ID: 1079006307

View in Genome Browser
Species Human (GRCh38)
Location 11:16793704-16793726
Sequence AAGAAATAGGAGATGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 383}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079006307_1079006312 16 Left 1079006307 11:16793704-16793726 CCTGACCACATCTCCTATTTCTT 0: 1
1: 0
2: 5
3: 29
4: 383
Right 1079006312 11:16793743-16793765 CCCAGACTCTGCCAAGAGCTTGG 0: 1
1: 0
2: 2
3: 33
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079006307 Original CRISPR AAGAAATAGGAGATGTGGTC AGG (reversed) Intronic
900077614 1:830531-830553 AGAAAATTGGAGAAGTGGTCTGG - Intergenic
900902644 1:5527365-5527387 GAGAAAGAGCAGATGCGGTCTGG + Intergenic
901263890 1:7894467-7894489 AAGAAATCAGAGAAGAGGTCGGG - Intergenic
901357252 1:8661682-8661704 AAGAAAAAGGACATCTGGCCTGG + Intronic
901503657 1:9670211-9670233 CAGAAACAGAAGTTGTGGTCTGG - Intronic
902987606 1:20164616-20164638 TGGAAATAGGAGATGAGCTCTGG - Intronic
903271427 1:22190700-22190722 AAGAAATGGGAGTTCTGGGCAGG - Intergenic
903926812 1:26836263-26836285 GAGACAAAGGAGATGGGGTCTGG - Intronic
904232639 1:29088970-29088992 AATAAATAGGACATGTGCTTTGG + Intronic
905285847 1:36879825-36879847 CAGAAAGAGGAGATGGGCTCTGG - Intronic
905303269 1:36999783-36999805 AAGAAATAGAAGATGGGGTCAGG - Intronic
905459216 1:38111407-38111429 AAGAAACAGGATGCGTGGTCAGG + Intergenic
905551518 1:38844468-38844490 AAGAAACAGGAGAGGTGGTCGGG + Intronic
905867985 1:41386654-41386676 AAGAAATAGGAGAGGAGGTGTGG - Intergenic
905971188 1:42143790-42143812 AAAAAATAGCACATGTGCTCAGG + Intergenic
906163721 1:43670064-43670086 GAGAAATAGGAGATGATGTAGGG + Intronic
906258335 1:44367564-44367586 AGGAAATAGGAGATGAGGCATGG + Intergenic
907786974 1:57622026-57622048 AAGAAACAGGAGAGGTGGGAGGG + Intronic
908391224 1:63685325-63685347 AAGAGATGGGAGATCTGGCCAGG - Intergenic
909013135 1:70355938-70355960 AAGAAAGAAGAGATCTGGCCGGG - Intronic
909133209 1:71765878-71765900 AAGAAATAAGAGACCTGGCCAGG + Intronic
909501921 1:76344388-76344410 AAAGAATATGAAATGTGGTCAGG - Intronic
909750393 1:79152594-79152616 AAAAAATAGGTAATGTGGTTAGG + Intergenic
910465450 1:87494235-87494257 AAGAAATTGGAGACGGGGTATGG + Intergenic
911783186 1:101909980-101910002 AAGCAAGATGAGATGTGTTCTGG - Intronic
912102647 1:106231226-106231248 AAGGAAGAAGAGATGTTGTCTGG - Intergenic
913227399 1:116712302-116712324 AAGAAATAGAAGTTGAGTTCTGG + Intergenic
913458150 1:119055315-119055337 AAAAAATCTGAGAAGTGGTCAGG + Intronic
914690902 1:150025855-150025877 CTGAAAAAAGAGATGTGGTCAGG + Intergenic
914782844 1:150801412-150801434 AAAAAAGAAGAGATGTGGCCAGG - Intronic
915220983 1:154374166-154374188 AAGAAGTAGGAAATATGGGCTGG + Intergenic
915606076 1:156951825-156951847 AAGAGTCAGGAGATGTGTTCTGG + Intronic
915695398 1:157736196-157736218 AAAAAATAACAGATGTGGCCAGG - Intergenic
916337251 1:163686838-163686860 AAAAAATATGAGAGGTGGTATGG + Intergenic
916374186 1:164134071-164134093 AAGATATAGGTGATATGGTTTGG + Intergenic
918622844 1:186624912-186624934 CAGAAATGAGAGATGTGATCAGG + Intergenic
918814966 1:189170334-189170356 AGGAGAAAGGAGATGTGGTGGGG - Intergenic
919418534 1:197341549-197341571 AAGAAAAGGGTGATCTGGTCTGG + Intronic
920079110 1:203359473-203359495 AAGAAGTAGGAGATGGGGGAGGG - Intergenic
920126092 1:203694929-203694951 ATGATATAGGAGATGGGGGCTGG + Intronic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
920796018 1:209137595-209137617 TAGAAATCTGAGATGTGGCCAGG + Intergenic
921329357 1:214020013-214020035 AAAAAGTAGGAAAGGTGGTCAGG - Intronic
921467529 1:215507316-215507338 AAGAATTAGCAGATGTTCTCTGG - Intergenic
921586132 1:216948259-216948281 AAGAAATAGGGGACCTGGCCAGG + Intronic
921823663 1:219647054-219647076 AAGAAATAGAAGTTGTCGCCAGG + Intergenic
923406823 1:233669462-233669484 AAGATATATTAGATGTGGGCAGG + Intronic
924601083 1:245489939-245489961 AAGAAACAGGAGTTCTGGGCAGG + Intronic
1062801208 10:381861-381883 AAGAGAGAGGAGGTGTGGTGTGG - Intronic
1063141508 10:3260132-3260154 TTGAATTTGGAGATGTGGTCTGG + Intergenic
1064480701 10:15737632-15737654 AAGTAATAGGACATGTTGTTTGG - Intergenic
1064591317 10:16894297-16894319 AAAAAATAGCAGATGTCTTCAGG - Intronic
1065435287 10:25699168-25699190 CAGAAGTAGGAGATGAAGTCAGG + Intergenic
1066295715 10:34052623-34052645 AAGAAAGATGAGATGTGGGTGGG - Intergenic
1067151654 10:43740060-43740082 AACAAAAAAGAGATGAGGTCAGG - Intergenic
1068208031 10:53882656-53882678 AAAAAATAGCAGTTGGGGTCAGG - Intronic
1068226617 10:54114868-54114890 GAGAAGTAGGAGATGAGGTCAGG + Intronic
1068466563 10:57400304-57400326 AAGAAAAACGAGATTTGGGCTGG - Intergenic
1068705580 10:60071727-60071749 AAGAATCAGGAGATTTGGTGGGG + Exonic
1069409175 10:68134826-68134848 ATTAAATAGGATATGTGGTAAGG + Intronic
1069882167 10:71600295-71600317 AAGAAATTGAAGGTGTGGCCGGG - Intronic
1069941859 10:71962143-71962165 AAGAAAGAGGAGTTGTCGGCTGG + Intergenic
1070247321 10:74744551-74744573 AAGAATGAGGAGAAGTGGTGCGG - Intergenic
1071499976 10:86196355-86196377 AAGAAAAACGAGAAATGGTCTGG + Intronic
1071844048 10:89503590-89503612 AATAAAGAAGAGATGTGGACAGG + Intronic
1072457534 10:95589869-95589891 AAGAAAAATGAGATCTGGCCAGG + Intergenic
1073301832 10:102475595-102475617 AGGAATCAGGAGTTGTGGTCTGG + Intronic
1074259426 10:111836822-111836844 TAGAAAAAGGAGGTATGGTCTGG + Intergenic
1074615785 10:115066716-115066738 AAGAAAGATAAGATGTGGTGAGG - Intergenic
1074701786 10:116098678-116098700 GAGAAACAGGAGATGTGGAGAGG - Intronic
1074876126 10:117614687-117614709 GAGTAATAGGAGATGAGATCAGG + Intergenic
1074921067 10:118012925-118012947 CAGACATAGAAGATGTGGACTGG + Intronic
1075617751 10:123903870-123903892 CAGAAATAGGAGATGTGCTGGGG + Intronic
1075760865 10:124855236-124855258 ATGAAATAAGAAATGTGGTTGGG - Intergenic
1076311444 10:129510667-129510689 AAGAAATAGATGATGGGTTCAGG + Intronic
1077739665 11:4831490-4831512 AATAAAAAGCAGATGTGGTAGGG - Intronic
1078139248 11:8680106-8680128 AAGATTCAGGACATGTGGTCAGG + Intergenic
1078471797 11:11593564-11593586 AAAAAAAATTAGATGTGGTCTGG - Intronic
1078652099 11:13205445-13205467 AAGAAAGAAGATATGAGGTCAGG + Intergenic
1078926335 11:15878868-15878890 AAGTAGTAGGAGAAGAGGTCAGG + Intergenic
1079006307 11:16793704-16793726 AAGAAATAGGAGATGTGGTCAGG - Intronic
1079250384 11:18782832-18782854 AATATATAGGAGATGGGGCCAGG + Intronic
1079399610 11:20095676-20095698 AATAAGAAAGAGATGTGGTCTGG - Exonic
1079955947 11:26864708-26864730 AAGAAATATGATATGTGTGCTGG - Intergenic
1081442039 11:43091314-43091336 TAGAAATAGTATCTGTGGTCAGG - Intergenic
1082207869 11:49460297-49460319 AAGAAATATGATATGTGTCCAGG - Intergenic
1082263751 11:50097784-50097806 AAGAAATAAGGAATGTGTTCGGG + Intergenic
1082757916 11:57096455-57096477 AAGAAAAAAGAGAAGGGGTCTGG - Intergenic
1082869428 11:57930504-57930526 AAGAGAGAGGAGGTGTGGTGTGG + Intergenic
1083441255 11:62678238-62678260 AAGAAAGAGGAAATGTGGAAAGG + Intronic
1083791772 11:64990313-64990335 AGGAAACAGGAAATGTGGCCGGG - Intronic
1086176954 11:83902246-83902268 AAGAAATAGGAGATAGGGGAGGG - Intronic
1087267499 11:96076786-96076808 AAGAAGTATGAGCTGTGGCCTGG - Intronic
1087565664 11:99854177-99854199 AGGAAATAGAAAAAGTGGTCAGG - Intronic
1088037799 11:105338534-105338556 AAGAAACAACAGATGTGGTGAGG + Intergenic
1088497977 11:110451429-110451451 AAGAAACAACAGATGTGGTGAGG + Intronic
1088515954 11:110634068-110634090 AAGAAAAAGTAGTGGTGGTCAGG + Intronic
1088538289 11:110885376-110885398 ATGAGGTTGGAGATGTGGTCAGG + Intergenic
1088695477 11:112362479-112362501 AAGAAGTAGGAAATGAGGGCAGG + Intergenic
1088981697 11:114870423-114870445 CAGAGATAGGAAATGTAGTCAGG + Intergenic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1095341918 12:41100176-41100198 AAGAAAGAGGAGAACTGGTTTGG + Intergenic
1095967980 12:47882400-47882422 GAGAAAGAGGAGATGGGGGCTGG + Intronic
1096390854 12:51227978-51228000 AAAAAGTGGGAGATGTGATCAGG + Intergenic
1096426617 12:51509509-51509531 AAGAAAGGGGAGATGTTCTCAGG - Exonic
1096527014 12:52216102-52216124 AAGAAATCAGAGATGGGCTCTGG - Intergenic
1097870503 12:64597906-64597928 AATAAATAAAAGATTTGGTCAGG - Intergenic
1098045538 12:66396813-66396835 AAGAGAAAGGAGATTTGGCCAGG + Intronic
1101579391 12:106028239-106028261 AATAAACAGGAGTTGTGATCTGG + Intergenic
1102340174 12:112115314-112115336 AATAAATAGGGGTTGAGGTCAGG - Intergenic
1102568546 12:113813042-113813064 AAGAAAAACGAGCTGTGGTTTGG - Intergenic
1103225833 12:119286961-119286983 AATGAATAGAAGATGTGGTTTGG - Intergenic
1104424715 12:128666573-128666595 AAGAGATATGATATGTGATCAGG + Intronic
1105619130 13:22050044-22050066 AAGAAATAGGGTATGTGGCTCGG - Intergenic
1105909810 13:24852640-24852662 TAGATATGGGAGATGTGGCCTGG + Intronic
1105977212 13:25482582-25482604 AAGAAGAAGGTGATGTGGTTTGG + Intronic
1106194312 13:27480272-27480294 AAGGAATAGGAGAGGAGGGCTGG + Intergenic
1107100106 13:36581128-36581150 CAGAATGAGGAGATGTGGTTTGG - Intergenic
1107958457 13:45539610-45539632 TAAAAATAGGAGATTTGGGCTGG - Intronic
1108047000 13:46392603-46392625 AAGAAATAGTTGGTTTGGTCCGG - Intronic
1108134022 13:47335459-47335481 AAGAAATAGGAAAAGGGGGCCGG - Intergenic
1108248780 13:48544277-48544299 AACAAAGAGCAGATATGGTCTGG + Intergenic
1108650043 13:52469025-52469047 AAGAAATAGCAGATGCTGGCAGG - Intronic
1109021621 13:57102311-57102333 AACAAAAAGGAGCTGTGGTAAGG + Intergenic
1110647161 13:77900938-77900960 AAGAAAAAGGAAATATGCTCTGG + Intronic
1112125219 13:96458804-96458826 AAGAAAGAGGTGATATGGTTGGG + Intronic
1112602633 13:100871693-100871715 AACAAATAGAATATGTGGTGGGG - Intergenic
1112646942 13:101344115-101344137 AAGAAATCACAGATGTGGTATGG - Intronic
1113176689 13:107572960-107572982 AAGTACCAGGAGATGGGGTCTGG - Intronic
1113225930 13:108159520-108159542 AAAAAAGAGGAGATGAGGCCGGG + Intergenic
1114723065 14:24903946-24903968 AAGAAAATGAAGATTTGGTCAGG - Intronic
1116259077 14:42599710-42599732 AAGTAATACCATATGTGGTCAGG + Intergenic
1118989140 14:70782115-70782137 AAGATACATGAGATGGGGTCTGG - Intronic
1119277497 14:73371934-73371956 AAGAAAGAGGAGAAGTGACCAGG + Intronic
1120639264 14:86990332-86990354 GAGAAATAAGAGATGAGGTGAGG - Intergenic
1120687297 14:87552858-87552880 AATAAATAGGAATTTTGGTCAGG - Intergenic
1120773981 14:88412015-88412037 AAAAAATAGTAGATGTGGCAAGG - Intronic
1121078439 14:91088611-91088633 CAGAGATAGGGGTTGTGGTCAGG + Intronic
1121079436 14:91095818-91095840 AAGATATAGAAGATGTGTTTTGG - Intronic
1121209375 14:92196301-92196323 AATAAATAGTAGATGTTGGCAGG - Intergenic
1121495312 14:94388130-94388152 AAGCAGTAGGAGAGGTGGTGAGG + Intronic
1123462242 15:20483743-20483765 AAGAAAAATGACACGTGGTCGGG + Intergenic
1123655817 15:22516628-22516650 AAGAAAAATGACACGTGGTCAGG - Intergenic
1124272929 15:28299754-28299776 AAGAAAAATGACACGTGGTCGGG + Intronic
1124555209 15:30719053-30719075 AGGAAAAAGGAGATGTGGAAAGG - Intronic
1124676043 15:31686628-31686650 AGGAAAAAGGAGATGTGGAAAGG + Intronic
1125400784 15:39300468-39300490 GAGAAAAAGCAGATTTGGTCTGG + Intergenic
1126184177 15:45814634-45814656 AAAAAATAAGAGATGTTGGCAGG - Intergenic
1127514849 15:59683284-59683306 AAGAAATAGAAGTTGAGGTAAGG + Intronic
1127704476 15:61533447-61533469 AGGAAACGGGAGATGTGGTGGGG + Intergenic
1127836764 15:62796727-62796749 AAGGTATAGGACATGTGGTGAGG - Intronic
1129536787 15:76319649-76319671 AAGAAATATGGAAGGTGGTCAGG - Intergenic
1129545039 15:76386791-76386813 GAGTAATAGGACATGAGGTCAGG + Intronic
1129761741 15:78132712-78132734 AAAAAACAGGAGATGAGGCCGGG - Intronic
1130333150 15:82936846-82936868 TAGAAATAGGAGAGCTGGCCAGG - Intronic
1131879393 15:96846422-96846444 AAAAAATAGGAAATGTTGGCAGG - Intergenic
1133001244 16:2852761-2852783 AATAAATAAGATATGTGGGCAGG + Exonic
1133115709 16:3576963-3576985 TAGAAAAAAGAGATGTGGCCAGG - Intronic
1133507003 16:6422215-6422237 AAAAAAAAGGAGAGGTGGTCGGG - Intronic
1135041668 16:19122147-19122169 ATGAAACAGTAGTTGTGGTCAGG + Intronic
1135419950 16:22299070-22299092 AAGAAAACAGAGATGTGGTAGGG + Intronic
1137423090 16:48352870-48352892 AAGAAATAGGAGACGGAATCAGG - Exonic
1138772959 16:59686937-59686959 AAAACATTGAAGATGTGGTCTGG - Intergenic
1140132914 16:72179934-72179956 ACCAAGTAGGAGATGTGGTTTGG - Intergenic
1140435201 16:74941396-74941418 AACATATAGAAGATGTGGCCAGG + Intronic
1140683936 16:77414640-77414662 AAGAAATAGGAGATTTCATGGGG + Intronic
1140950483 16:79812324-79812346 ATGAAATAGGACTTCTGGTCTGG + Intergenic
1141439250 16:84018810-84018832 AAGACAAAGGGGATCTGGTCGGG + Intronic
1142138041 16:88460517-88460539 AAGAAACAGGGGAGATGGTCTGG + Intronic
1143167761 17:4906305-4906327 AACATATAGGAGAAGTGGGCTGG - Intergenic
1143358767 17:6350820-6350842 AAGAAGTAAGAGATGAGGTCAGG - Intergenic
1143361738 17:6376817-6376839 AATAAATTGAAGATGTGGCCGGG - Intergenic
1143621563 17:8083861-8083883 AAGAATTTGGAAATGTGGCCGGG + Intronic
1146000080 17:29125724-29125746 AAGAAATGAGAGAAGTGCTCTGG - Intronic
1147035437 17:37676402-37676424 GATAGATAGGAGATGTGGTTTGG - Intergenic
1147949961 17:44101865-44101887 AATAAAGAGGAGATGAGGTAGGG + Intronic
1148097102 17:45060225-45060247 AAGAAAGAGTTGATGTGGGCTGG + Intronic
1148680269 17:49469838-49469860 AAGAAATAGGAGCACTGGACCGG - Intronic
1150990818 17:70256719-70256741 AAAAAATATGAGAGGTGGACAGG - Intergenic
1152160151 17:78663760-78663782 AATAAATAGAATATGTGTTCTGG - Intergenic
1153370759 18:4313270-4313292 AAGAAAAAGTAGATGTGGGTTGG + Intronic
1153785841 18:8534575-8534597 AAAAAATAACAGATGTGGTGAGG + Intergenic
1156080596 18:33330023-33330045 AAGAAATAGGAAATCTGAGCAGG - Intronic
1156479592 18:37427589-37427611 ATGCAAGAGGAGATGAGGTCAGG - Intronic
1156953859 18:42937568-42937590 AGAAAAAAGGAGATGTGCTCTGG + Intronic
1157876770 18:51281098-51281120 AAGGAATAGAAGATGAAGTCAGG - Intergenic
1158302281 18:56065456-56065478 AAAAAAAAGGAGCTGGGGTCGGG - Intergenic
1159449159 18:68577509-68577531 AAGGCATAGGACATGTGGTAAGG + Intergenic
1160101345 18:75922832-75922854 AAGACATCGGTGATGTGGTGAGG + Intergenic
1160848328 19:1176929-1176951 AAAAAAAAGGAGATTTGGCCGGG - Intergenic
1162732191 19:12725072-12725094 AAGAAATAGGAAAACTGGGCCGG - Intergenic
1162961026 19:14126900-14126922 ATAAAATAGAAGATGTGGCCGGG - Intronic
1163087104 19:14989574-14989596 AAGAAAAAAGATAAGTGGTCAGG + Intronic
1164557359 19:29263796-29263818 AAGAAAAAGGAGATTTGGAATGG - Intergenic
1164719267 19:30420282-30420304 AAGACATAAGAGATGTGATCAGG - Intronic
1165242274 19:34478283-34478305 AGGAGATAGAAGATGGGGTCAGG + Intergenic
1166239373 19:41479419-41479441 AGGAAATATGAGATGTTGTTTGG + Intergenic
1166311737 19:41966908-41966930 AAGAGATGGGCGATGTGGTGGGG + Exonic
1166646289 19:44534124-44534146 AATAATTAGGAAATGTGGCCAGG + Intergenic
1167475385 19:49697607-49697629 AAGAAAAAGGAGGTGAGGCCGGG + Intronic
1167583048 19:50357770-50357792 GAGAAACAGGAGATGAGATCCGG + Intronic
1168565278 19:57417201-57417223 AGGAAATAGCGGATTTGGTCAGG + Intronic
925595244 2:5549235-5549257 AAGAGATAGGAAGTGTTGTCTGG - Intergenic
926016242 2:9454420-9454442 AAGAAATAGCAGCAGTGGTGAGG + Intronic
926234307 2:11027847-11027869 AAGAAATTTGAGATGCGGGCCGG - Intergenic
926823754 2:16881917-16881939 AAGAGATTGGAGAAGTGGTGTGG + Intergenic
927120427 2:19955243-19955265 TAGAAATATAAGATGTGGCCAGG - Intronic
927356151 2:22175837-22175859 AAAGAAAAGGAGATGTGGTGAGG - Intergenic
928063216 2:28136112-28136134 AAAAAATACAAGATGTGTTCGGG - Intronic
928628769 2:33169040-33169062 AATAAAAAGGAGTTGTAGTCGGG + Intronic
930879183 2:56252339-56252361 AAAAAATAGTTGATGAGGTCAGG - Intronic
931970987 2:67586159-67586181 AGGTAATGGGAGATGTGGTCAGG + Intergenic
933254051 2:80060474-80060496 AAGAAATAGGAGATATTGAATGG - Intronic
934746700 2:96764003-96764025 AAGCAATAGGAGAAGTCTTCAGG - Intronic
935243868 2:101201590-101201612 GAGAAATAAGAGATGAGTTCTGG - Intronic
935813811 2:106827500-106827522 AGGCAACAGAAGATGTGGTCTGG - Intronic
935902831 2:107810953-107810975 GAGAAATAGGAGAAGTGGGGAGG + Intergenic
942542521 2:177029460-177029482 CAGAAATATCAGATGTGGACAGG - Intergenic
942576145 2:177365221-177365243 AGGAATGAGGAGATGTGGTCTGG + Intronic
944218479 2:197278857-197278879 CAGAAACAGGCGGTGTGGTCTGG + Intronic
944330327 2:198458016-198458038 AAGAAGTAGAAGAGGTTGTCTGG - Intronic
945462398 2:210124955-210124977 AAGAAATAGAAAATTTGGGCTGG + Intronic
945697508 2:213126269-213126291 AAGAAATGGGAAAAGTGGTAGGG - Intronic
946169713 2:217887602-217887624 AAGAACTAGGGGATGTTGGCTGG - Intronic
946352232 2:219162678-219162700 AAAAAATGGGAGATGAGGTTGGG - Intronic
947426891 2:229991867-229991889 AAGAAATTGGAGATGGGGAAAGG - Intronic
1169120148 20:3090856-3090878 AAGAAACAGAAGGTGTGGGCAGG - Intergenic
1170674045 20:18462698-18462720 AAGAAATAAGAGTTGAGGCCGGG + Intronic
1170759341 20:19236039-19236061 ATGAGATAGAAGAAGTGGTCAGG - Intronic
1170874378 20:20236450-20236472 AAGAATTAGAAAATGTGGTTTGG - Intronic
1171257216 20:23698536-23698558 ATGAAATAGAAGAAGGGGTCTGG + Intergenic
1172639262 20:36431224-36431246 CAGAGCTAGGAGATGTGGGCTGG + Intronic
1172874014 20:38153227-38153249 AAGAATGAGCAGATGTGGCCGGG + Intronic
1173341241 20:42154782-42154804 AAAATATAAGAGATGTGGGCTGG - Intronic
1173381679 20:42550262-42550284 AAGAAATTGGAACGGTGGTCTGG - Intronic
1173931690 20:46826160-46826182 AACAAATATCAGATGTGGGCAGG + Intergenic
1175326315 20:58130891-58130913 AAGAAATAGGAGCTGCCTTCAGG + Intergenic
1179379269 21:40883363-40883385 AAGAAATAAAAGAGGTGGCCGGG + Intergenic
1179780507 21:43697219-43697241 AAGAAATAAAAGATGGGGCCGGG + Intergenic
1180890198 22:19282340-19282362 AAGAAATAGGCAATGGGTTCGGG + Intronic
1182042686 22:27250634-27250656 AAGAAGCAAGAGATGGGGTCAGG + Intergenic
1182679365 22:32066814-32066836 AAGAAAGAGCAGAGGTGGGCTGG - Intronic
1182859255 22:33545234-33545256 AAGACATAGGTGTTCTGGTCAGG - Intronic
1183699737 22:39444544-39444566 GAGGAATAGGAGATGGGGTGGGG + Intergenic
1183819373 22:40332953-40332975 AAGAAAGAGCAGAGGAGGTCGGG + Exonic
1184777364 22:46630005-46630027 AAGAAAAAGAAAATGTGGCCTGG - Intronic
949612042 3:5712678-5712700 AATAAAGAGGAGATAAGGTCTGG + Intergenic
951393132 3:22131212-22131234 AAGACAGAGACGATGTGGTCAGG + Intronic
951957210 3:28270407-28270429 AAGAAACAACAGATGTGGTGAGG - Intronic
953000052 3:38924156-38924178 AAGAAATGGGAGCTGTTGTGTGG - Intronic
953518968 3:43622821-43622843 AAGAAATAGGAGAGCAGGTAAGG - Intronic
954064923 3:48098211-48098233 AAGAGATAGGAGTTTTGGCCAGG - Intergenic
954804144 3:53205849-53205871 AAGAAATAGGAGAAATAGGCTGG + Intergenic
956910960 3:73816550-73816572 AAGCTGTAGGAGATGAGGTCAGG + Intergenic
956938325 3:74129409-74129431 AAGAGATTGGAGCTGAGGTCTGG + Intergenic
958472993 3:94545091-94545113 GGGAAATAGGAGATGTGACCAGG - Intergenic
959860599 3:111210863-111210885 GACAAATAGCAGATGAGGTCTGG + Intronic
960309105 3:116098615-116098637 AAAAAATAGGAGGTGAGGTGGGG - Intronic
960529902 3:118752742-118752764 AAGGAAGAGGAAATGTGGTCAGG + Intergenic
964628428 3:158781817-158781839 AAGAAACAGAGGATGTTGTCCGG + Intronic
964813734 3:160694358-160694380 AAGGAATAGGAGATGGAGTGAGG + Intergenic
965465123 3:169019998-169020020 TAGAGATAGGAGATGTGGGTTGG - Intergenic
966254641 3:177904001-177904023 AAGAAATTGGAGTAGTGGGCAGG + Intergenic
966281505 3:178235795-178235817 AAAAAATAGGAGATAGGGTGGGG - Intergenic
966613557 3:181891527-181891549 AAGAAAAAGAAAATGTGGGCTGG - Intergenic
966709555 3:182956928-182956950 AAGAAATTGGAAATGTGTTTGGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967237750 3:187403556-187403578 AAGAACTAGGAGATGGTGTCAGG + Intergenic
970599004 4:17626242-17626264 AAGAAAAAGGAGATGTTGAATGG + Exonic
971584256 4:28384875-28384897 AAGAACTAGGAAATGTAGCCAGG - Intronic
973927051 4:55749153-55749175 AAGAAAGAGGAGATAAGGTTGGG + Intergenic
974157892 4:58098045-58098067 CAGAAATAGGAGCTGTTGGCAGG - Intergenic
974908959 4:68092079-68092101 AAGAGATTGGAGATCTGGCCAGG - Intronic
976410012 4:84702799-84702821 AAGAAATATGAGTTCTGGCCGGG + Intronic
976749110 4:88436100-88436122 AAGAAACAGGAGTTCTGGCCTGG + Intronic
977138770 4:93340054-93340076 GATAAATAGGTGATGTGGTTAGG - Intronic
977481435 4:97582118-97582140 CAGAAGTAGGAGATGGGGTTGGG - Intronic
978129628 4:105179377-105179399 AAGAAATAGGGGAGGTGATGGGG + Intronic
978746860 4:112204369-112204391 AAGAAATGGGACATTTGGCCGGG - Intergenic
981269302 4:142825790-142825812 AAAAAATAGGAGATGTGTTTGGG + Intronic
981402467 4:144329542-144329564 AAGCTAGAGGAGCTGTGGTCAGG + Intergenic
981495674 4:145389397-145389419 AGGAAAAAGGAGTTGTGGGCGGG - Intergenic
981829141 4:148980126-148980148 TTGAAATATGAGATGTGGTGAGG + Intergenic
982804043 4:159740833-159740855 AAAAAATAATAGATGTTGTCAGG - Intergenic
982959725 4:161822083-161822105 AAAAAATAGTAGATGTTGGCAGG - Intronic
983966090 4:173812092-173812114 AATAAATAGCAAATGTGCTCTGG - Intergenic
985268901 4:188176178-188176200 AGGAAATAGGCCATGTGGTGAGG - Intergenic
985269114 4:188177423-188177445 AAAAAAAAGGAGATGGGGGCAGG + Intergenic
985325182 4:188759951-188759973 AAGAAAGAGAAAATGTGGTATGG - Intergenic
987134694 5:14889849-14889871 AAGAAGCAGGAGCCGTGGTCTGG + Intergenic
987167287 5:15214022-15214044 AAAGAATAAGAGATGTGGTTGGG + Intergenic
987302433 5:16608376-16608398 AAGAAATGGGAGATGAGCACTGG - Intronic
987636037 5:20543632-20543654 ATGAAATAGGAATTGTGGTGAGG - Intronic
989273564 5:39560017-39560039 GAGAAATATGAGATGATGTCAGG - Intergenic
989555039 5:42784241-42784263 AAAAAATAACAGATGTTGTCAGG - Intronic
990608134 5:57430425-57430447 AAGAAATCGTGGAGGTGGTCGGG - Intergenic
991437593 5:66612550-66612572 AAGAAATAATAGATCTGGTCAGG + Intronic
991921094 5:71657720-71657742 AAGAATAAGGAGATGTGGTCAGG - Exonic
991972967 5:72158451-72158473 AAGAAAGAGGAGAGGTGTTTGGG + Intronic
992536203 5:77706516-77706538 AAGAAATAGGAGGTGCTGGCTGG + Intronic
993132038 5:83911101-83911123 AAGAAACAGGAGATGGAGTGAGG - Intergenic
993732491 5:91439180-91439202 AAGAAATAGTAACTGTGGTCAGG + Intergenic
993823233 5:92646900-92646922 ACAAAATTTGAGATGTGGTCAGG + Intergenic
994364753 5:98900296-98900318 AAGAAAAAAGAAATGTGGTCAGG + Intronic
994983695 5:106907926-106907948 GAGAAATAGGAGGTGAGGTCAGG + Intergenic
995101450 5:108311962-108311984 AAGCTACAGGAGATGGGGTCAGG - Intronic
995653458 5:114397681-114397703 AAAAAATAATAGATGTGGCCAGG - Intronic
996056609 5:118989129-118989151 AAGCAATAGGAGAGCTGGCCCGG + Intergenic
996786269 5:127239944-127239966 AATAAATGGGGGATGGGGTCAGG - Intergenic
997940596 5:138153969-138153991 AAGAAAATGGTGATGGGGTCGGG - Intronic
998250767 5:140550657-140550679 AAGGCATAGGAGATGGTGTCCGG + Exonic
998885940 5:146693508-146693530 AAGAAATACTAGTTGTGGTCGGG - Intronic
999092564 5:148950184-148950206 AAGAACCAGGTAATGTGGTCTGG - Intronic
999606493 5:153322812-153322834 AAGCAATGGTGGATGTGGTCAGG - Intergenic
1000263084 5:159608327-159608349 AAAAAATAACAGATGTGGTGAGG + Intergenic
1000668153 5:164024675-164024697 AAAAAATAACAGATGTGGTAAGG - Intergenic
1003537682 6:6989925-6989947 AATAAATAGGATATGAGGCCAGG + Intergenic
1005080065 6:21947891-21947913 AAGTAGTGGGAGATGTGCTCTGG - Intergenic
1005220277 6:23578798-23578820 GAGAGATAGGAGATGGGGTCAGG + Intergenic
1006267985 6:32941308-32941330 AAGGAATAGGAGAGGTTATCTGG - Intronic
1007784661 6:44272675-44272697 ATGAAACAGAAGATGTGGACAGG - Intronic
1008655395 6:53607009-53607031 AAAAAATAGTAGATGTTGGCGGG - Intronic
1009552587 6:65118245-65118267 ATGATGTAGGAGATGTGGGCTGG + Intronic
1010089091 6:71958512-71958534 AAGGAATGGGAGAAGTGGTCAGG + Intronic
1010272112 6:73926425-73926447 AGGAAAAAAGAGATGTGGCCGGG - Intergenic
1010749639 6:79603791-79603813 AAGAAAAAAGAAAAGTGGTCTGG - Intergenic
1011769381 6:90659279-90659301 AAAAAATAACAGATGTTGTCAGG + Intergenic
1012277678 6:97293726-97293748 AAGAAATTGGGGGTGTGGTGGGG - Intergenic
1013568672 6:111396823-111396845 AAGAAATAGGAAACCTGGCCAGG - Intronic
1013758368 6:113486822-113486844 AAGAAATAAGAAATGTGGCCGGG + Intergenic
1014443371 6:121498579-121498601 AAGAAATAGGTTAGGTGATCTGG - Intergenic
1014940630 6:127434279-127434301 AGGAAATGGGAGATGAGGCCAGG + Intergenic
1015460107 6:133480928-133480950 AAGAAATGGGAGAGGTGGAAGGG + Intronic
1016580431 6:145623533-145623555 AGTAAGTAGGAGATGTGGTCAGG + Intronic
1016806402 6:148216712-148216734 AAGAAAAAAGAGATGAGGTCAGG - Intergenic
1016941585 6:149486765-149486787 AACAAATAGGAGTTGTCGGCCGG - Intergenic
1017991736 6:159494937-159494959 AAGAATTAGGAGATGAGGTGGGG - Intergenic
1020005047 7:4778491-4778513 AAGAAACAGGACATGGAGTCTGG + Intronic
1020456479 7:8379381-8379403 GAGAAATAGAACATCTGGTCTGG - Intergenic
1020484741 7:8707335-8707357 AATACATAGGAAATGTTGTCAGG - Intronic
1020653542 7:10903745-10903767 AACGAATAGGATATTTGGTCAGG - Intergenic
1021004910 7:15382283-15382305 AAGAAATGGGAGATATGTTTTGG - Intronic
1021023276 7:15631090-15631112 AAGAAATAATAGATGTTTTCTGG - Intronic
1021618181 7:22523905-22523927 AACAAATAGGAGAGGTGGGTGGG + Intronic
1021685951 7:23186033-23186055 AAGAAATAAGATATGTGGCTGGG - Intronic
1022927779 7:35073380-35073402 AACAAATAGGAGAGGTGGGTGGG + Intergenic
1023405671 7:39831271-39831293 AGGAAATTTGAAATGTGGTCAGG + Intergenic
1023934192 7:44727526-44727548 AAGTAATAGGAGATGAAGGCAGG + Intergenic
1025219473 7:57093987-57094009 AATAAATAAGAGCTGTGGTAGGG - Intergenic
1025652004 7:63478485-63478507 AATAAATAAGAGCTGTGGTAGGG + Intergenic
1025768159 7:64477598-64477620 AAAAAATAGGACATGTTGCCAGG - Intergenic
1026027996 7:66762616-66762638 AAGAAATAGGACATGAAGGCTGG + Intronic
1026122375 7:67549152-67549174 AAGAAATAGTACATGTGGCCAGG - Intergenic
1028374498 7:90132204-90132226 AACAAATAGGAGAGGTGGGTGGG - Intergenic
1028646507 7:93103392-93103414 AATACATAGAAAATGTGGTCCGG - Exonic
1028843897 7:95458846-95458868 AAGAAATAGAAGATGTGGTAGGG - Intergenic
1028881021 7:95880259-95880281 AAGAAACATCAGATGTGGACAGG - Intronic
1028964786 7:96790068-96790090 AAGAAATATGAGGTCTGGGCTGG - Intergenic
1029596494 7:101540240-101540262 AAGAAGTAGACGATCTGGTCAGG + Intronic
1030130549 7:106195850-106195872 AGGGAATAGAAGATGAGGTCAGG - Intergenic
1030629843 7:111883711-111883733 CAGGAAAAGGTGATGTGGTCAGG + Intronic
1030903004 7:115148081-115148103 AAGAAAGAGAGGATGTGTTCTGG + Intergenic
1032448115 7:132002082-132002104 ATGAGATTGGAGAAGTGGTCAGG + Intergenic
1032515899 7:132506027-132506049 AGGAAATAGGAGAGGTGCTATGG - Intronic
1034623579 7:152475248-152475270 AAGAAATGGAAGATGAGGCCGGG + Intergenic
1034839575 7:154383348-154383370 AAGAAATAGGAGATGTGAAGAGG - Intronic
1035528009 8:329106-329128 AGAAAATTGGAGAAGTGGTCTGG + Intergenic
1036948060 8:13113801-13113823 AAGAAATTGGAGATATTCTCTGG + Intronic
1039473845 8:37829135-37829157 ATGAAAAAGGAGATGAGGTTGGG - Intronic
1039931451 8:41994379-41994401 GAGCAATAGAAGATGAGGTCAGG - Intronic
1041973650 8:63772742-63772764 AATAAACACCAGATGTGGTCTGG + Intergenic
1042118523 8:65458774-65458796 AAGAAATAGAAGATTGGGTGTGG + Intergenic
1042725499 8:71870715-71870737 AAAAAATAACAGATGTGGACAGG - Intronic
1043216126 8:77591330-77591352 AAGAAAAAAGAGATATGGTTTGG + Intergenic
1043661405 8:82746961-82746983 AAGAAATAGAAGTTGTTGGCCGG + Intergenic
1043864666 8:85361379-85361401 AAGAGATATCAGATGTGGCCAGG + Intronic
1044518850 8:93174338-93174360 AAGGAATAGGAGATTTGGCATGG - Intergenic
1045366541 8:101481577-101481599 AAGGAATTGGAAATGTGTTCTGG - Intergenic
1045635658 8:104185728-104185750 AAAAAATAAGAGATGTTGGCAGG + Intronic
1046605088 8:116362490-116362512 AAGCCAGAGAAGATGTGGTCTGG + Intergenic
1046971085 8:120224009-120224031 AAAAAAAAGGAGATGAGGGCAGG - Intronic
1046981639 8:120342715-120342737 AAGGAATAGAAGATCTGATCTGG - Intronic
1047038756 8:120969506-120969528 AAAAAATAGTAGATGAGGGCCGG - Intergenic
1047200037 8:122757364-122757386 AAGGAGAAGGAGATGTGGTAAGG - Intergenic
1048013526 8:130477734-130477756 AAGAAAAAAGAAATGTGGCCGGG - Intergenic
1048096252 8:131298306-131298328 AAGAAATAGGAGATGATATTGGG + Intergenic
1049364806 8:142232026-142232048 AAGAAACAGGAGCTGAGGTCAGG + Intronic
1049990103 9:982204-982226 AAGAACTAGGAGATGAGCACAGG - Intronic
1053092429 9:35291343-35291365 AAAAATTAGGAGATCTTGTCAGG - Intronic
1053126983 9:35589753-35589775 AAAAAATAACAGATGTGGGCTGG + Intergenic
1054374705 9:64440566-64440588 ATTAAATAGGAGATTTGGTGGGG - Intergenic
1055789045 9:79901623-79901645 GAGAAAGAAGAGATGGGGTCTGG + Intergenic
1056027607 9:82515400-82515422 AAGAAGTAGGAGTTGAGGTTGGG - Intergenic
1056615758 9:88164166-88164188 AAGAAATAGGAGTCTTGGTAGGG - Intergenic
1057155382 9:92833623-92833645 AAAAAATAGCAGATGTGGCAAGG + Intergenic
1061095640 9:128455655-128455677 AAGACAGAGGCGATGTGGGCAGG + Intronic
1061259153 9:129470037-129470059 AAGAGAGAGAAGATGTGGTTTGG + Intergenic
1061380066 9:130250412-130250434 AAGAAATTGGATTTGTGGCCAGG - Intergenic
1186247480 X:7629905-7629927 GAGAAATAGCAGATCAGGTCTGG - Intergenic
1186312876 X:8339466-8339488 AAGAAGTGGGAAATATGGTCAGG + Intergenic
1186410013 X:9338756-9338778 AAGAAATATGAGATGCCGTTTGG + Intergenic
1186490120 X:9965110-9965132 AAGAAATAGGAGATTGGGTCAGG + Intergenic
1186649050 X:11539619-11539641 CAGAAGTGGGAGCTGTGGTCTGG - Intronic
1187732071 X:22265313-22265335 AAGCAATGGGAGATATGGTCGGG - Intergenic
1188995795 X:36883652-36883674 AAGAAATAAAAGATCTGGTGGGG - Intergenic
1191979500 X:66910482-66910504 GAGCAGTAGGAGATGTGGCCGGG + Intergenic
1192385667 X:70666718-70666740 GAGAATTAGGAGATGTGATCAGG - Intronic
1192683433 X:73278305-73278327 AAGAAATAGGTGGTGTGAGCTGG + Intergenic
1193670957 X:84385506-84385528 AAGAAATCAGAGATGAGGCCGGG - Intronic
1197170643 X:123430025-123430047 AATAAGTGGGAGATGGGGTCTGG - Intronic
1197949525 X:131879268-131879290 AAGAAATGCAAGATGTGATCAGG - Intergenic
1198833106 X:140772038-140772060 TAAAAATAGGAAATGAGGTCAGG - Intergenic
1198935279 X:141897310-141897332 AAGAAATAGGAGTGGTTGTCGGG - Exonic
1199118271 X:144018309-144018331 AAAAAATAGGATATTTGGACAGG + Intergenic
1199419949 X:147633721-147633743 TAGAAATAGGTCATGTGGTCTGG + Intergenic
1199749820 X:150804888-150804910 AAGAAATAGAAAATCTGGCCAGG + Intronic
1199750382 X:150810904-150810926 AAGAAATAGAAAATCTGGCCAGG + Intronic
1199786009 X:151105486-151105508 AAGGGGTAGGAGACGTGGTCGGG - Intergenic