743042 CAAGATTCCAAGAAATATGTTGG + Intergenic
1092576010 12:9783188-9783210 CCAGGTTGCCAGGAACATGTGGG + Intergenic
1092580666 12:9837545-9837567 CCAGATTTTCAGGATTATGTGGG + Intronic
1093210649 12:16304282-16304304 CTGGATTACCAGCAGTTTGTAGG - Intergenic
1093301636 12:17465412-17465434 CTAGATACTCAGGAATATTTTGG - Intergenic
1094239279 12:28202763-28202785 CTGGAGTTCAAGGAATATGTTGG + Intronic
1097427325 12:59462658-59462680 CTATATTTTCAGGAATATGTTGG - Intergenic
1098002350 12:65958744-65958766 CTAGATTACCAAGTATTTGTAGG + Intronic
1098602511 12:72348750-72348772 CTACATACCCAGAAATATGTTGG + Intronic
1098693541 12:73521957-73521979 ATAGAGCCCCAGGAATATGTGGG - Intergenic
1099673067 12:85719095-85719117 CTAGATTCCCAGGAATATATTGG + Intergenic
1101024105 12:100583850-100583872 ATATTTTACCTGGAATATGTTGG + Intronic
1102778587 12:115543110-115543132 CTCTATTACCAGGAATAACTTGG - Intergenic
1102941197 12:116943719-116943741 CCAGACTCCCAGGAATATATTGG + Intronic
1105624398 13:22099044-22099066 CTAGATTACAAGGAAGTTGATGG + Intergenic
1106722874 13:32454049-32454071 CTAGATTCCCAGGAATATGTGGG - Intronic
1106790186 13:33147243-33147265 CTAGATTCCTAGGAATACATTGG - Intronic
1108131984 13:47311102-47311124 CTATGTCACCAGGAATATCTGGG - Intergenic
1109082113 13:57917546-57917568 CTTGATTACCAGCAGTATTTGGG + Intergenic
1111940102 13:94599226-94599248 CTGGCTGACCAGGAATATGCTGG - Intergenic
1112141074 13:96643409-96643431 CCAGATTCTCAGGAATTTGTTGG + Intronic
1112249031 13:97761759-97761781 CTACATTCCTAGAAATATGTTGG - Intergenic
1112716624 13:102193416-102193438 CTAGATTCTCAGAAACATGTTGG - Intronic
1114337487 14:21706919-21706941 CTAGAGTTTCAGGAATATGTTGG + Intergenic
1114835195 14:26195833-26195855 ATAGATTCCAAGGAATAAGTGGG + Intergenic
1115910345 14:38249696-38249718 CTAGATTCCCAGGAATACATTGG - Intergenic
1117704958 14:58455887-58455909 CTAGATTCCTAGGAATATGTTGG + Intronic
1119409422 14:74420496-74420518 CTAAATGAACAGGAATCTGTGGG + Intronic
1120002733 14:79321594-79321616 CAAGATGACCTGGAATATCTTGG + Intronic
1124009450 15:25825345-25825367 AGAGATTCCCAGGAATATGCTGG - Intronic
1125780282 15:42259670-42259692 CTAGATTTCCAGGAATATTTTGG - Intronic
1126057555 15:44745012-44745034 CTAGATTACCAGGAATATGTGGG - Intronic
1129981416 15:79874716-79874738 CTAGATTCCCTGGAATATGTCGG - Intronic
1130431729 15:83855247-83855269 CTAGATTTTCAGGAATATGTTGG + Intronic
1131813323 15:96196769-96196791 CTAGATTCCTGGGAATATGTTGG + Intergenic
1132268019 15:100494871-100494893 CTAGATTTCCAAGAACATGTTGG + Intronic
1135602850 16:23797914-23797936 CTAGATCACCAGGAACATCAAGG + Intergenic
1135908158 16:26533023-26533045 CCAGATTTCCAGAAATATGTTGG - Intergenic
1137333339 16:47523649-47523671 CTGACTTTCCAGGAATATGTTGG + Intronic
1137798843 16:51244237-51244259 CTAGATTAACAGGAGGAAGTTGG + Intergenic
1139682607 16:68576776-68576798 CTAGATTTCTAGGAATATGCTGG - Intergenic
1143716657 17:8776477-8776499 CTACATCCCCAGGAATATGTTGG + Intergenic
1143824450 17:9593029-9593051 CAAGATCACCAGGAATAGGGAGG - Intronic
1150316893 17:64176317-64176339 CTAGATTAGAAGGAAAATATGGG - Intronic
1150657292 17:67047781-67047803 CTAGATTCCCAGGAATATGTTGG - Intronic
1150957413 17:69874479-69874501 CTAGAGTCTCAGAAATATGTTGG - Intergenic
1151348511 17:73517855-73517877 CTTCTTTACCAGGAAAATGTTGG + Intronic
1156428173 18:37039141-37039163 CTACATTCCTAGGAATATATTGG + Intronic
1158508727 18:58070540-58070562 CTAGATTCCCAGGAATATGTTGG - Intronic
1159479668 18:68972409-68972431 CTAGGTTTCCAGGAATATTAGGG + Intronic
1165411338 19:35664056-35664078 CTAGATTTCCAAGAATATTTTGG + Intergenic
1167484375 19:49752767-49752789 CTACATTCCCAGGAATTTGTTGG - Intronic
925684209 2:6454753-6454775 CTAGATCCCCAGGGATATGCTGG - Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
928332899 2:30371183-30371205 ATAGAGTACCAGCAATAGGTGGG + Intergenic
928740583 2:34347627-34347649 CTAGATTACAAGCAATTTGAGGG + Intergenic
929347366 2:40902075-40902097 CTACATTTCCAGGAATATATGGG - Intergenic
930844248 2:55884679-55884701 CTAGATTATCAGGAAAATCATGG - Intronic
931167988 2:59770578-59770600 CAAAAATACTAGGAATATGTTGG - Intergenic
931988477 2:67764649-67764671 CTAATATACAAGGAATATGTGGG + Intergenic
932289107 2:70560304-70560326 ATAGATTATCTGAAATATGTTGG - Intergenic
932542446 2:72669791-72669813 CTAGACAACCTGAAATATGTGGG + Intronic
933641776 2:84769860-84769882 CTGGATTCCCAAAAATATGTAGG - Intronic
935893715 2:107710302-107710324 CTAGATTCCCATGAATATGTCGG - Intergenic
935962703 2:108443259-108443281 CTAGATTCCCAAGAATATTGGGG + Intergenic
936342444 2:111646282-111646304 GTAGATTCCCAGGACTGTGTGGG - Intergenic
937558605 2:123192690-123192712 CTTGATTAGCAGAAATATTTGGG - Intergenic
937817403 2:126267151-126267173 CTAGATTTTCAGAAATATGTTGG - Intergenic
938173008 2:129099009-129099031 CTGTGTTTCCAGGAATATGTAGG + Intergenic
939143278 2:138379943-138379965 CTTGATTACCAGGGATGTGGGGG - Intergenic
939157762 2:138544930-138544952 CTAGATTTCCTGGAATATGTGGG + Intronic
939434523 2:142156791-142156813 CTAGAGTCCCAGGAAAATGTTGG + Intergenic
939712854 2:145544698-145544720 CTAGATTCCCAGGAATATAATGG + Intergenic
939898505 2:147821954-147821976 CTACATTTCAAGGAATGTGTTGG - Intergenic
939904912 2:147900534-147900556 CTATATTTCCAGAAATATTTGGG - Intronic
940239603 2:151548898-151548920 TTTGATTCCCAGGAATATGAAGG + Intronic
941255087 2:163219334-163219356 CTAGATACTCAGGAATATGCAGG - Intergenic
942395772 2:175547881-175547903 TTAGATTTCCAGGAATATGTTGG + Intergenic
943822784 2:192348509-192348531 TTATTTTACCAGGATTATGTGGG + Intergenic
943872550 2:193019869-193019891 CTTGAATACCAAAAATATGTAGG + Intergenic
944222159 2:197313308-197313330 CTGGCTCTCCAGGAATATGTAGG - Intergenic
944571978 2:201054063-201054085 CTGGATTCCCAGGAAGTTGTTGG - Intronic
945494398 2:210492002-210492024 CTAGATAACCAGGAACCTGGTGG + Intronic
947045748 2:225981279-225981301 CTAGATTTCCAGGGATATATTGG - Intergenic
1169035324 20:2446046-2446068 CTAGATTTCCAGATGTATGTTGG - Intergenic
1169642181 20:7765302-7765324 CCAAATCCCCAGGAATATGTTGG - Intergenic
1170415614 20:16135889-16135911 CTAGATTTCCAAGAACATGTTGG - Intergenic
1172498265 20:35404949-35404971 CTAGATGCCCAGGAATATATTGG - Intronic
1174890428 20:54385964-54385986 TTTGATTACCAGGAACATATGGG - Intergenic
1175316353 20:58050097-58050119 CTAGATTCTCAGGAATATGTTGG - Intergenic
1178303231 21:31469916-31469938 CTAGATTTCCAGGCATGGGTAGG + Intronic
1180987522 22:19913653-19913675 CTAGGTTCCCAGGAATATGCTGG - Intronic
1181837183 22:25620366-25620388 TTAGGTTGCCAGGAACATGTTGG + Intronic
1184325795 22:43783322-43783344 CTAGATTCCCAAGAATATGTGGG - Intronic
951374169 3:21892285-21892307 CTACAGTGCCAGGAATATGCTGG + Intronic
953457018 3:43051546-43051568 CTAGATTTCCAGGAACATATTGG + Intronic
955919448 3:63940105-63940127 CTGGATTCCCAGGAGTATGGTGG - Intronic
956164656 3:66387254-66387276 CTAGATCCCCAGGAATGTATTGG - Intronic
956336539 3:68170542-68170564 CTGGATTCCCAGAAATATATTGG - Intronic
956446777 3:69333439-69333461 CCAGATTTCCATGAATATTTTGG + Intronic
960446249 3:117752356-117752378 CTAAATGACCAGTAAAATGTTGG + Intergenic
961598174 3:128036111-128036133 CTAGATTCATAGGAATATTTTGG - Intergenic
961862858 3:129931429-129931451 CTAGATCCCCAAAAATATGTGGG + Intergenic
963184535 3:142398730-142398752 CTAGCTTACAGGAAATATGTGGG + Intronic
963819734 3:149876414-149876436 GTAGATGATAAGGAATATGTTGG + Intronic
965719017 3:171640782-171640804 TCAGATTCCCAGGGATATGTTGG + Intronic
966568838 3:181416911-181416933 CTTGAGTAACATGAATATGTGGG + Intergenic
967160601 3:186734121-186734143 CCAGATTATGAGGATTATGTTGG - Intronic
968543381 4:1180034-1180056 CTAGATTCTCAGAAATAGGTTGG - Intronic
969875664 4:10133992-10134014 CCAGGTTACCAGGAATGTCTTGG - Intergenic
970640915 4:18065019-18065041 CTAGATTCACAGGAATATATTGG + Intergenic
972282557 4:37617070-37617092 CTAGATTAGCATGAATCTATTGG - Intronic
972929768 4:44057350-44057372 CTAGATTTGGAGGAAAATGTTGG - Intergenic
972937998 4:44162985-44163007 CCAGATTCCCAGAAATATTTTGG - Intergenic
972983507 4:44734935-44734957 CTAGATTCCAAAGAACATGTTGG + Intergenic
975376203 4:73649330-73649352 CTAAAGTGCCATGAATATGTTGG + Intergenic
979109358 4:116732334-116732356 TCAAATTACAAGGAATATGTAGG - Intergenic
979351473 4:119648715-119648737 CTCCACTCCCAGGAATATGTTGG - Intergenic
981667886 4:147250563-147250585 CTGGATTCCAAGAAATATGTTGG - Intergenic
982031402 4:151304732-151304754 CTAGATTCCCAGGAATATGTGGG - Intronic
983843741 4:172489731-172489753 CTATTCAACCAGGAATATGTTGG + Intronic
984095236 4:175426198-175426220 CTAGGGTACCAAGAACATGTTGG + Intergenic
984789269 4:183600059-183600081 GTAGATTCCCAGGAATATGCAGG + Intergenic
986000470 5:3627173-3627195 CTAGATTCCCAGGTGTAGGTGGG - Intergenic
986261973 5:6155471-6155493 CTAGATTACCAGGAAAGGGCTGG - Intergenic
987724335 5:21678568-21678590 TTAGATTTCCAAGAATATGTTGG + Intergenic
987899285 5:23990034-23990056 CTGGATTCCCAGGAATACTTAGG + Intronic
988120413 5:26954174-26954196 CTGGATTACCAGGTCTCTGTTGG + Intronic
990351942 5:54927321-54927343 CTAAAGTCCCAGGAATATGTTGG + Intergenic
990397049 5:55392749-55392771 CTAGATTTCCAGAAATGTGTGGG + Intronic
991402626 5:66269979-66270001 CTAGATTACTAGAAATATGTTGG + Intergenic
991973829 5:72166441-72166463 CTAGACTACACGGAATATTTTGG - Intronic
992347491 5:75894787-75894809 CTAGATTCCCAGGAATGTGCAGG - Intergenic
993118861 5:83750571-83750593 CTAGATTCCCAGAAATATGTTGG + Intergenic
993475151 5:88355525-88355547 CTGGATTCTCAGGAATATGTTGG + Intergenic
993760226 5:91785877-91785899 ATGGATTTCCAGAAATATGTAGG - Intergenic
994570153 5:101505351-101505373 CTAGATTTCCAAGGATATATGGG + Intergenic
995192452 5:109331930-109331952 CCAGATTACCAGGCAAAGGTAGG + Intergenic
995200195 5:109416198-109416220 CTAGATCCCCAGGAATGTGTTGG - Intergenic
997707544 5:135972118-135972140 TTTAATTCCCAGGAATATGTAGG + Intergenic
998580006 5:143362918-143362940 CTAGATTTCCAGGAGTATGTTGG - Intronic
1001751010 5:174131483-174131505 CCAAATTAGCAGGAATCTGTAGG - Intronic
1003374499 6:5563321-5563343 CCACATTGCCAGGAACATGTGGG + Intronic
1003863173 6:10340469-10340491 CTAGATCACCAGGGACTTGTAGG - Intergenic
1005351876 6:24944085-24944107 CTAGATTCCCAGGAATATGTGGG - Intronic
1005716373 6:28553333-28553355 CTTGATTGCCAGGAGTTTGTGGG + Intergenic
1006279353 6:33036328-33036350 CTAGATTTCCAGGAATATGATGG + Intergenic
1006900436 6:37497044-37497066 CTAGAGTACCAGGTCTATGGTGG - Intronic
1007200357 6:40102836-40102858 CCAGATTCATAGGAATATGTTGG + Intergenic
1008055430 6:46940790-46940812 CCAGAATATCAGGAATATTTGGG + Intronic
1009245301 6:61230614-61230636 CTAGATTTCCAGATATATGTTGG - Intergenic
1014575411 6:123063854-123063876 CTACATTAACATGAATAAGTCGG - Exonic
1014973279 6:127845845-127845867 CTGGATTCTTAGGAATATGTTGG - Intronic
1015277112 6:131394813-131394835 CTAGAATCTCAGAAATATGTTGG + Intergenic
1015635357 6:135269277-135269299 ATAAACTACCAGGATTATGTGGG + Intergenic
1015649549 6:135440449-135440471 CTAGATACCCAGGAATATTTTGG - Intronic
1016062178 6:139642530-139642552 CTAGATTCCCAGCAATGTGCTGG + Intergenic
1016212575 6:141557345-141557367 GTAGTTTTCCAGGAATATCTTGG + Intergenic
1016971245 6:149766216-149766238 AGAGATAACCAGGGATATGTTGG - Intronic
1017468985 6:154721048-154721070 ATAGATTTCCTGGAATATGGTGG - Intergenic
1018118452 6:160611889-160611911 CTAGATTGGTAGGAATCTGTAGG - Intronic
1018120854 6:160634080-160634102 CTAGATTGGTAGGAATCTGTAGG - Intronic
1018933098 6:168255021-168255043 CTATTTTGCCATGAATATGTGGG + Intergenic
1021032592 7:15756203-15756225 CTAGATTCCCAGGAATATGTTGG - Intergenic
1021250501 7:18319623-18319645 CTAAATTACAAGCAATATATTGG - Intronic
1022131320 7:27407103-27407125 ATAAATTACCAGGAAATTGTTGG - Intergenic
1023459522 7:40379864-40379886 ATAGGTTAACAGGAATATGGTGG + Intronic
1024431963 7:49299034-49299056 AGAAATTACCAGAAATATGTTGG - Intergenic
1026669622 7:72377923-72377945 CTAAATTCCCAGGAATATATTGG + Intronic
1027689641 7:81327729-81327751 CTAGATTCCCAGGAATATGATGG + Intergenic
1027759901 7:82263971-82263993 CTAGTTTAACATGATTATGTAGG + Intronic
1027774701 7:82449319-82449341 CTAAATTACCAGGAATCCTTAGG - Intergenic
1028453027 7:91006917-91006939 CTAAATTTTCAGGAATAGGTGGG - Intronic
1028700343 7:93771139-93771161 CTAGATTCCCAGGAATATGTAGG - Intronic
1029001454 7:97159326-97159348 TTAGATTTCCAGAAATATGTGGG + Intronic
1029097712 7:98102234-98102256 CTAGATTTCCAATAATATGGTGG + Intergenic
1029633406 7:101767733-101767755 CTTGATTTCCAGGAATATCAGGG + Intergenic
1031410658 7:121436987-121437009 CCATGTTACCAGGAACATGTGGG + Intergenic
1032184103 7:129708773-129708795 CTATAGTACCAGTAATATCTTGG + Intronic
1034239386 7:149598204-149598226 CAAGAATACCAAGAATATGAGGG - Intergenic
1036001964 8:4615802-4615824 ATAGATTATCAGGAATAAGATGG - Intronic
1037054653 8:14424055-14424077 ATAGATCTTCAGGAATATGTAGG + Intronic
1037186555 8:16071134-16071156 TTAGATCACCATGAATGTGTGGG - Intergenic
1039582682 8:38679941-38679963 CTATTTTAACAGGAAAATGTGGG + Intergenic
1040742321 8:50593071-50593093 CTAGAACATCAGGAATATGAGGG - Intronic
1041632295 8:60101586-60101608 CTAGTTGACCGGGAATATGGAGG + Intergenic
1042287192 8:67126705-67126727 CTAAATTCTCAGGAATATGTTGG + Intronic
1045178582 8:99755063-99755085 GTAGTTTCCCAGGAATATGTTGG - Intronic
1045560700 8:103259554-103259576 CCAGATTTCCAGGAATATGTTGG - Intergenic
1045939524 8:107723401-107723423 GTAGATCTCCAAGAATATGTTGG + Intergenic
1046244685 8:111543587-111543609 CCAGAATCCCAGGAATATGTAGG - Intergenic
1048187541 8:132255473-132255495 CTAGGTTCCCAGGAATATGTAGG - Intronic
1048246987 8:132816086-132816108 CTAAATTAACATGAATATATTGG + Intronic
1048961193 8:139579799-139579821 TTAGATTGACAGGAATATGTTGG + Intergenic
1052096997 9:24395283-24395305 TTATATTACCAGGAATGTGTTGG + Intergenic
1052313969 9:27097372-27097394 CTAGATTTCAAAGAATGTGTAGG + Intergenic
1055203820 9:73701731-73701753 ATAGATCCCTAGGAATATGTGGG - Intergenic
1055390023 9:75810509-75810531 CTAGAGTCCCAGGAAAATGTGGG - Intergenic
1055547148 9:77390356-77390378 CTAGTTTAGCAGGAATCTCTTGG + Intronic
1058302075 9:103388011-103388033 ATAGATTAACAGAAATATCTAGG - Intergenic
1059615110 9:115941868-115941890 CTAGATGCCCTTGAATATGTTGG + Intergenic
1059778294 9:117499135-117499157 ATAGTTTACAAGGAATATCTTGG - Intergenic
1061670641 9:132186317-132186339 CCAGATTTCCAGGAATGTTTGGG - Intronic
1188322582 X:28758292-28758314 CTAGATAACCAGGATGATGATGG + Intronic
1188727471 X:33603810-33603832 CTTGATTCCCAAGAAGATGTTGG + Intergenic
1190211446 X:48451784-48451806 CTAGATTCCCAGGCATGTGTTGG - Intergenic
1190899871 X:54660884-54660906 TTAGATTCCCAGGAATATGTTGG + Intergenic
1192019523 X:67370607-67370629 CCAGATTACAAGGAATATGTAGG - Intergenic
1192593303 X:72380118-72380140 TTAGATTCCCAGGTATTTGTTGG + Intronic
1192694055 X:73395847-73395869 CTAGATTACCAGGACAAATTAGG + Intergenic
1194052599 X:89090385-89090407 ATACATCCCCAGGAATATGTTGG + Intergenic
1194629057 X:96261072-96261094 CTAAATTCCCAGGAATACGATGG + Intergenic
1195373127 X:104199855-104199877 CTAGAGTTCCAGAAATATCTTGG + Intergenic
1195740549 X:108060896-108060918 CTAGATCACCAGGGGTATGGAGG - Intronic
1196026427 X:111045954-111045976 CTAGGTTACCTGGAATTAGTGGG - Intronic
1196968762 X:121086264-121086286 CTAAATTTCCAGGAATATGTGGG + Intergenic
1197156553 X:123276177-123276199 CTAGAATAGCAAGAATATGGAGG - Intronic
1197249726 X:124202383-124202405 TCAGATTCCCAAGAATATGTAGG - Intronic
1197426445 X:126302866-126302888 TTAGATTACCAGGACTCTATTGG - Intergenic
1197908540 X:131454255-131454277 CTAGAATTCTAGGAATATATAGG + Intergenic
1198619519 X:138490609-138490631 TTAAACTAACAGGAATATGTGGG + Intergenic
1198691142 X:139286184-139286206 CTAGATACCCAGGACTTTGTTGG + Intergenic
1199797653 X:151216588-151216610 CCAGATTTCCAGGAACATTTTGG + Intergenic
1202060665 Y:20884595-20884617 CTATGTTGCCAGGCATATGTTGG - Intergenic