ID: 1079003799

View in Genome Browser
Species Human (GRCh38)
Location 11:16778804-16778826
Sequence GGAGTCTGAGCTAAACTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079003795_1079003799 0 Left 1079003795 11:16778781-16778803 CCTTTGCCATTCATATGTAGAGA 0: 1
1: 0
2: 0
3: 14
4: 191
Right 1079003799 11:16778804-16778826 GGAGTCTGAGCTAAACTAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 78
1079003797_1079003799 -6 Left 1079003797 11:16778787-16778809 CCATTCATATGTAGAGAGGAGTC 0: 1
1: 0
2: 0
3: 12
4: 96
Right 1079003799 11:16778804-16778826 GGAGTCTGAGCTAAACTAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079003799 Original CRISPR GGAGTCTGAGCTAAACTAGT GGG Intronic