ID: 1079007841

View in Genome Browser
Species Human (GRCh38)
Location 11:16804593-16804615
Sequence CTGTGTGACCAAAGGGATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079007841_1079007846 6 Left 1079007841 11:16804593-16804615 CCACGATCCCTTTGGTCACACAG 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1079007846 11:16804622-16804644 ACGGAACCATTGTTTTATCTTGG 0: 1
1: 0
2: 0
3: 4
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079007841 Original CRISPR CTGTGTGACCAAAGGGATCG TGG (reversed) Intronic
903827595 1:26156843-26156865 CTTTAAGACCAAAGGGATGGGGG + Intergenic
903885799 1:26540365-26540387 CTGTGTGACCAAGGGGCTTAAGG - Intronic
906692500 1:47801822-47801844 CTGTGTGGGCAAAGGGCTGGAGG - Intronic
906794836 1:48688597-48688619 CAGTGTAAGCAAAGGGAACGAGG - Intronic
907443267 1:54491162-54491184 CTGTGTGAGCCCAGGGAGCGTGG - Intergenic
909259908 1:73474367-73474389 CTGTGTTCCCAATGGGATCCTGG + Intergenic
914850350 1:151309559-151309581 CTGTGGGACCAAAGGGTCAGGGG + Intronic
915873566 1:159587963-159587985 CTGTGTGAGCAAAGGCTTCCAGG - Exonic
917758863 1:178133332-178133354 CAGTGTCACCAAAGTGATCATGG - Intronic
918638882 1:186814101-186814123 TTGTGTTTCCAAAGGTATCGCGG - Intergenic
920074246 1:203325316-203325338 CTGTGTGACCAAAGGAGGCGGGG - Intergenic
920451899 1:206065680-206065702 CTGTGGGACAACAGGGATCAGGG + Intronic
922994028 1:229941717-229941739 TTGTGTGACAAAAGGGGTAGGGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1068183962 10:53561506-53561528 CTATATGCCCAAAGGGATTGGGG + Intergenic
1068689111 10:59897952-59897974 GTGTGTGTCCAAAGTGATCTGGG - Intronic
1070545238 10:77446872-77446894 CAGTGTGAACAAAGGTATGGAGG - Intronic
1070962125 10:80506687-80506709 CTGTCTGGCCACAGGTATCGTGG - Intronic
1072197859 10:93132019-93132041 CTGTTTGACCTAAGGGATCCAGG - Intergenic
1075985321 10:126780049-126780071 CTGTGTGAGCAAAGGCCTAGAGG - Intergenic
1075998753 10:126898492-126898514 CTATGTGACCAGAGAGATAGAGG - Intergenic
1077349491 11:2085864-2085886 CTGGGTGACAGAAGGGCTCGAGG + Intergenic
1078146953 11:8728597-8728619 CTAGGTGACCAAAGGGAGTGGGG - Intronic
1079007841 11:16804593-16804615 CTGTGTGACCAAAGGGATCGTGG - Intronic
1079348404 11:19672606-19672628 CTGCTTGACCCAAGGGATGGAGG + Intronic
1082254275 11:50015167-50015189 ATCTGTGACCAAAGGGTTGGGGG - Intergenic
1099276522 12:80583186-80583208 ATGTGTGAGCAAATGAATCGAGG - Intronic
1101733641 12:107446572-107446594 CTATGTGACCAAAAGGAGCTCGG + Intronic
1102419364 12:112791731-112791753 CTGTGTGAGCAAGGGAAGCGGGG - Exonic
1103581897 12:121921622-121921644 CTGTGTCTCCAAACGGATCATGG - Exonic
1104352033 12:128053190-128053212 CTGTCAGTCCAAAGGGACCGGGG - Intergenic
1104720823 12:131044284-131044306 CTGTGTGCACAAAAGCATCGGGG + Intronic
1105707749 13:22978892-22978914 CTGTGTGACTGAAGGTATCCAGG + Intergenic
1106542880 13:30705624-30705646 CTGTGTGAGCGAAGGTGTCGTGG + Intergenic
1117354024 14:54906272-54906294 CTCTGTGACCAAATGGGTGGGGG - Intergenic
1121690392 14:95874163-95874185 CTGTGTGGCCACAGGGATCATGG + Intergenic
1128624464 15:69185694-69185716 TTCTGTGACCAAAGGTATGGGGG + Intronic
1129713873 15:77835941-77835963 CTGTGTGAGCAAAGGCTTGGAGG - Intergenic
1130809850 15:87365384-87365406 CTGTGGTACAAAAGGGATTGGGG + Intergenic
1135132541 16:19864689-19864711 CTGTGAGACCCAAGGGCTCAAGG + Intronic
1140292141 16:73669479-73669501 CTGTGTGACCAAAAGACTCAGGG + Intergenic
1142050617 16:87955736-87955758 CTGTGTGAAGCAAGTGATCGGGG + Intronic
1142628282 17:1206304-1206326 CTGTGTGATCTAAGGGGTCAAGG - Intronic
1145103671 17:20097238-20097260 CTTAGAGACCAAAGGGATGGGGG - Intronic
1146401310 17:32502050-32502072 TTCTGTGACCAAAGGTATGGAGG - Intronic
1146785399 17:35716083-35716105 CTCTCTGAACAAAGGGATCCTGG - Intronic
1150465408 17:65388490-65388512 CTGTGTGAACAGAAGGATAGTGG - Intergenic
1155054912 18:22173989-22174011 CTGTGTGTGGAATGGGATCGGGG + Intronic
1155620429 18:27772094-27772116 CTGTGGCCCCAAAGGGATGGTGG + Intergenic
1158784830 18:60697921-60697943 CTGTGGGAGCAAGGGGATGGAGG + Intergenic
1160891500 19:1381005-1381027 CTGTGTGACCAACAGAATGGCGG - Intergenic
1166360257 19:42250164-42250186 CTGTGTTACCAAGGGGCTCAGGG + Intronic
925975883 2:9141834-9141856 CTGTGTGTACAAAGGCATAGTGG - Intergenic
928550056 2:32361433-32361455 CTGTGTGAGCACAGAGATAGAGG - Intronic
933175579 2:79169293-79169315 TTGTGTCTCCAAAGGGATCTAGG - Intergenic
936666894 2:114607376-114607398 CTATGTGACAAAAGGGACCTTGG + Intronic
937252230 2:120532243-120532265 CTGAGTGACCCAAGGGAGAGGGG - Intergenic
938342905 2:130547301-130547323 CTGTGTGCCCAAAGGGAGTCAGG - Intronic
938346928 2:130573421-130573443 CTGTGTGCCCAAAGGGAGTCAGG + Intronic
1173417345 20:42868817-42868839 CTGTATGAAAAAAGGGATCTTGG + Intronic
1174306601 20:49617837-49617859 CTGTGTCACCAAATGGCTCTTGG + Intergenic
1175817915 20:61893223-61893245 ATGGGTGACCACAGGGATGGTGG + Intronic
1176326886 21:5509110-5509132 CTGTGTTAGCAAAGGGCTCTGGG - Intergenic
1176400871 21:6311841-6311863 CTGTGTTAGCAAAGGGCTCTGGG + Intergenic
1176436286 21:6677263-6677285 CTGTGTTAGCAAAGGGCTCTGGG - Intergenic
1176460548 21:7004333-7004355 CTGTGTTAGCAAAGGGCTCTGGG - Intergenic
1176484109 21:7386111-7386133 CTGTGTTAGCAAAGGGCTCTGGG - Intergenic
1177229263 21:18298476-18298498 CTGTGTGATCAAAGACATTGAGG + Intronic
1178784493 21:35640419-35640441 CTGTGAGACCCAAGGGATTCAGG - Intronic
1180862111 22:19089491-19089513 CTGTGGGACCAAAGGGTGAGAGG + Intronic
1184329163 22:43815200-43815222 CTTTGTGACCATAGCGATCCTGG - Intergenic
1184549989 22:45199395-45199417 CTGTGTCACCAAAGAGCACGTGG + Intronic
950788138 3:15452549-15452571 CTGTGTAACCACAGTGAGCGTGG + Intronic
955009448 3:54999986-55000008 CTGTGTGCCCACATGGATGGTGG - Intronic
955559656 3:60174978-60175000 CTGTGTGAACGAAAGGATAGGGG + Intronic
962695701 3:137945230-137945252 ATGTGTGACCAACAGGATGGAGG + Intergenic
965082600 3:164053946-164053968 CTGTGTGCCCAAAGGGGGCATGG - Intergenic
965907159 3:173723087-173723109 CTGTGTGACACAAGGGTTCATGG + Intronic
969385195 4:6840335-6840357 CTTTGTGGCCAAAGGGATGATGG + Intronic
973819871 4:54653388-54653410 CTGTGTGACCAAAAGTATTGTGG - Intergenic
977879385 4:102186836-102186858 CTGTGAGTACAAAGGGATGGTGG + Intergenic
978525154 4:109657694-109657716 CTGTGTGAACAAAGATATTGTGG - Intronic
981090811 4:140730286-140730308 CTCTGAGACCAAAGGGAACCTGG + Intronic
993017338 5:82549853-82549875 TTGTGGGACCATAGGGATGGTGG + Intergenic
994763371 5:103884694-103884716 CTATGTGACCAGAGGCATCTCGG + Intergenic
997353822 5:133249517-133249539 CAGTGTGACCACAGTGACCGTGG - Exonic
998329252 5:141309380-141309402 TTCTGTGACCAAATGGGTCGGGG + Intergenic
998373770 5:141678349-141678371 GTGTGTGCCCAAAGGGATCCAGG - Intronic
999148550 5:149411896-149411918 CTGTGTGCCCAGAGGGATAATGG - Intergenic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1007590410 6:43017423-43017445 CTCTGGGACCAAGGGGATTGGGG + Intronic
1009697987 6:67134432-67134454 CTGTGTGCCCAAATGGAGTGTGG + Intergenic
1012989434 6:105910195-105910217 CTTTGTGACCTGAGGGATAGAGG - Intergenic
1017083677 6:150693543-150693565 CAGTGTGACCAAAGAGAGGGTGG - Intronic
1018907847 6:168085602-168085624 CTGTGAGAACAAAGGGACCAAGG + Intergenic
1021720473 7:23499833-23499855 CAGTGTGACAGAAGGGATCTAGG - Intergenic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1026827589 7:73594044-73594066 ATGTGGAACCAAAGGGATAGGGG + Intronic
1029273255 7:99389673-99389695 CTGTGTGGCCTAAAGGATAGAGG + Intronic
1033047588 7:137976794-137976816 ATGTGCAACCAAAGGGATAGGGG + Intronic
1035393019 7:158517810-158517832 ATGTGTGACGAAGGGGATGGAGG - Intronic
1035828102 8:2665927-2665949 GTTTGTGACTAAAGGGATCGTGG - Intergenic
1039304485 8:36246812-36246834 CCGTGTGAGCAAAGGCACCGAGG - Intergenic
1041256666 8:55984679-55984701 CTGTGTGACCACTGGGCTGGGGG - Intronic
1042449119 8:68923669-68923691 CTGTGTTACCAAAGTGAACTGGG - Intergenic
1045064892 8:98436093-98436115 CTGTGTGGCCAAAGAATTCGGGG - Intronic
1045406341 8:101870391-101870413 TTATGTGAACAAAGGGATCTTGG - Intronic
1048191464 8:132293446-132293468 ATCTGTGACCAAAGGTATGGGGG - Intronic
1052963463 9:34319981-34320003 CTGTGAGACCAAATGGAGCTAGG + Intronic
1052984635 9:34477711-34477733 CTGGGTGACTAAATGGATAGTGG + Intronic
1054840417 9:69732285-69732307 CTTTGTGACCAAAGGAAACTTGG - Exonic
1057711767 9:97451880-97451902 TTGTGTGACCAAATGGGTGGGGG - Intronic
1060637339 9:125209735-125209757 CTGTGTGTGCAAAGGCATGGAGG - Intronic
1060781932 9:126419319-126419341 GTGTGTGACTAAAAGGATCCAGG - Intronic
1062271595 9:135712394-135712416 CTGTGTGACCCAAGGGGCCCTGG - Intronic
1203435229 Un_GL000195v1:131398-131420 CTGTGTTAGCAAAGGGCTCTGGG + Intergenic
1187953861 X:24496701-24496723 CACTGTGACCAAGGGGATGGTGG - Intronic
1190107332 X:47569810-47569832 CTGTGTGGCCAGTGGGATCTGGG + Intronic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1200209061 X:154337817-154337839 CTGTGTGACAAATGGTATGGAGG + Intergenic
1200221814 X:154394312-154394334 CTGTGTGACAAATGGTATGGAGG - Intronic