ID: 1079008589

View in Genome Browser
Species Human (GRCh38)
Location 11:16810273-16810295
Sequence TTCAAGATCCAGATGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 364}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079008589_1079008597 26 Left 1079008589 11:16810273-16810295 CCTTCCTTCATCTGGATCTTGAA 0: 1
1: 0
2: 1
3: 18
4: 364
Right 1079008597 11:16810322-16810344 ACCCAAGCTGAGTCTGAGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 170
1079008589_1079008593 -5 Left 1079008589 11:16810273-16810295 CCTTCCTTCATCTGGATCTTGAA 0: 1
1: 0
2: 1
3: 18
4: 364
Right 1079008593 11:16810291-16810313 TTGAAGTGGGACTCTCATCTTGG 0: 1
1: 0
2: 0
3: 7
4: 133
1079008589_1079008596 25 Left 1079008589 11:16810273-16810295 CCTTCCTTCATCTGGATCTTGAA 0: 1
1: 0
2: 1
3: 18
4: 364
Right 1079008596 11:16810321-16810343 AACCCAAGCTGAGTCTGAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079008589 Original CRISPR TTCAAGATCCAGATGAAGGA AGG (reversed) Intronic
900639848 1:3683457-3683479 AGCTAGATCCAGATGTAGGAAGG + Intronic
903268971 1:22176085-22176107 TTCCACATCCAGAACAAGGAGGG - Intergenic
903687381 1:25141705-25141727 TTCAAGATGCTGATGAAAAAAGG - Intergenic
904838150 1:33352775-33352797 TGCACCATCCTGATGAAGGAAGG + Intronic
906183109 1:43838497-43838519 TGCAAGCTCCAGAGGCAGGATGG - Intronic
909197194 1:72642386-72642408 TTCAATATCCATATCATGGAAGG - Intergenic
909816924 1:80006263-80006285 GTCAAGATCCATATGAGGTATGG - Intergenic
909893562 1:81037403-81037425 TTCAAGATCAAGATGTTGGCAGG - Intergenic
910539316 1:88337144-88337166 TTCTACATCAAGATGAAGGAGGG + Intergenic
913262462 1:117011889-117011911 TTCAGGATCCAGATGAAACTTGG + Exonic
916975431 1:170072526-170072548 GGCAAGTTCCAGATAAAGGAAGG + Intronic
917542906 1:175932979-175933001 TTCTAGATCCAGACAAGGGAGGG - Intergenic
918201980 1:182276150-182276172 TCCAAGATCAAGATGTTGGAAGG - Intergenic
918344921 1:183598750-183598772 TTGAAGACCCAGATAGAGGATGG + Intergenic
918470862 1:184871513-184871535 TTCAAAATCCAGATGATGGCAGG - Intronic
918612084 1:186504388-186504410 GGCAAGGTCCAGATCAAGGAGGG + Intergenic
919799570 1:201345350-201345372 TTCAAGAGTCAGCTGCAGGAGGG - Intergenic
921648285 1:217646163-217646185 TTCAAGACAGAAATGAAGGATGG - Intronic
923718307 1:236445814-236445836 TTCATGTTCCAGAAGAACGAAGG + Intronic
923777527 1:236993184-236993206 TTCCAGCTCCAGAAGACGGAGGG - Intergenic
924389723 1:243540564-243540586 TACAAGATACAGAGGAAGGTGGG - Intronic
1063660430 10:8032006-8032028 TTCAACACCATGATGAAGGAAGG + Intergenic
1063673525 10:8119115-8119137 TTCATGAGGCAGAGGAAGGAAGG - Intergenic
1064333909 10:14420854-14420876 GTCAAGATCAAGATGAAGACAGG + Intronic
1065283928 10:24168875-24168897 TTGATGATCCAGATGAAAAATGG - Intronic
1065755951 10:28931274-28931296 TTCCAGATTAAGAAGAAGGAGGG - Intergenic
1067811355 10:49429444-49429466 GTCAGGATGCAGATGAAAGAGGG - Intergenic
1068714490 10:60173446-60173468 TTCAAGATACAAAGGAAAGATGG + Intronic
1068876100 10:61998523-61998545 CTCAAGCTTAAGATGAAGGAAGG + Intronic
1069786498 10:70991427-70991449 TTCAAGAACCAGTTGATGGTTGG - Intergenic
1071904825 10:90161299-90161321 CTCAAGATCAAGAGGAAGGCTGG - Intergenic
1072482049 10:95818479-95818501 TTCTATAGCCACATGAAGGAGGG + Intronic
1077247231 11:1545573-1545595 TCCAAGATCCAGGTGTAGGCAGG - Intergenic
1079008589 11:16810273-16810295 TTCAAGATCCAGATGAAGGAAGG - Intronic
1079451857 11:20604917-20604939 TTCAAGAAGCAGAAGAAGGCGGG - Intronic
1080198837 11:29644678-29644700 TTAGAGATTCAGATGAAAGACGG + Intergenic
1080790904 11:35521679-35521701 TTCAGGATGCACATGAAGCAGGG - Intronic
1083098454 11:60278197-60278219 TTCAAAATCCAGCTCAAGGCCGG + Intergenic
1083242792 11:61402044-61402066 TTAAAAAGCCAGGTGAAGGAGGG - Intergenic
1085230428 11:74963794-74963816 TTCTAAATCCAGATGAACGTTGG + Intronic
1085532570 11:77200738-77200760 TTGAAGAGCCAGAAGAAGGGAGG - Intronic
1087376166 11:97343281-97343303 CTCAAGCTCCATCTGAAGGATGG - Intergenic
1089583161 11:119494199-119494221 TTTAAGATTCATATTAAGGAAGG - Intergenic
1091162040 11:133432631-133432653 TTGAAGTTCCAGAAGAAGAAAGG - Intronic
1091408666 12:224675-224697 TGCAAGAACCAGATGGAGGTTGG - Intronic
1091645473 12:2269390-2269412 GTGAAGTTCCTGATGAAGGAAGG + Intronic
1092067198 12:5600802-5600824 TCCTACATCCAGATGAAGCATGG - Intronic
1092176626 12:6412832-6412854 TACAAGATCCACATGGGGGATGG - Intergenic
1093187038 12:16031954-16031976 TTTAAGATACATTTGAAGGAAGG + Intronic
1094386902 12:29904438-29904460 TTAAAAATCAAGATGAATGATGG - Intergenic
1096054250 12:48637741-48637763 TCCAAGATCAAGATGATGGCAGG - Intergenic
1096362743 12:51002238-51002260 TTCAAGAGACAGAGGTAGGAAGG + Intronic
1096656863 12:53097590-53097612 TTTAAGAGCCAGGTGAAGGGGGG - Exonic
1096721286 12:53524684-53524706 ATGAAGATCCAGATGAGCGACGG - Exonic
1097435044 12:59545355-59545377 TTCAATATCCAGGTGAAGAGAGG + Intergenic
1098947869 12:76608404-76608426 TTCAGGAGGCAGATGAGGGAGGG - Intergenic
1099322454 12:81167495-81167517 TTCAAGATCAAGGTGCTGGAAGG + Intronic
1099632751 12:85171847-85171869 TCCAAGATCCAGGTGCTGGAAGG - Intronic
1102206436 12:111094243-111094265 TCCAAGAGCCGCATGAAGGAGGG + Intronic
1103158858 12:118710680-118710702 GTCATTATCCACATGAAGGAGGG - Intergenic
1103576736 12:121883022-121883044 TTCAAGATCCAGCTCAAGGCTGG - Intergenic
1107428696 13:40319191-40319213 TCCAAGATCCAGATGACAGCAGG + Intergenic
1108183695 13:47867446-47867468 TTGAATATCCACTTGAAGGATGG + Intergenic
1108586471 13:51874454-51874476 TTAATGATACAGATGAATGAAGG + Intergenic
1108940394 13:55946644-55946666 TGCAGGAGACAGATGAAGGAAGG + Intergenic
1111962833 13:94830126-94830148 CTCCAGATCCAGGTGAAAGAAGG + Intergenic
1111975492 13:94962684-94962706 TTCATGTTACAGATGAGGGAGGG + Intergenic
1112093644 13:96108999-96109021 ATAAAGATCCAGATGATAGAGGG - Intronic
1112261733 13:97883845-97883867 TTCAACATTCAGATGAATGACGG + Intergenic
1113065422 13:106369087-106369109 TTCATGATCCAGTTGCAGCAAGG + Intergenic
1114085486 14:19234594-19234616 TTCAGGCTCCAGATGAATGTCGG + Intergenic
1114219474 14:20683821-20683843 TCCTCGATCCAGATGCAGGATGG - Intergenic
1115572729 14:34682037-34682059 TACAGGATCCAGAAGAAAGAAGG - Intergenic
1115900053 14:38135983-38136005 TTCAAAATGGAGATTAAGGATGG - Intergenic
1116685117 14:48029183-48029205 ATCAAGATCCCTTTGAAGGAAGG + Intergenic
1118492719 14:66277273-66277295 TTCTAGCTACAGATGAAGTATGG + Intergenic
1118889223 14:69894016-69894038 TTCAAGATCAAGATGCTGGCAGG - Intronic
1118918648 14:70129782-70129804 TTCAAGAGGCAGAGAAAGGAGGG + Intronic
1120715643 14:87838195-87838217 TTCAAGATCAAGATGTTGGCAGG - Intronic
1123000977 14:105293971-105293993 TTCAAGATGAAGCTGGAGGAAGG + Intronic
1127842671 15:62844503-62844525 TTCAAGATCCAGAAGAAAACAGG + Exonic
1127980613 15:64032299-64032321 TTCAAGGTCCAGATCAAACACGG - Intronic
1129336981 15:74858287-74858309 TTGAAGAACCAGGTCAAGGAAGG - Intronic
1130163451 15:81425994-81426016 TTCAAAACCCATATGAAGGCAGG - Intergenic
1130356464 15:83135472-83135494 TTCAAGATACACATGAATAAAGG - Exonic
1132274403 15:100554309-100554331 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274472 15:100554630-100554652 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274488 15:100554701-100554723 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274495 15:100554736-100554758 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274501 15:100554772-100554794 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274509 15:100554807-100554829 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274515 15:100554842-100554864 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274529 15:100554913-100554935 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274542 15:100554985-100555007 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274548 15:100555021-100555043 TTCCAGACGCAGATGAGGGATGG + Intergenic
1132274556 15:100555056-100555078 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274579 15:100555162-100555184 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274585 15:100555197-100555219 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274615 15:100555339-100555361 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274621 15:100555375-100555397 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274637 15:100555446-100555468 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274652 15:100555518-100555540 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274659 15:100555554-100555576 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274667 15:100555589-100555611 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274673 15:100555625-100555647 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274680 15:100555660-100555682 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274688 15:100555696-100555718 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274702 15:100555768-100555790 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274718 15:100555839-100555861 TTCAGGATGCCGATGAGGGACGG + Intergenic
1132274725 15:100555875-100555897 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274741 15:100555946-100555968 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274748 15:100555982-100556004 TTCCAGACGCAGATGAGGGAGGG + Intergenic
1132274756 15:100556017-100556039 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274761 15:100556053-100556075 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274783 15:100556160-100556182 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274829 15:100556373-100556395 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274842 15:100556445-100556467 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274914 15:100556802-100556824 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274921 15:100556838-100556860 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274929 15:100556873-100556895 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274977 15:100557122-100557144 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132274983 15:100557158-100557180 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274990 15:100557194-100557216 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274997 15:100557230-100557252 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275005 15:100557265-100557287 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132275011 15:100557301-100557323 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275018 15:100557337-100557359 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275026 15:100557372-100557394 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132275061 15:100557550-100557572 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132275067 15:100557586-100557608 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275074 15:100557622-100557644 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275081 15:100557658-100557680 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275089 15:100557693-100557715 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132275095 15:100557729-100557751 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275102 15:100557765-100557787 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275138 15:100557943-100557965 TTCAGGACGCAGATGAGGGACGG + Intergenic
1132275144 15:100557979-100558001 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275165 15:100558086-100558108 TTCCAGACGCAGATGAGGGATGG + Intergenic
1132275180 15:100558194-100558216 TTCCAGACGCAGATGAGGGACGG + Intergenic
1135423021 16:22317185-22317207 ATCAAGATCCTGATGAAGAATGG + Exonic
1135930204 16:26729866-26729888 TACAAGATCTAGAAGAAGTAAGG + Intergenic
1137942503 16:52702664-52702686 TGCAAGATGCAGAAGCAGGAGGG - Intergenic
1138634750 16:58328898-58328920 TTTAAAATCCAGACTAAGGAAGG + Intronic
1139512327 16:67434549-67434571 TTCAGAGTCCAGATTAAGGAAGG + Intronic
1140812314 16:78590234-78590256 TTCAAGATCAAGATGCAGACAGG + Intronic
1142182075 16:88676195-88676217 TCCCAGATCCAGGTGAAGGCAGG - Intergenic
1142769572 17:2086874-2086896 TTCAAGCTCCAGATCCAGCAGGG - Intronic
1144089187 17:11838565-11838587 GTGAAGACCCAGATGAATGAAGG + Intronic
1144504528 17:15818414-15818436 TTCCAGTTCCAGATGACAGAAGG - Intergenic
1144634267 17:16894033-16894055 TTCCAGTTCCAGATGACGGGAGG - Intergenic
1145168381 17:20633928-20633950 TTCCAGTTCCAGATGACAGAAGG - Intergenic
1146829564 17:36056739-36056761 GTAAAGATGCATATGAAGGAAGG + Intergenic
1147744239 17:42685312-42685334 TTCAAGACCGAGGAGAAGGACGG + Exonic
1149514692 17:57271601-57271623 GTAAAAACCCAGATGAAGGAAGG - Intronic
1150793493 17:68219397-68219419 TTCAAGACCCAGTTCAAGGGAGG + Intergenic
1152690013 17:81713720-81713742 TTCAACACCCAGATGAACGTGGG - Intronic
1153302546 18:3603907-3603929 TTAAAGATTTAGAAGAAGGATGG + Intronic
1155015192 18:21830744-21830766 TTCATGAGCCCGGTGAAGGAAGG + Intronic
1155021093 18:21897658-21897680 TTCAAAAACAAAATGAAGGAAGG - Intergenic
1156585197 18:38424283-38424305 TTCAAGAAAGAGATGGAGGAGGG - Intergenic
1156935946 18:42707224-42707246 TTGAAGGTTCAGATGAAGAAGGG + Intergenic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1158817843 18:61124595-61124617 TACAAGATCCTGAGGAAGTATGG + Intergenic
1162228458 19:9244491-9244513 TTCAAAATGCAGAAGAATGAAGG + Intergenic
1162354771 19:10175687-10175709 TTCAACATCCTGGTGAATGAGGG - Intronic
1163126690 19:15248033-15248055 TTCCAGTTCCAGAAGAAGGCAGG + Intronic
1163768590 19:19177316-19177338 TTCCTTATCCAGATGAAGAAAGG + Exonic
1166238926 19:41476337-41476359 TTCAAAATCCAGAAGGATGATGG - Intergenic
1166241184 19:41495316-41495338 TTCAAAATCCAGAAGGATGATGG - Intergenic
1166747695 19:45149445-45149467 TAAAAGTTCCAGATGAAGGAGGG - Intronic
1167235828 19:48314314-48314336 TCCAAGATCAAGATGTAGGCAGG - Intronic
1167855759 19:52238380-52238402 TTCAAGATTGAGGTGAAGGCAGG - Intergenic
925488966 2:4370426-4370448 TTGAAGATCCTCTTGAAGGAGGG + Intergenic
926783316 2:16495676-16495698 TTGAAGATGCAGATCAAGCATGG - Intergenic
929648911 2:43657906-43657928 TTGTAGATACAGAAGAAGGAGGG - Intronic
931202073 2:60106993-60107015 TTCAGGATACAGATGGAGGGAGG + Intergenic
931415367 2:62075415-62075437 TTAAAGATCAAGTTGCAGGATGG - Intronic
931615082 2:64147557-64147579 TTGGAGTTCCAGATGAAAGATGG + Intergenic
931789280 2:65649151-65649173 TTTAAAATCCAGATAAAAGAAGG - Intergenic
933191486 2:79338727-79338749 TTCAATATCCAGGCAAAGGATGG + Intronic
933660858 2:84926109-84926131 TTCAAGATCCAGCTGACGTGTGG - Intergenic
935725067 2:106016671-106016693 TTCAAAATCCAAATGAAGTGTGG - Intergenic
936168371 2:110144487-110144509 TTCAATATCCAGAAGAGGTATGG - Exonic
937488041 2:122336010-122336032 ATCAAAATCCAGTTGAAAGATGG - Intergenic
937816181 2:126253155-126253177 TTTAAGATGCAGATGAAGTGAGG - Intergenic
939817930 2:146919646-146919668 GTCAAGACCCAGAAGAAGAAAGG + Intergenic
940870625 2:158857185-158857207 TTCCACATGCAGAAGAAGGAAGG + Intronic
941177085 2:162211181-162211203 ATCAACATCCAGCTGAGGGATGG - Intronic
941519548 2:166522139-166522161 TTCAAAATTCAGTTGAAAGAAGG + Intergenic
941555318 2:166972222-166972244 TCCAAGATCAAGGTGCAGGAAGG - Intronic
941564691 2:167092008-167092030 GCCAAGATCCAGGTGAAGAAGGG + Intronic
941874267 2:170417566-170417588 TTCAAGATTCAGGTGAAGTCAGG + Intronic
942043895 2:172088036-172088058 TTCAAGAAGCTGATGAAGCAGGG + Exonic
943453455 2:188074313-188074335 ATCAAGATACAGAAGAAGGTTGG - Intergenic
944274723 2:197822786-197822808 TACAGGATCCAAAAGAAGGAAGG - Intronic
944334823 2:198520251-198520273 TCCAGGGTCCTGATGAAGGATGG - Intronic
946677988 2:222182579-222182601 TTCACCTTCCAGATGAAGGCTGG - Intergenic
948267603 2:236647019-236647041 GTCAAGGTCCAGAAGAGGGAAGG + Intergenic
1170368814 20:15626079-15626101 TTAACCATACAGATGAAGGAAGG + Intronic
1170852989 20:20020893-20020915 TTGAAGATGCAGATGCAGGAGGG + Intronic
1171516437 20:25741860-25741882 TTCAGGATCCCCATAAAGGAGGG - Intergenic
1172601064 20:36183284-36183306 ATCAACATGAAGATGAAGGAGGG - Intronic
1173436399 20:43035635-43035657 TTCAAAAACCAGATGAACAAAGG + Intronic
1173965975 20:47113254-47113276 TTCAGGATCCAGGAGAAGAATGG + Intronic
1174274534 20:49394191-49394213 TTTAGGATCCACAGGAAGGAAGG + Intronic
1174706352 20:52660271-52660293 TTAAAGAACAAAATGAAGGAGGG + Intergenic
1174890359 20:54385234-54385256 CCCAAGATCCAGATGCAAGAGGG - Intergenic
1175018401 20:55817073-55817095 TTTAAGATCCAGAAGAACAATGG + Intergenic
1176668484 21:9709608-9709630 ATCAAGACGCAGAGGAAGGAAGG + Intergenic
1177479446 21:21668215-21668237 TTCAAGATCCAAGAGAAGGGTGG - Intergenic
1178608832 21:34062550-34062572 TCCAAGATCAAGATGCTGGAAGG + Intergenic
1178921160 21:36739232-36739254 TTCAACAACCATATGAAGTAAGG + Intronic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179257385 21:39728479-39728501 TCCAAGATCAAGATGTGGGAAGG - Intergenic
1179472165 21:41618548-41618570 TTCAACATACAAATTAAGGAGGG - Intergenic
1180292487 22:10858599-10858621 TTCAGGCTCCAGATGAATGTCGG - Intergenic
1180495293 22:15888021-15888043 TTCAGGCTCCAGATGAATGTCGG - Intergenic
1180789044 22:18564178-18564200 TTCAGGATCCAGACAAAGGTGGG + Intergenic
1180798587 22:18620398-18620420 TTCAGGCTGCAGAGGAAGGAGGG - Intergenic
1180876217 22:19176430-19176452 TTGCAGATCCTGAAGAAGGAGGG - Exonic
1181223129 22:21374866-21374888 TTCAGGCTGCAGAGGAAGGAGGG + Intergenic
1181232691 22:21431142-21431164 TTCAGGATCCAGACAAAGGTGGG - Intronic
1181245960 22:21503714-21503736 TTCAGGATCCAGACAAAGGTGGG + Intergenic
1181255609 22:21560768-21560790 TTCAGGCTGCAGAGGAAGGAGGG - Intronic
1181944104 22:26502162-26502184 TACAAGCTCTATATGAAGGAAGG + Intronic
1182549091 22:31091404-31091426 TTCACCATCGAGATCAAGGACGG + Exonic
1182902138 22:33907440-33907462 TTAAAGAGCCAGATGCAGAATGG - Intronic
1184216129 22:43068500-43068522 TTCATGATCCAGGTGCTGGACGG + Exonic
1185157564 22:49203356-49203378 CTCAAGATGCAGAGGAAGGAAGG + Intergenic
949277298 3:2299470-2299492 TTGAAGATTCAGAAGAAAGAGGG - Intronic
951456522 3:22898312-22898334 TTCAAGATCCAGGTGTGGGCAGG - Intergenic
952932352 3:38370042-38370064 TTCCAGAACCTGAGGAAGGAAGG - Exonic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
954102218 3:48382427-48382449 TTCTACATCAAGATGAATGAAGG + Intronic
955497759 3:59553454-59553476 TTCTTTATCCAGGTGAAGGAAGG + Intergenic
956505453 3:69933510-69933532 TTCAAGATCTGAATGAAGAAAGG + Intronic
956552250 3:70474375-70474397 TGCAGGATCAAGATGAAGCAGGG + Intergenic
957167209 3:76690504-76690526 TTCAAGATCAATATGGAGGCAGG - Intronic
957589719 3:82180316-82180338 TTCAAGATCAAGGTGTAGGCAGG + Intergenic
958745426 3:98128378-98128400 TTCAAGATCCAGATGCTGACAGG + Intergenic
958748242 3:98163760-98163782 TTCAAGATCCAGATGCTGGCAGG + Intergenic
958752028 3:98203101-98203123 TTCAAGATCCAGATGCTGACAGG + Intergenic
959391891 3:105785593-105785615 TTCCAGAGCCAGAAGAAGGAAGG - Intronic
960500737 3:118435315-118435337 TTCAAGATAGTGAAGAAGGAAGG - Intergenic
961113149 3:124302730-124302752 TTCAAGATCAAGGTGATGGCAGG + Intronic
961994607 3:131228834-131228856 TTCAAGGTCCAGAGGCAGGCAGG + Intronic
962311568 3:134330594-134330616 TTCAAGATAGAGAGGAAGGTGGG - Intergenic
962584188 3:136825157-136825179 TTCAAGATCTAGAAAAAGGATGG - Intronic
962747710 3:138409842-138409864 CTCATGAATCAGATGAAGGAAGG - Intergenic
964587524 3:158323433-158323455 TTGAAGAACCAGATGAAGATTGG - Intronic
965477766 3:169178257-169178279 TGCAGGAGCCAGATGATGGAGGG + Intronic
965817396 3:172651518-172651540 TTAAAAATCCAAAGGAAGGAAGG - Intronic
966244259 3:177788828-177788850 ATCAAGTCCCAGGTGAAGGAAGG - Intergenic
966706002 3:182914651-182914673 TTCAAGAAACAGATTTAGGAGGG - Intronic
967730307 3:192900985-192901007 TTGAAGAAACTGATGAAGGATGG + Intronic
967755126 3:193160103-193160125 TTCAAGATCAAGATGATGGCAGG - Intergenic
968063992 3:195748039-195748061 TTCCAGATCCCGCCGAAGGAGGG - Intronic
968359276 3:198135935-198135957 TTCATGTGACAGATGAAGGAAGG - Intergenic
969363553 4:6680845-6680867 TGCAAGATGCAGAGGAAGGCAGG - Intergenic
970700065 4:18725815-18725837 TTCAAGATCAAGGTGTAGGTAGG - Intergenic
975224573 4:71856861-71856883 GTCAAGGTCCAAATCAAGGAGGG - Intergenic
976681426 4:87760358-87760380 ATCAAGACCCCTATGAAGGAAGG + Intergenic
977114194 4:93001647-93001669 TTTAATATCCAAATGAATGATGG + Intronic
978411845 4:108434483-108434505 TTCAAGCCTCAGAGGAAGGATGG + Intergenic
978840770 4:113209332-113209354 TTCTAGATCCAGACAAGGGAGGG + Intronic
980892200 4:138827847-138827869 TCCAAGACCCAGAGGAGGGATGG - Intergenic
981334614 4:143556309-143556331 TTTAAGATCGAGATTAAGAAAGG - Exonic
981613957 4:146626551-146626573 TTCAAGATCAAAATGGAGGCTGG - Intergenic
982251519 4:153412385-153412407 TTCAAGATCAAGATGTTGGCAGG + Intronic
982342753 4:154320449-154320471 CTCACGATCCAGACGAAGGAAGG - Exonic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
984198275 4:176686479-176686501 TTCAAGTTACAGAAGAAAGAAGG + Intronic
984699904 4:182812427-182812449 TGGAAGATTCAGAAGAAGGAAGG - Intergenic
985406295 4:189641900-189641922 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
986191113 5:5496637-5496659 TTCAACATGCAAATAAAGGATGG - Intergenic
986463014 5:7992761-7992783 TTCAAGATCAAGGTGTAGGCAGG + Intergenic
986759794 5:10869479-10869501 TTCAAGGTAGAGAGGAAGGAAGG - Intergenic
987483058 5:18483851-18483873 TTCAAGAACAAGCTGAAAGAGGG + Intergenic
987511315 5:18843736-18843758 AACATGATCGAGATGAAGGAAGG + Intergenic
987516387 5:18916405-18916427 TTCAAGATCCAGGTGCTGGGTGG + Intergenic
987684328 5:21177496-21177518 TTCAAGATCAAGATGCTGGCAGG - Intergenic
988871301 5:35393146-35393168 TTTATGATCCAGAAGAAGGCCGG + Intergenic
991139725 5:63226124-63226146 TTCAAGGTACAGATGTATGATGG - Intergenic
991472835 5:66987286-66987308 TGCTAGATACTGATGAAGGAGGG - Intronic
991548187 5:67806749-67806771 ATCCAGATCCACAGGAAGGAAGG - Intergenic
991698401 5:69295143-69295165 TTTAAGAGTGAGATGAAGGAAGG - Intronic
992184840 5:74233926-74233948 TTCAAAATGCAGAAGAGGGATGG + Intergenic
992290491 5:75274573-75274595 TTCCAGATCAAAATGAAGGCAGG + Intergenic
993860714 5:93133535-93133557 TTGAAGAACCAGATTTAGGAAGG - Intergenic
995209742 5:109523792-109523814 TTCAAGATCCAAATGAGCAAAGG + Intergenic
996198663 5:120642124-120642146 TTCATCATCCAGATGAAAAATGG - Intronic
996806541 5:127461884-127461906 TGCAATAACCAGATGAATGATGG + Intronic
997687368 5:135797966-135797988 TTTAATATCCAGAGGAAGAAAGG + Intergenic
998000429 5:138620774-138620796 ATCAAGTTCCAGGTGAAGAAGGG + Intronic
998187137 5:139989263-139989285 TTTAGTATCCAGATGAAGGAGGG - Intronic
998195963 5:140071576-140071598 TTTAGTATCCAGATGAAGGAGGG + Intergenic
1000288254 5:159846465-159846487 CACAAGATCCAGATGAACCATGG + Intergenic
1001044663 5:168362745-168362767 CTCAAGATGGAGGTGAAGGAAGG + Intronic
1002284513 5:178153461-178153483 TGCAAAATCCAGAGGAAGGAAGG + Intronic
1002923861 6:1593670-1593692 TTAAAACTCCAGAAGAAGGAAGG - Intergenic
1003277872 6:4667674-4667696 TTCAAGATCAAGGTGTAGGCAGG - Intergenic
1003618379 6:7675202-7675224 TGCAAGATACAGCTGAATGAAGG + Intergenic
1005817821 6:29570683-29570705 TTACAGGTCCAGAAGAAGGATGG + Intronic
1005860640 6:29897198-29897220 TTCAAGCTCCAGATGGAAGTTGG + Intergenic
1011724630 6:90197740-90197762 TTAAAACTCCTGATGAAGGACGG + Intronic
1012420681 6:99061591-99061613 TTTAAAAACCAGATGGAGGAAGG - Intergenic
1013105236 6:107021467-107021489 ATGAAGATCCAGAAGAATGAGGG - Intergenic
1013124747 6:107171845-107171867 TTCAAAATGTAGATGAAGGCAGG - Intronic
1013177605 6:107690754-107690776 TTCAAGAGCCAAGTGGAGGAAGG + Intergenic
1013649769 6:112182716-112182738 TTCAAGATCCAGATGGTGAGGGG + Intronic
1013958268 6:115866399-115866421 GACAAGATCCAGATCAAGAAAGG - Intergenic
1014992750 6:128102876-128102898 GTCTATATCAAGATGAAGGAAGG - Intronic
1017307912 6:152940542-152940564 TTCAAGGCCCAGAGGTAGGAGGG - Intergenic
1023333959 7:39149025-39149047 TTGAAGATCCAGGAGAGGGAGGG + Intronic
1025242994 7:57293695-57293717 TTGAGAGTCCAGATGAAGGATGG - Intergenic
1026154769 7:67817380-67817402 TTCAAGATCAAGGTGATGGCAGG + Intergenic
1028761510 7:94502370-94502392 TCCAAAAGCCAGGTGAAGGATGG + Intergenic
1032942090 7:136805781-136805803 TTCACTTTCCAGATGAAGGGAGG + Intergenic
1033725356 7:144110255-144110277 CTGAAGATCCAGACAAAGGAGGG + Exonic
1033728057 7:144142681-144142703 CTAAAGATCCAGACAAAGGAAGG + Intergenic
1033774673 7:144594764-144594786 TTCAAAATCCAGAAGGGGGATGG + Intronic
1036927038 8:12917012-12917034 TTCAGGTACCAGATCAAGGAAGG + Intergenic
1037014641 8:13886943-13886965 TTCAGGATCCAGAAAAAGCAGGG + Intergenic
1037341233 8:17847815-17847837 TGCAAAATCCAGAAGAATGAAGG - Intergenic
1037412833 8:18616444-18616466 TCCTAGATCCAGACGAGGGAAGG - Intronic
1037660812 8:20925198-20925220 TTCAAGATCAAGGTGGAGGCAGG + Intergenic
1038104144 8:24414523-24414545 TTGAAGATGCAGTTGAAAGAAGG - Intergenic
1038401659 8:27288594-27288616 TCCAAAATCCAGATGTTGGAAGG - Intronic
1038508793 8:28110563-28110585 TTCAATATCCATTTGAGGGAGGG + Intronic
1038950128 8:32404879-32404901 TTTAAGATGAAGATGAAGGCTGG - Intronic
1038976345 8:32700930-32700952 TTGAAGACCCAGAGGCAGGAGGG - Intronic
1039362526 8:36893960-36893982 GTCAAGTTAGAGATGAAGGAAGG - Intronic
1040476089 8:47779243-47779265 TTCAAGATCCAGAGTAATGTGGG - Intronic
1041626459 8:60034377-60034399 GCCAAAATTCAGATGAAGGAGGG + Intergenic
1041636059 8:60146341-60146363 TTCATGATCCAGCTGAATGAAGG + Intergenic
1043729979 8:83665158-83665180 TTTAAGATCCAATTGAAGAAAGG - Intergenic
1043952977 8:86329887-86329909 TTCAGGATCACGAGGAAGGAAGG + Intergenic
1044384041 8:91566554-91566576 ATCTAGATGAAGATGAAGGAAGG - Intergenic
1044469056 8:92544155-92544177 TTGAAGATCCAGTACAAGGAAGG + Intergenic
1046647165 8:116798725-116798747 TTCAAGAGCCAGAGAAAAGATGG - Intronic
1047720944 8:127638511-127638533 GTCAAGATCCAGATGCAGGATGG - Intergenic
1048255554 8:132902558-132902580 GTCAAGATGCGGATGAAGCAGGG - Intronic
1048755598 8:137734190-137734212 TCCAAGATCAAGATGCAGGGAGG - Intergenic
1048941391 8:139403582-139403604 TCCAGTATCCAGATCAAGGAAGG + Intergenic
1048946821 8:139456385-139456407 TTCAAGACCCAGGTCAGGGAAGG - Intergenic
1050340432 9:4632297-4632319 TTCAAGATGAAGCTGAAGGCCGG + Intronic
1051669263 9:19493885-19493907 TTCAACATGGAGATGCAGGAAGG + Intergenic
1052055532 9:23902860-23902882 TTCAATGTCCAGAGGTAGGAGGG - Intergenic
1053645371 9:40116862-40116884 TTCAGGCTCCAGATGAACGTCGG - Intergenic
1053760343 9:41346665-41346687 TTCAGGCTCCAGATGAACGTCGG + Intergenic
1055016955 9:71629056-71629078 TTGAAGATGGAGATGCAGGAAGG - Intergenic
1055511714 9:77001666-77001688 TTAAAGTTCCTGATGTAGGATGG + Intergenic
1055819275 9:80242304-80242326 TTCAAGATCAAGGTGAGGGTAGG + Intergenic
1059678973 9:116567706-116567728 TTCACGAAGAAGATGAAGGAAGG + Intronic
1060450947 9:123739040-123739062 TTCTAGATCCCTATGAAGGCTGG - Intronic
1060903061 9:127278738-127278760 TTCAAAATCAAGATGTAGCAGGG + Intronic
1062068054 9:134539508-134539530 ATCATGATCCAGAGGAAGGTGGG + Intergenic
1062743964 9:138199654-138199676 TTCATGTGACAGATGAAGGAAGG - Intergenic
1203657382 Un_KI270753v1:11337-11359 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
1186808643 X:13165162-13165184 TTTAAAATCCAGATGAAAGAAGG + Intergenic
1186857415 X:13639622-13639644 TTCAAGATCCAAATGGTGGCCGG - Intergenic
1191955763 X:66640908-66640930 TTCAGGATACAGATGCAGAAAGG - Intergenic
1192095090 X:68202155-68202177 TTAAAGTGGCAGATGAAGGAGGG + Intronic
1194795394 X:98205608-98205630 TCCAAGATCAAGATGTAGGCAGG + Intergenic
1195206313 X:102602833-102602855 TCCTAGTTCCAGTTGAAGGAGGG + Exonic
1195391977 X:104371816-104371838 TTGAAGATACAAGTGAAGGATGG - Intergenic
1195821012 X:108945072-108945094 ATCAATATCCAAATAAAGGAAGG - Intergenic
1197276835 X:124489309-124489331 CTCAAGATCCAGGTGATGAAAGG + Intronic
1197600960 X:128529347-128529369 GTCAAGAGCCAGATCAAGAATGG + Intergenic
1198154156 X:133941396-133941418 TTTCAGATCCAGAGGAAGAAAGG + Intronic
1198960814 X:142181167-142181189 TTCAAGATCAAGATGTTGGCTGG - Intergenic
1199176897 X:144799416-144799438 TTCCAGTTCCAGATAAAAGACGG - Intergenic
1199488460 X:148373213-148373235 TAGAAAATCCAGATGAAGAATGG - Intergenic
1200759550 Y:7025486-7025508 TCCAAGATCAAGATGTGGGAAGG + Intronic
1200973632 Y:9182723-9182745 TTCAAGATCCAGTAGATGTAAGG - Intergenic
1200975369 Y:9207069-9207091 TTCAAGATCCAAGAGAAGTAAGG + Intergenic
1201424489 Y:13833359-13833381 TTCAAGATCCAGGTGTGGGCAGG - Intergenic
1201756405 Y:17491204-17491226 TTCATGGGACAGATGAAGGAAGG + Intergenic
1201797042 Y:17906931-17906953 TTCAAGATCCAATAGAAGAAAGG - Intergenic
1201804511 Y:17999054-17999076 TTCAAGATCCAATAGAAGAAAGG + Intergenic
1201845147 Y:18414781-18414803 TTCATGGGACAGATGAAGGAAGG - Intergenic
1202137447 Y:21681793-21681815 TTCAAGATCCAGTAGATGTAAGG + Intergenic
1202358412 Y:24075990-24076012 TTCAAGATCCAACAGAAGAAAGG - Intergenic
1202512366 Y:25594123-25594145 TTCAAGATCCAACAGAAGAAAGG + Intergenic