ID: 1079007712

View in Genome Browser
Species Human (GRCh38)
Location 11:16803796-16803818
Sequence AGGAAGGCTGGCCTTACCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 250}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079007712_1079007715 -6 Left 1079007712 11:16803796-16803818 CCGTGGGTAAGGCCAGCCTTCCT 0: 1
1: 0
2: 2
3: 15
4: 250
Right 1079007715 11:16803813-16803835 CTTCCTTACCCTTTACCATTTGG 0: 1
1: 0
2: 0
3: 12
4: 232
1079007712_1079007716 -5 Left 1079007712 11:16803796-16803818 CCGTGGGTAAGGCCAGCCTTCCT 0: 1
1: 0
2: 2
3: 15
4: 250
Right 1079007716 11:16803814-16803836 TTCCTTACCCTTTACCATTTGGG 0: 1
1: 0
2: 1
3: 17
4: 258
1079007712_1079007720 7 Left 1079007712 11:16803796-16803818 CCGTGGGTAAGGCCAGCCTTCCT 0: 1
1: 0
2: 2
3: 15
4: 250
Right 1079007720 11:16803826-16803848 TACCATTTGGGAAGAAGACCTGG 0: 1
1: 0
2: 1
3: 14
4: 143
1079007712_1079007725 28 Left 1079007712 11:16803796-16803818 CCGTGGGTAAGGCCAGCCTTCCT 0: 1
1: 0
2: 2
3: 15
4: 250
Right 1079007725 11:16803847-16803869 GGCCAAGGTAAAAAGGAACCTGG 0: 1
1: 0
2: 0
3: 15
4: 200
1079007712_1079007722 13 Left 1079007712 11:16803796-16803818 CCGTGGGTAAGGCCAGCCTTCCT 0: 1
1: 0
2: 2
3: 15
4: 250
Right 1079007722 11:16803832-16803854 TTGGGAAGAAGACCTGGCCAAGG 0: 1
1: 1
2: 1
3: 21
4: 260
1079007712_1079007723 21 Left 1079007712 11:16803796-16803818 CCGTGGGTAAGGCCAGCCTTCCT 0: 1
1: 0
2: 2
3: 15
4: 250
Right 1079007723 11:16803840-16803862 AAGACCTGGCCAAGGTAAAAAGG 0: 1
1: 0
2: 0
3: 15
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079007712 Original CRISPR AGGAAGGCTGGCCTTACCCA CGG (reversed) Intronic
901000989 1:6148771-6148793 AGGAGGGCAGGCCTTCCCCTGGG + Intronic
901165981 1:7221855-7221877 AGGAAGGCAGGGGTCACCCATGG - Intronic
902216179 1:14935816-14935838 AGAGATCCTGGCCTTACCCATGG + Intronic
902449913 1:16490579-16490601 AGGGAGGCCAGCCTGACCCAAGG - Intergenic
902672423 1:17983979-17984001 TGGGGGTCTGGCCTTACCCAGGG - Intergenic
902692074 1:18116276-18116298 AGGAAGGATGGGCATACCCAGGG - Intronic
903265750 1:22157001-22157023 AGGAAGGCCGGCCCTCTCCATGG + Intergenic
905168404 1:36096946-36096968 AGGGAGGTTGCCCTTTCCCAGGG + Exonic
905884705 1:41485354-41485376 AGGAAGGATGCCCTTGGCCATGG - Intergenic
906248069 1:44290919-44290941 GGGAAGGCTGAGCTTACACATGG + Intronic
908000553 1:59674169-59674191 AGGAAGGATGGCCTCAGACAGGG - Intronic
911582338 1:99648349-99648371 AGGAAAGCTGGCGTGTCCCAGGG - Intronic
915071554 1:153272866-153272888 TGCAGGGCTGGCCTTACCTAAGG + Intergenic
916916853 1:169416292-169416314 TAGAAGGCTGGCGTGACCCATGG - Intronic
918310132 1:183279749-183279771 GGGAAGGCTGCCCTGACCCTGGG - Intronic
918405172 1:184205277-184205299 AGGAGTGTTGGGCTTACCCAAGG - Intergenic
920369611 1:205469940-205469962 AGGCAGGCTGGCCCAACTCAAGG + Intergenic
920701013 1:208218055-208218077 AAAGAGGCTGGCCTGACCCAGGG + Intronic
922516782 1:226213952-226213974 AGGAAGGATGGCCTAAAGCAGGG + Intergenic
922567331 1:226609328-226609350 ATGAAGGCTGTCCTCCCCCAAGG + Intergenic
922655328 1:227377342-227377364 AGAAAGCATTGCCTTACCCAAGG + Intergenic
923087423 1:230712155-230712177 AGGAAGCCTGGCCTAGCCCTGGG - Intronic
923282796 1:232461019-232461041 TGGAAGGCTGGCCTTCGCCAAGG - Exonic
924111127 1:240701046-240701068 AGAGAGGCTGGCCTTAGACATGG + Intergenic
1065324860 10:24541687-24541709 TGGAGGCCTGGCCTTTCCCAAGG - Intronic
1067128200 10:43538381-43538403 AGGAAGGCATTCCTTCCCCAGGG - Intergenic
1067574467 10:47400472-47400494 AGAAAGCCTGGCCATACCCAGGG - Intergenic
1068637744 10:59366556-59366578 AGGAAGCCTGGTCATTCCCAAGG - Intergenic
1070282843 10:75062406-75062428 AGGAAGAATGGCCTCACCAAGGG - Intergenic
1070895132 10:79976869-79976891 ATGAGGGCTGGTCTTTCCCATGG + Intronic
1072524947 10:96263372-96263394 AGGAAGGCTCTCATTACCCCAGG - Intronic
1072617098 10:97057155-97057177 AGGAAAGCTGGCCCTTCCCTGGG + Intronic
1073099318 10:100998600-100998622 AGAAAGGCTGCCTTTGCCCAGGG + Intronic
1073481289 10:103787622-103787644 AGGCAGGCTGGCCTCCGCCAGGG + Intronic
1073982745 10:109173451-109173473 AGACAGGCAGGCTTTACCCACGG + Intergenic
1075172483 10:120128273-120128295 TAGAAGGCTGGCGTGACCCAGGG - Intergenic
1076776084 10:132699133-132699155 AGGGAGGCTGTCATGACCCAGGG - Intronic
1076904876 10:133356764-133356786 AGGAAGGCTGGCAGTGCCCAGGG - Intronic
1077151412 11:1074672-1074694 AAGAAGGCTGCGTTTACCCAGGG + Intergenic
1077431033 11:2516064-2516086 AGGCAGCCTGGCCTTCCACAGGG - Intronic
1079007712 11:16803796-16803818 AGGAAGGCTGGCCTTACCCACGG - Intronic
1079800175 11:24859670-24859692 TAGAAGGCTGGCATGACCCACGG + Intronic
1080164982 11:29225247-29225269 TAGAAGGCTGGCATGACCCACGG - Intergenic
1080579771 11:33632669-33632691 AGGGAGGCTCGCCTGAGCCAAGG - Intronic
1080592444 11:33736003-33736025 CGGAGGGCTGGCCTTTCCCCCGG + Intronic
1080789654 11:35510907-35510929 AGGATGGCTGCCCATAACCATGG - Intronic
1081906277 11:46672440-46672462 AGGGAGGCTGGCTTCTCCCATGG + Exonic
1083623953 11:64062442-64062464 CGGAAGGCTCGCCTCACACAGGG + Intronic
1083629311 11:64087602-64087624 TGCAAGGCTGGCCTTGCCCGCGG + Intronic
1084621418 11:70272346-70272368 AGAAACGCTGGCCTTAACCCAGG + Exonic
1084858401 11:72003197-72003219 AGGAAGACTGGCCAGGCCCAAGG + Exonic
1085066197 11:73498238-73498260 TAGAAGGCTGGCGTGACCCATGG + Intronic
1085252810 11:75154735-75154757 AGGAAGCCTGCCCTGACCCCAGG + Intronic
1085710982 11:78829098-78829120 AGGAAGGCTGGCCAGACAGAGGG - Intronic
1086513744 11:87588853-87588875 TAGAAGGCTGGCATGACCCATGG + Intergenic
1086771822 11:90775927-90775949 TAGAAGGCTGGCATAACCCACGG - Intergenic
1088878025 11:113951968-113951990 AGGAAGCCCGGCCTTCCCGAAGG - Intergenic
1089015136 11:115159431-115159453 AGTGAGGCTGGCCTTCCCCTGGG + Intergenic
1089384243 11:118057594-118057616 TGGATGGCTGGCCTGCCCCAGGG + Intergenic
1090037006 11:123257910-123257932 AGGAAGGCTGGGCTTGCCTGAGG + Intergenic
1090200189 11:124848546-124848568 AGTGAGGCTGGACTTTCCCAGGG + Intergenic
1090428329 11:126625888-126625910 AGGAAGGCTGTCATTATACAGGG - Intronic
1090669664 11:128937451-128937473 AGGAGGGCTGGCCTTCCTCTTGG + Intronic
1090756670 11:129797919-129797941 AGAGAGGCTGGCCTGACCAATGG + Intergenic
1090840389 11:130482519-130482541 AAGAAGGCTGGCTTTTGCCAAGG + Intergenic
1091413156 12:257548-257570 TGGAAGGCAGGCTCTACCCAGGG + Intronic
1091934368 12:4423532-4423554 GGGAAGGCTGCCCTCACACAGGG - Intergenic
1092443285 12:8528000-8528022 TGGAAGGCTGGTGTGACCCACGG - Intergenic
1093735184 12:22613063-22613085 AGGAAGGCATTCCTTTCCCAGGG + Intergenic
1094120612 12:26970113-26970135 GGGAACTCTGGACTTACCCAGGG - Intergenic
1094178395 12:27565252-27565274 CAGGAGGCTGGCCTTGCCCAAGG + Intronic
1095320484 12:40819972-40819994 TAGAAGGCTGGCATGACCCACGG - Intronic
1096200071 12:49675159-49675181 AGAAAGGGTGGCCTTAATCAGGG - Intronic
1096970689 12:55664012-55664034 GGGAAGGATGGCCTTAGCTATGG + Intergenic
1099530834 12:83778727-83778749 ATGAAGACTGGCATTTCCCAAGG + Intergenic
1101092708 12:101304060-101304082 AGGCAAGCTGGCCTTCCCCAAGG - Intronic
1103479465 12:121241685-121241707 AGGGAGACTGTCCTTACACAAGG + Intronic
1103626711 12:122225770-122225792 AGGAAGCCGGGCTTGACCCAGGG + Intronic
1104055437 12:125226672-125226694 AGGAAGAGTGGACTTTCCCAAGG - Intronic
1104126298 12:125849275-125849297 GGTAAGGATGGCCTTAGCCAAGG - Intergenic
1104377028 12:128273039-128273061 AGGAAGCTGTGCCTTACCCAAGG + Intronic
1104490501 12:129189592-129189614 AGGAAGGCTGGGAGTCCCCACGG + Intronic
1105882011 13:24613834-24613856 AGGAAGACAGACCTAACCCACGG + Intergenic
1110521803 13:76488239-76488261 AGGAAGGCTGGACTAAGCTATGG - Intergenic
1112408389 13:99140954-99140976 AGGAATGCAGTCCTTCCCCAGGG - Intergenic
1113241863 13:108347026-108347048 AGGAAGGCTGGCCTCACGTGAGG - Intergenic
1113541378 13:111112463-111112485 AGGAAGGCTGACTTTACCCATGG - Intergenic
1114705857 14:24726373-24726395 TAGAAGGCTGGCGTGACCCACGG + Intergenic
1116984425 14:51204078-51204100 AGGCAGGATTGCCTTTCCCATGG - Intergenic
1118323184 14:64765177-64765199 AGGAAGACTGGCATTCCACATGG - Intronic
1119770962 14:77220544-77220566 TGGAGGGCTGGCCTTCACCAGGG - Intronic
1119771774 14:77224625-77224647 GGGAAAGGTGGCCTTAGCCATGG - Intronic
1125723975 15:41858819-41858841 AGGAAGGGTGGCCTTTCCCTGGG + Intronic
1126553088 15:49953986-49954008 TAGAAGGCTGGCATGACCCACGG - Intronic
1128756741 15:70188365-70188387 AGGATGGCTGGGCCTCCCCAGGG + Intergenic
1128939941 15:71779748-71779770 TGGCAGGCTGGCCATTCCCATGG - Exonic
1129183237 15:73890076-73890098 AGGAGGGCTGACATTACACATGG + Intergenic
1129234680 15:74217101-74217123 AGGAAGCTGGGCCTGACCCAGGG - Intergenic
1131446752 15:92504523-92504545 AGGAAGGAAGGCCTAATCCAGGG + Intergenic
1132782065 16:1632754-1632776 GGGAAGGCTGGCCGTCCCCCAGG - Intronic
1132785593 16:1655599-1655621 AAGAAGGCTGGGCTGACCCTTGG - Intronic
1136073316 16:27802032-27802054 AGGAAGGGGGGACTTAGCCAGGG - Intronic
1136298093 16:29314947-29314969 AGGAAGGCTGGCCTGTCCACCGG + Intergenic
1136461006 16:30410070-30410092 AAGAAGGATGACCTTGCCCAAGG - Intronic
1138349196 16:56337526-56337548 AGGAAGGCTGCACTCTCCCAGGG - Intronic
1138605934 16:58088626-58088648 AGGAGCCCTGGCCTTACCCGAGG - Intergenic
1140745134 16:77974438-77974460 AGGAAGGCCTGTCTTACCAAGGG + Intronic
1142059739 16:88021452-88021474 AGGAAGGCTGGCCTGTCCACAGG + Intronic
1142060876 16:88028312-88028334 AGGAGAGCTGGCCCTGCCCACGG - Intronic
1143088213 17:4432897-4432919 AGGAAGGATCGCCTTAGCCTGGG - Intergenic
1143777560 17:9209489-9209511 AGGAAGGCAGGCCTTGGCCCTGG + Intronic
1146764298 17:35505322-35505344 AGGTAGGCAGGCCTCAGCCAGGG - Intronic
1147054512 17:37824187-37824209 AAGAAGGCTTGACTCACCCAAGG - Intergenic
1147255418 17:39178280-39178302 AGGAAGGCTGGCATAACACCAGG - Intronic
1148991035 17:51667586-51667608 AGGAAGGATGTTCTAACCCAAGG - Intronic
1149229800 17:54519516-54519538 TAGAAGGCTGGCATGACCCACGG - Intergenic
1150376004 17:64682141-64682163 GGTAAGGCTGGACTTCCCCAGGG + Intergenic
1150448574 17:65246554-65246576 AGGAAAGCTGGCCTTAGGGAGGG + Intergenic
1152134053 17:78493808-78493830 AGGGAGGGAGGCCTCACCCAGGG + Intronic
1152303327 17:79507851-79507873 AGGAAGGCTCAGCTTCCCCAGGG - Intronic
1153405269 18:4731578-4731600 AGGAAGGTTGGCTGTACCTAAGG + Intergenic
1155278531 18:24214087-24214109 AGGAAGGCAGACCTTAACCTAGG + Intronic
1155319647 18:24606753-24606775 AAGAAGGCTGGCCTTCCTAACGG + Intergenic
1157501135 18:48191497-48191519 AGCAAGGCTGGCTTTTCCCTGGG + Intronic
1158601533 18:58860061-58860083 TGGAAAGCTGGCCTTGTCCAAGG - Intergenic
1160225776 18:77009682-77009704 AGGGAGGCAGGCCTCCCCCAGGG - Intronic
1160901849 19:1432734-1432756 AAGAAGGCAGGCCGTGCCCAGGG - Intronic
1161173804 19:2827738-2827760 AGTGATGCTTGCCTTACCCAGGG - Exonic
1164025595 19:21348817-21348839 AGGAAGGCATTCCTTCCCCAGGG + Intergenic
1164735440 19:30537480-30537502 TGCAAGGCTGACGTTACCCATGG - Intronic
1165868572 19:38954190-38954212 AGGAAGGCTGGATTTAACCAGGG + Intronic
1168132952 19:54332467-54332489 AGGGAGGGTGGCCTCCCCCAGGG - Intergenic
926159467 2:10477483-10477505 AGGAAGGCTTCCCTTTCCCCAGG - Intergenic
927100606 2:19785006-19785028 AGGATGGCTGTGATTACCCATGG + Intergenic
928413292 2:31070824-31070846 AGAGAGGCTGGCCCTACCCAGGG + Intronic
928422916 2:31153573-31153595 TGGCAGCCTGGCCTTACCTAAGG - Intronic
928845146 2:35662713-35662735 AGGGAGGCAGGCCTTTCACAAGG + Intergenic
929428984 2:41870967-41870989 AGGAAGGCTGCACTGTCCCAGGG + Intergenic
929598798 2:43192259-43192281 AGGAAGCCAGTCCTGACCCATGG - Intergenic
929819784 2:45263806-45263828 GGGAATCCTGGGCTTACCCATGG + Intergenic
930362516 2:50399614-50399636 AGTTAGGCTTGCCTAACCCAGGG + Intronic
931836294 2:66101386-66101408 AAGAAAGCTGGACTCACCCAAGG - Intergenic
933970362 2:87465049-87465071 AGGAAGGCAGGACTGGCCCAGGG - Intergenic
934571929 2:95377997-95378019 AGGAAGGCCTGTCTGACCCAGGG + Intronic
934658838 2:96132442-96132464 AGGATGGATAGCCTCACCCATGG + Intronic
934682097 2:96291518-96291540 AGGAAGGCTCGCCTCATCCCCGG - Intronic
936323421 2:111485447-111485469 AGGAAGGCAGGACTGGCCCAGGG + Intergenic
937931400 2:127208208-127208230 TAGAAGGCTGGCATAACCCACGG + Intronic
937969636 2:127539434-127539456 AGGAAAGCTGGTCTTCCCCTTGG - Intronic
938634324 2:133206806-133206828 AGGAATGCATTCCTTACCCAGGG - Intronic
938772710 2:134513938-134513960 AGGAAGCCTGGCTACACCCAGGG - Intronic
938942275 2:136179620-136179642 AGGAAGGCTGGCCAGACCCAGGG - Intergenic
939796314 2:146648636-146648658 AGAAAGCCTTGCCTAACCCAAGG - Intergenic
946863352 2:224021087-224021109 ACGAAGGATGTCCTTATCCATGG - Intronic
947327677 2:228995463-228995485 AGTAAGGCTGGCCTCTCTCATGG + Intronic
948386884 2:237586047-237586069 AGCCAAGCTGGACTTACCCACGG + Exonic
1170360779 20:15543847-15543869 AGGCAGGCTGGCTTGTCCCAGGG - Intronic
1171396639 20:24838720-24838742 AAGAAGGCTGGCCCTGCACAAGG + Intergenic
1171485612 20:25483447-25483469 AGGAATCCTATCCTTACCCAGGG - Intronic
1172182042 20:33009574-33009596 CGGAAGGCTGTGTTTACCCAGGG - Intronic
1172999811 20:39097629-39097651 AGGAGGGCTGGCCTTTCTGAAGG + Intergenic
1173526362 20:43735901-43735923 AGGAGGGCTGGCCCATCCCATGG - Intergenic
1174371945 20:50096337-50096359 AGGAATGCTGGCTATACCTAGGG + Intronic
1175208881 20:57335514-57335536 ATGAAGGCTTGGCTTACCAAAGG - Intronic
1175397559 20:58677141-58677163 AGGATGGCTGGGGATACCCATGG - Exonic
1175546142 20:59779011-59779033 AGGAAAGGGGGCCTCACCCAGGG - Intronic
1175608988 20:60334492-60334514 CGGAAGGTTGGCCTTTCCCTGGG + Intergenic
1179574848 21:42301616-42301638 AGAAAGGCTGGGGTTACCGAGGG - Intergenic
1179769839 21:43606325-43606347 AGGATGGCTGGGCTGATCCAAGG + Intronic
1181013347 22:20054807-20054829 CGGAGGGCAGGCCTCACCCAGGG - Intronic
1182939034 22:34255739-34255761 TAGAAGGCTGGCATGACCCATGG - Intergenic
1183380601 22:37488834-37488856 AGGGAGGCTGCCCTTCCCCCAGG + Intergenic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184274497 22:43402477-43402499 TGGAAGAATGGACTTACCCAAGG - Intergenic
1184300922 22:43560522-43560544 AGCATGGCTGCCCCTACCCAAGG - Intronic
949942410 3:9165052-9165074 AGGCAGGCTGGGCTTAGCTAGGG + Intronic
951030824 3:17880002-17880024 AGGTAGGCTTGCTTTTCCCATGG + Intronic
951523306 3:23629545-23629567 TGGGAGGCTAGGCTTACCCAGGG - Intergenic
951846329 3:27088595-27088617 AGGAAGGCTGGTTTGACCCTGGG + Intergenic
952416494 3:33095559-33095581 AGGGAGGCTGGCATCACCCCAGG - Intronic
954430504 3:50468320-50468342 AGGGAGGCTGGCCTTACAGCAGG - Intronic
960565236 3:119125749-119125771 TAGAAGGCTGGCATGACCCACGG + Intronic
960946382 3:122969623-122969645 AGGAAGGCTGGAGTGACCTAGGG - Intronic
960997939 3:123351854-123351876 GGGAAGGCAGGCCATTCCCAGGG - Intronic
965213108 3:165821640-165821662 AGGAAGGGTGGCCATACAGATGG - Intronic
966250616 3:177860734-177860756 TAGAAGGCTGGCTTGACCCATGG - Intergenic
966879680 3:184343008-184343030 AGGAAGGCTGTCCACACTCATGG + Intronic
967097285 3:186187427-186187449 GGGAAGGCTGGAGTTACCAATGG + Intronic
968629378 4:1642286-1642308 ATGAGGGCGGGCCTTGCCCAGGG - Intronic
969570102 4:8003229-8003251 AGGCAGGCTGGGCTAAGCCATGG - Intronic
969690827 4:8703215-8703237 AGGGGGGCTGGCATTACTCATGG + Intergenic
970154756 4:13130748-13130770 TAGAAGGCTGGCGTGACCCAGGG + Intergenic
973304557 4:48630851-48630873 AAGGAGGCTGGCCTTGCTCATGG - Intronic
974015234 4:56643253-56643275 AGGAAGGCTGGGGTAGCCCAGGG + Intergenic
974741708 4:66014797-66014819 TAGAAGGCTGGCTTGACCCATGG - Intergenic
976636783 4:87294119-87294141 AGGAAGGCATTCCTTTCCCAGGG + Intergenic
979978447 4:127225093-127225115 TAGAAGGCTGGCATGACCCACGG - Intergenic
981725453 4:147842690-147842712 AGGAAGTCTTCTCTTACCCAGGG + Intronic
982226886 4:153174528-153174550 AGACAGGCTGCCCTTTCCCAGGG + Intronic
983266415 4:165512719-165512741 AGGAAGGCTGTTCTTCCCAAAGG - Intergenic
984163540 4:176282492-176282514 TAGAAGGCTGGCATGACCCACGG + Intergenic
986724244 5:10582342-10582364 AGGAAGGCTGGGCTGACTCTAGG - Intronic
986950168 5:13073172-13073194 AGGAATGCTTTCCTTCCCCAGGG + Intergenic
987834803 5:23146724-23146746 TGGAAGGCTGGCGTGACCCGCGG - Intergenic
988729606 5:33958369-33958391 AGGAAGTCTGCACTTCCCCAGGG - Intronic
991003737 5:61807865-61807887 AGAAAAGGTGGCCTTCCCCATGG + Intergenic
992638336 5:78747068-78747090 AGGTGGGCTGGCCATAGCCATGG + Intronic
993750316 5:91657922-91657944 AGGAAGGCATTCCTTCCCCAAGG - Intergenic
994386950 5:99143769-99143791 AGGAAGGCATTCCTTTCCCAGGG + Intergenic
995006306 5:107200097-107200119 TGGAAGGCTGGCATCACCAATGG + Intergenic
997371289 5:133362647-133362669 GGGAAGGCAGCCCTTGCCCATGG + Intronic
997471941 5:134122184-134122206 AGGAAGCCTGGCTCTAACCAGGG - Intronic
1000149996 5:158490836-158490858 AGGAAGGCCAGCCTTTGCCATGG + Intergenic
1000172260 5:158713512-158713534 AGGAAGTCTGAGGTTACCCAGGG + Intronic
1001543764 5:172557436-172557458 AGGAAGGCTGGCCTCAGCTTGGG - Intergenic
1002025110 5:176391517-176391539 TGGAAGGATTGCCTGACCCAAGG + Intronic
1002102795 5:176865625-176865647 AAAAAGGCTTTCCTTACCCACGG + Intronic
1003544101 6:7043970-7043992 AGGCAGGCAGGCCAGACCCAGGG + Intergenic
1007300070 6:40861306-40861328 AGGTAGGTTGGGCTTACTCATGG - Intergenic
1008434956 6:51465206-51465228 AGAAAGGCTGGCATTTCCAAGGG + Intergenic
1008468360 6:51855221-51855243 TAGAAGGCTGGCGTGACCCACGG - Intronic
1008773761 6:55009682-55009704 TAGAAGGCTGGCGTGACCCACGG - Intergenic
1014369380 6:120584904-120584926 TAGAAGGCTGGCGTGACCCACGG - Intergenic
1014732230 6:125046164-125046186 AAGAAGCCTGGCCTTAGCCTCGG - Intronic
1014863101 6:126495802-126495824 ATGGAGGCTGGTCTTTCCCATGG - Intergenic
1015507115 6:134000105-134000127 AGGAAGGCTGGCTATATCCTTGG - Intronic
1018060672 6:160087329-160087351 ATGAAGGCTGCCATTACCCGGGG + Intronic
1019311039 7:360781-360803 AAAAAGCCTGGCCCTACCCAGGG - Intergenic
1019371416 7:663920-663942 AGGAGGGCTGATCTTTCCCACGG + Intronic
1023529777 7:41140372-41140394 ATCAAGGCTGGCCTCACCCCTGG + Intergenic
1024284286 7:47744042-47744064 CTGCCGGCTGGCCTTACCCAGGG + Intronic
1025728176 7:64087224-64087246 ACCTAGGCTGGCCTCACCCAGGG - Intronic
1026223246 7:68418631-68418653 AGGAAGGCTGGCATTTCCCTGGG - Intergenic
1026550804 7:71366817-71366839 ATGAAGACTGGTCTTACCTAGGG - Intronic
1027188094 7:75983686-75983708 CGGAAGGCTGGCCCTGCCCCAGG - Intronic
1029152803 7:98492817-98492839 AGGAAGGCTGATTTTAGCCAGGG - Intergenic
1033411321 7:141120204-141120226 AGGAAGGTTGAACTTGCCCAAGG - Intronic
1033732761 7:144195433-144195455 AGGAAGCCAGGCCTTTCCCAGGG - Intronic
1033743612 7:144294013-144294035 AGGAAGCCAGGCCTTTCCCAGGG - Intergenic
1033750290 7:144355584-144355606 AGGAAGCCAGGCCTTTCCCAGGG + Intronic
1034271725 7:149806338-149806360 AGGCAGACTGGCCTTCCTCAGGG + Intergenic
1035460611 7:159036391-159036413 CGGAAGCCTTGCCTTGCCCAGGG - Intronic
1038052556 8:23827439-23827461 AGGAGGGGTGGCCTGGCCCAGGG + Intergenic
1039686037 8:39802288-39802310 TAGAAGGCTGGCATGACCCACGG - Intronic
1040408724 8:47134060-47134082 AGGAAGGGTGGCCCAGCCCACGG - Intergenic
1040866854 8:52056261-52056283 AGCAAGGCTGGGCTCACACACGG - Intergenic
1042991746 8:74648203-74648225 AGGAATGCATTCCTTACCCAGGG - Intronic
1043491765 8:80756014-80756036 AGGAAGGATGGCTTTAGCCTGGG + Intronic
1043653622 8:82632870-82632892 AGGAAGACTGTGCTTTCCCATGG + Intergenic
1045680875 8:104658453-104658475 AGAAAGGCTGACCTTCTCCAAGG - Intronic
1046627034 8:116585947-116585969 GGGAAGGTTGGCCTGCCCCATGG - Intergenic
1047428442 8:124767828-124767850 AGGAAGGCTGGCGAAACCCTGGG + Intergenic
1049838212 8:144754026-144754048 AGCAAGGCAGGCTTTTCCCATGG + Intronic
1056711167 9:88992719-88992741 AGGATAGCTGGCCATGCCCAGGG + Exonic
1057170655 9:92961131-92961153 AGGAAAGCTGGCCATGGCCAGGG - Intronic
1058374204 9:104304750-104304772 TGGAAGACTGGCGTTACCCATGG + Intergenic
1058525520 9:105853922-105853944 ACTAAGACTGGCATTACCCAGGG - Intergenic
1058636645 9:107044572-107044594 AGGAAGGCTGGACTTCCCCGGGG - Intergenic
1059341246 9:113598705-113598727 AACAGGGCTGGCCTTGCCCAGGG - Intergenic
1059437762 9:114286844-114286866 AGGAAGGAAGGTCTTAGCCAAGG - Intronic
1061754549 9:132803591-132803613 AGGAAAGCTCGCCTTACAGATGG + Intronic
1062625142 9:137439063-137439085 AGGATGGCTGGCCTCACCCTGGG - Intronic
1187241107 X:17514101-17514123 ATGAAGGCAGGTCTTTCCCATGG - Intronic
1190164420 X:48060802-48060824 AGGGAATCTGCCCTTACCCACGG + Exonic
1194642346 X:96417502-96417524 AGGTAGGCAGGCCATACCAAGGG - Intergenic
1195218081 X:102720546-102720568 AGGAAGGCTGGCCTTTGCTCTGG - Intergenic
1195320414 X:103717282-103717304 AGGCAGGCTGGACTTAGGCAAGG - Intronic
1196392492 X:115223268-115223290 AGGAAGCATTGCCTAACCCAGGG - Intronic