ID: 1079010773

View in Genome Browser
Species Human (GRCh38)
Location 11:16826394-16826416
Sequence GGACCCACTGGAGGGCAAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079010773 Original CRISPR GGACCCACTGGAGGGCAAGC GGG (reversed) Exonic
900169671 1:1260617-1260639 GGACCCACTTCAGGACAAGTGGG - Intronic
900188545 1:1343873-1343895 GGGCCCCCAGGAGAGCAAGCTGG + Intronic
900272367 1:1797856-1797878 GGACACACTGAAAGGCAGGCGGG + Intronic
901810157 1:11762829-11762851 GGAGCCACACGAGGGCAGGCTGG - Intronic
902365409 1:15969804-15969826 TGACCCACTCCAGGGGAAGCTGG - Intronic
902623320 1:17662876-17662898 GGACCCAGTGGAGGGCAGGTGGG + Intronic
903184913 1:21623339-21623361 GGACACACTGCAGAGCCAGCTGG - Intronic
904405540 1:30285881-30285903 GGGCCTGCAGGAGGGCAAGCAGG + Intergenic
904458526 1:30661845-30661867 GGGCCTGCAGGAGGGCAAGCAGG + Intergenic
904614658 1:31743258-31743280 GGACCAACAGGAGGGGAACCAGG + Intronic
904900919 1:33856385-33856407 GGAGCCAGTGGAGGCCAGGCTGG - Intronic
907558582 1:55367409-55367431 GAACAGAGTGGAGGGCAAGCGGG - Intergenic
912650353 1:111433223-111433245 AGACCCACTGGATGGCAGGAAGG + Intergenic
915255690 1:154627190-154627212 GGCCCCACTAGAGGGTAATCCGG - Intronic
919683272 1:200456587-200456609 AGACCCCCTGGATGGAAAGCTGG - Intergenic
919778198 1:201207471-201207493 GGGCCCAGTGGAGGACAAGAGGG + Exonic
920275775 1:204803251-204803273 GGACTCCCTGGAGAGCAATCAGG + Intergenic
1065521857 10:26580848-26580870 GGAACCACTGCAAGGCAACCTGG + Intergenic
1067048596 10:42999661-42999683 GGACTCAAAGGAGGGCAGGCAGG - Intergenic
1067246658 10:44553111-44553133 TCGCCCACTGGAGGGCTAGCAGG + Intergenic
1067289357 10:44930006-44930028 GGACCCACTGGAGAGGAGGAAGG - Intronic
1069861450 10:71474175-71474197 GGACCCTCTGCAGAACAAGCTGG - Intronic
1070943807 10:80371634-80371656 AGTCCCACTGCAGGGTAAGCAGG + Intergenic
1072401907 10:95111268-95111290 GCAGCCCATGGAGGGCAAGCTGG - Intergenic
1073623925 10:105076593-105076615 GGGCCAACTGGTGGGCCAGCAGG + Intronic
1073842935 10:107518922-107518944 GGTCCCCCTGGAGTGCAGGCTGG + Intergenic
1074856850 10:117480201-117480223 GGAGCCACTAGATGGCAAACAGG - Intergenic
1074868588 10:117559699-117559721 GGTCCCACTGGTGGTCATGCAGG + Intergenic
1075445366 10:122509337-122509359 GGAGCGACTGGAGGGGCAGCTGG + Intronic
1076383613 10:130041275-130041297 GGACTCAGTAGAGGTCAAGCTGG - Intergenic
1077266390 11:1652935-1652957 GGAAGCCCTGGAGGGCCAGCCGG + Intergenic
1077412223 11:2408989-2409011 GAACCCACCGCAGGGCAACCTGG - Intronic
1077533987 11:3110295-3110317 GCAGCCACTGGAGGGCGAGGTGG + Intronic
1078059944 11:8036776-8036798 TGACCCCCTGGAGGACAACCGGG - Intronic
1079010773 11:16826394-16826416 GGACCCACTGGAGGGCAAGCGGG - Exonic
1081576805 11:44323792-44323814 GGCCCCACGGAAAGGCAAGCAGG - Intergenic
1081761374 11:45578420-45578442 GGAGCCACTGGAATGCAAGGGGG + Intergenic
1083429180 11:62605076-62605098 GGACTCCCAGGAGGGAAAGCAGG - Intronic
1084631585 11:70355349-70355371 GGAGCTGCTGGAGGGGAAGCAGG + Intronic
1086146385 11:83556824-83556846 GCATCCAGTGGAAGGCAAGCTGG + Intronic
1088249406 11:107849854-107849876 AGGCCCAGTGGAGGGCATGCTGG + Intronic
1089128190 11:116192052-116192074 AGACCTTCTGGAGGGCAAACTGG - Intergenic
1089260665 11:117221840-117221862 GCACCCACTGCAGGCCAGGCTGG - Intronic
1090205710 11:124882951-124882973 GGAGGCACTGGAGGGTAGGCAGG - Intergenic
1094830027 12:34295883-34295905 GGACCCAATGCAGGGCTTGCTGG - Intergenic
1098624289 12:72643684-72643706 GGAGCTACTGTATGGCAAGCTGG - Intronic
1101015333 12:100494694-100494716 GGAACCACGGAAGGGCAGGCAGG - Intronic
1101900177 12:108786238-108786260 GGACCCAGCTGAGGGCAAGATGG + Exonic
1103447782 12:121005491-121005513 GGAGCCAGTGGAGGGCGCGCTGG + Intronic
1103561510 12:121795411-121795433 GGCAGCACTGGAGGGCAGGCAGG + Intronic
1103927941 12:124434052-124434074 GGACCCTCTGGAGGCCCAGTTGG - Intronic
1104036782 12:125103116-125103138 GGACCCACTGGAGCTCCTGCGGG + Intronic
1104479238 12:129093038-129093060 GGACGCACTGGAGGACACACTGG + Intronic
1104617819 12:130285087-130285109 GGACCCACTGGAGTCCAGGATGG + Intergenic
1112324239 13:98432818-98432840 GGACCCACTGGAGGGTCTGCAGG + Intronic
1112744021 13:102507389-102507411 GTAGCCACTGGAGGAGAAGCAGG - Intergenic
1112939154 13:104840057-104840079 GTACTCATTGGAGGGAAAGCAGG - Intergenic
1113101368 13:106723080-106723102 AAGCCCACTGGAGTGCAAGCAGG + Intergenic
1113450095 13:110402950-110402972 GGACCCACTGGAGCCACAGCTGG + Intronic
1113484458 13:110644023-110644045 TGACCCATTTGAGGGCAAGTTGG - Intronic
1121342832 14:93115528-93115550 GGGCCCGCAGGAGGGGAAGCCGG + Intronic
1121592948 14:95133382-95133404 GGACCCATTGGTGAGGAAGCAGG + Exonic
1122278495 14:100607796-100607818 TGTCCCACTGCAGGGCAAGGAGG - Intergenic
1122655904 14:103259157-103259179 AGACCCAATGGAAGGGAAGCAGG + Intergenic
1122967376 14:105137709-105137731 GGAGCCACGGGAGGGCTTGCTGG - Intergenic
1123476368 15:20594661-20594683 GGAGGCACTGGAGGCCAAGGAGG - Intergenic
1123641643 15:22405703-22405725 GGAGGCACTGGAGGCCAAGGAGG + Intergenic
1125575353 15:40751698-40751720 TAACCCTCAGGAGGGCAAGCAGG + Intronic
1125717176 15:41825980-41826002 GGACACCCTGGAGGGCCAGATGG - Exonic
1129780027 15:78264220-78264242 GGACCCACGGAAGGGCAAGGGGG + Exonic
1132219290 15:100093294-100093316 GGACCCACAGGAGTTCAGGCAGG + Intronic
1132342502 15:101087332-101087354 GGCCCCACTGATGGGCAGGCTGG - Intergenic
1132414111 15:101608470-101608492 GCACCCTCTGGAGGGCAGGCAGG - Intergenic
1132981421 16:2740274-2740296 GGACCTGCTGTAGGACAAGCTGG + Intergenic
1135622683 16:23969196-23969218 GGCCCCACTGCAGGGGAAGGAGG - Intronic
1136370681 16:29834109-29834131 GTCCCCACTGCAGGGGAAGCAGG + Intronic
1136926964 16:34383170-34383192 GGAACCACTGAAAGGCAACCTGG - Intergenic
1136977610 16:35028637-35028659 GGAACCACTGAAAGGCAACCTGG + Intergenic
1138442914 16:57045961-57045983 GGTCCCACTAGAGGGCAGCCGGG - Intronic
1139126893 16:64089041-64089063 GGACTCAATGGATGGGAAGCAGG - Intergenic
1139422223 16:66855850-66855872 GGCCCCACTGCAGGGCCAGGAGG + Intronic
1140377530 16:74456717-74456739 GGAAGCACTGGAGGATAAGCGGG - Exonic
1141148054 16:81545781-81545803 GGGCCCACGGGAGGGCCGGCAGG - Intronic
1141860368 16:86712290-86712312 GCACCCACGGGAGGGGAAGCAGG - Intergenic
1142473330 17:175639-175661 GGAGCACCTGGAGGGCAAGTTGG - Intronic
1143479763 17:7221522-7221544 GGGCGTACTGGAGGGGAAGCAGG - Exonic
1144021530 17:11242860-11242882 GGGCTCACTGGGGGGCAAGATGG - Intronic
1146997044 17:37330261-37330283 GGACCTACTGGAGGAGAAGGAGG - Exonic
1147286708 17:39408233-39408255 AGACCCACTGGACGGCCAGATGG - Exonic
1148341129 17:46874121-46874143 AGATGCACTGGAGGGCAGGCAGG + Intronic
1150455503 17:65303933-65303955 GCACCCACTGGTGGGCATGAAGG - Intergenic
1151354088 17:73548380-73548402 GGACCCACTCGGGGGCAGGGGGG - Intronic
1151495771 17:74457328-74457350 GGACCCATTTGAGGACAGGCTGG + Intergenic
1151551261 17:74823788-74823810 GCACCTACTGGAGGTCACGCCGG + Intronic
1151624297 17:75267080-75267102 GTACCCACTGGATGGTAAGGAGG - Intronic
1152759243 17:82099408-82099430 GCACCCCATGGGGGGCAAGCGGG + Intergenic
1152816574 17:82411713-82411735 GGAGCCACTGGAAGCCAAGGTGG - Intronic
1153465745 18:5386284-5386306 GGTCTCACTGGAGTGCAGGCTGG - Intergenic
1155199981 18:23508696-23508718 GGGGCCACTGCAGGGCAGGCAGG - Intronic
1155223108 18:23703220-23703242 GGAACCACTGGAGTGCTTGCTGG - Intronic
1155798083 18:30065337-30065359 GGACCCACTTGAGCCAAAGCTGG + Intergenic
1161168376 19:2800781-2800803 GCACCCACTGAGGGGCAGGCTGG - Intronic
1162386190 19:10361865-10361887 GGACCCTGAGGAGGGCAAGATGG - Exonic
1162480133 19:10922922-10922944 GGAGCCATAGGAGGGAAAGCAGG + Exonic
1162792259 19:13069256-13069278 GTCCCCACTGGCTGGCAAGCAGG + Intronic
1162933463 19:13968736-13968758 GGACCCAGGGCAGGGCAGGCGGG - Intronic
1163437228 19:17302970-17302992 AGACATACTGGAGGGGAAGCAGG + Intronic
1163578614 19:18124761-18124783 GGACCCCCTGGAGGGTAAGCCGG + Exonic
1166633579 19:44429586-44429608 GGACCCTCTGATGGACAAGCAGG + Exonic
1167351515 19:48977996-48978018 GCTCCCACTGCAAGGCAAGCAGG + Exonic
1167660696 19:50794468-50794490 GGGCCCCCTGGAGGGCCAGCAGG - Exonic
1168095175 19:54110292-54110314 GCCCCCACTGGAGGGCACTCAGG - Intronic
1168281167 19:55306139-55306161 TGAGCCACTGGAGGGAAAGAAGG - Intronic
1168301401 19:55407222-55407244 GGAACCACTGGGGACCAAGCAGG - Intronic
1168539323 19:57197280-57197302 TGACCCACTTGATGGCTAGCTGG + Intronic
926003441 2:9352914-9352936 TTACCCACTGGAAGACAAGCAGG - Intronic
927147281 2:20174532-20174554 GGAGGCACTGGTGGGCAACCTGG - Intergenic
936450521 2:112630539-112630561 GGTCTAGCTGGAGGGCAAGCAGG + Intergenic
937982349 2:127623080-127623102 GAACCCACGGGATGGCAAGCAGG + Intronic
938729732 2:134137343-134137365 GGACTCACTGAGTGGCAAGCGGG - Intronic
942921314 2:181376684-181376706 TGACCAATTGGAGGGCAAGCAGG - Intergenic
948548145 2:238746913-238746935 GGACACCCAGGAGGGCAGGCTGG - Intergenic
948642391 2:239383923-239383945 AGAGCCACTGGAGGGCAGGGCGG + Intronic
1170689106 20:18596105-18596127 GGACACACTGGAGGGTAAACTGG - Exonic
1171048734 20:21836055-21836077 GGCCCCACTGGAGTACAAGGAGG + Intergenic
1172182763 20:33013701-33013723 GGGCCAAGTGGAGGGCAGGCAGG + Intronic
1172591403 20:36120670-36120692 GGACCCAGTGGAGGAGCAGCTGG - Intronic
1172891664 20:38270356-38270378 GAACCCACTGGAGGTCCAGGAGG + Intronic
1173112188 20:40202540-40202562 GGACCGACTGGATTGCAAACAGG + Intergenic
1173173149 20:40743405-40743427 GTACCCACTGGAGGGCAAACTGG + Intergenic
1173586841 20:44188795-44188817 TAACCCACTGGAAGGAAAGCAGG - Intergenic
1175940413 20:62535184-62535206 GGACCCCCTTGAGGGCCTGCAGG + Intergenic
1176179720 20:63743543-63743565 GGACCCTGTGGTGGGCAAGTGGG + Intergenic
1180220347 21:46354620-46354642 GGACACACGGGAGGGCAGGGAGG + Intronic
1181002381 22:19993960-19993982 GGACAAACTGCTGGGCAAGCAGG + Intronic
1181623770 22:24108279-24108301 GGACCCTCTAGAGGCCACGCAGG - Intronic
1182475736 22:30575351-30575373 GGCCCCACTGGGTGGCCAGCTGG - Intergenic
1183308478 22:37096744-37096766 GGACCCTCTGCAGGGCAGACAGG + Intronic
1183723382 22:39574987-39575009 TGACTCACTGGAGAGCCAGCAGG + Intronic
1184265902 22:43345815-43345837 GGAACCTCTGGATGCCAAGCTGG + Intergenic
950339529 3:12230310-12230332 GGACTCACTGCAGGGAAAGAGGG - Intergenic
952938033 3:38415949-38415971 GGACGCACAAGAGAGCAAGCAGG + Intronic
954899046 3:54003374-54003396 GTAGCCGCTGGAGGGCATGCAGG - Intergenic
955012428 3:55031346-55031368 TGAACAAATGGAGGGCAAGCTGG - Intronic
961869992 3:129980538-129980560 GGACCCCCTGGAAGTCAGGCTGG - Intergenic
962199577 3:133390355-133390377 GGCCCCACTGCAGGGAAACCAGG + Intronic
964335387 3:155649089-155649111 GGACAGTCTGGAGGGCAAGAGGG + Intronic
966201910 3:177366626-177366648 GCAGCCTCTGGAGGGTAAGCCGG + Intergenic
967245255 3:187480140-187480162 GGACCAACTGGAGGGAAATAGGG + Intergenic
968425818 4:522559-522581 GGACCCACTGCAGTGGCAGCAGG + Intronic
968705154 4:2074219-2074241 GGGCCCTCGGGAGGGCAGGCAGG + Intronic
969694042 4:8724953-8724975 GGTCACACAGGAGGGCAAGCTGG + Intergenic
975693077 4:76984816-76984838 GGACCCACTGGACAGCAAGAGGG + Intronic
981127789 4:141126612-141126634 GGACCAACTGGAGGGCACATGGG + Intronic
984860189 4:184230751-184230773 GGACCCACAGGATGGAAGGCAGG - Intergenic
985075903 4:186214281-186214303 GGACCCACTGAAGAGTGAGCAGG - Intronic
985434858 4:189918774-189918796 GGATCCACTGCAAGGCAACCTGG - Intergenic
985547182 5:515610-515632 GGACCCTGTGGAGGATAAGCAGG - Intronic
985689137 5:1297444-1297466 GGACCCACTGCAGGGGCAGCTGG - Intergenic
985767491 5:1787613-1787635 GGACCCAGTGGAGGCAAGGCAGG - Intergenic
986166165 5:5273145-5273167 GGGCACAGTGGAGGGCAAACAGG - Intronic
989355406 5:40538913-40538935 GGACCTACTGGGTGGCAGGCTGG + Intergenic
990954802 5:61331543-61331565 GGACCGGCTGGAGGGGAAGCTGG + Intergenic
994774524 5:104026043-104026065 GGACCCAGAGGAGGGCTAGAGGG - Intergenic
997602053 5:135147171-135147193 TGACCCACTGGAGGTGTAGCAGG + Intronic
997721402 5:136080803-136080825 CCACCCACTGGAGGGGAGGCAGG + Intergenic
998158282 5:139798302-139798324 GGACTCACCTGTGGGCAAGCCGG - Intronic
1002639004 5:180621842-180621864 GGAGCTACTAGAGGGCCAGCCGG - Exonic
1002713712 5:181211395-181211417 ATACCCACTGGAGGGCGTGCAGG + Intergenic
1003012236 6:2436670-2436692 AGCCCCAGGGGAGGGCAAGCCGG - Intergenic
1003311547 6:4973733-4973755 GGACCGAAGGGAGGGCAAGATGG - Intergenic
1005310628 6:24555730-24555752 GGAGCCACAGCAGGGCAAGCTGG - Intronic
1006003687 6:30986549-30986571 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003746 6:30986864-30986886 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003755 6:30986909-30986931 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003766 6:30986954-30986976 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003781 6:30987044-30987066 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003809 6:30987179-30987201 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003828 6:30987269-30987291 GGTCCCACTGGAGGTCGTGCTGG - Exonic
1006003846 6:30987359-30987381 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006151705 6:31993409-31993431 TGACCCACTGCAGGGCCAGGTGG - Exonic
1006158006 6:32026147-32026169 TGACCCACTGCAGGGCCAGGTGG - Exonic
1006271361 6:32969266-32969288 GTACCCATTGGAGGGCAAAGGGG + Intronic
1006945125 6:37779608-37779630 GGGCCCAGGGGAGGGCCAGCTGG - Intergenic
1007218887 6:40262855-40262877 GGACCCACTTGAGGAAAAGGAGG + Intergenic
1013980300 6:116121160-116121182 GGACCCCCAGGAAGGCCAGCAGG + Exonic
1014615628 6:123595398-123595420 GGATCCACTGCAGGGCAAATTGG - Intronic
1015498927 6:133910031-133910053 GGTGTCACTGGAGGACAAGCAGG + Intergenic
1016232892 6:141827842-141827864 GGACCCACTTGTGGTCAAGGGGG - Intergenic
1017838819 6:158204830-158204852 GGAGCCACTGTGGGGCAAGGGGG + Intergenic
1018424866 6:163671282-163671304 GGACCACCTGGAGGCCACGCAGG - Intergenic
1018762375 6:166903557-166903579 ATACCCCTTGGAGGGCAAGCTGG - Intronic
1019447647 7:1079725-1079747 GGACCCTCTGGAGGGCATCTGGG - Intronic
1019547245 7:1584418-1584440 GGACCCACCAGTGGGCAAGAGGG + Intergenic
1022953078 7:35356671-35356693 GGAGCCTCTGGCTGGCAAGCTGG - Intergenic
1028245725 7:88474620-88474642 GGACACACTAGAGGACAAACAGG - Intergenic
1030064702 7:105650651-105650673 GGACCCACTGCCGGCCAAGAAGG + Intronic
1034102607 7:148463749-148463771 GGGCCCACTGGATGGCAAAATGG - Intergenic
1034183149 7:149154187-149154209 GAACCAGCTGGAGGGCAAGTGGG + Exonic
1034196247 7:149250395-149250417 GAACCAGCTGGAGGGCAAGTGGG + Exonic
1034198587 7:149266577-149266599 GAACCAGCTGGAGGGCAAGTGGG + Exonic
1034227353 7:149494335-149494357 GAACCAGCTGGAGGGCAAGTGGG - Exonic
1034242531 7:149621391-149621413 GAACCAGCTGGAGGGCAAGTGGG - Intergenic
1035413849 7:158667547-158667569 GGACCCAGTAGTGGGTAAGCGGG - Intronic
1035437720 7:158871570-158871592 GGAACCACAGGAAGGCAAGCGGG - Intronic
1035531396 8:354525-354547 GGAGCCACTGGCGGGAGAGCTGG - Intergenic
1036770592 8:11575989-11576011 TGACCCACTGCCGGGAAAGCCGG - Intergenic
1037914822 8:22766640-22766662 GGAGCCAGTGGAGGGCATGCTGG + Intronic
1041351621 8:56952762-56952784 GGACCCACTGAAGGGTGAGGAGG - Intergenic
1041548440 8:59073801-59073823 GGACCCTCTGGAGGGCAGAGGGG - Intronic
1042022344 8:64380725-64380747 GGAGGCACTGGAGGGCCAGGAGG + Intergenic
1046417807 8:113939040-113939062 GGACCCACTGTAAGTCAAACCGG + Intergenic
1048770185 8:137886721-137886743 CTACCCACTGGGGGACAAGCAGG + Intergenic
1048970186 8:139641131-139641153 GGACCCACTGGAAGGCACCCTGG - Intronic
1049009119 8:139875590-139875612 ACACCCACTGCCGGGCAAGCTGG + Intronic
1049679783 8:143913025-143913047 GGCCTGACTGGCGGGCAAGCTGG - Intergenic
1052997998 9:34561535-34561557 GGATCCACTTGAGAGCAAGAAGG + Intronic
1056505034 9:87250454-87250476 GGAGCCAGAGGAGGCCAAGCAGG - Intergenic
1058960639 9:109989739-109989761 GGACCCACAGTAGGAGAAGCTGG - Intronic
1059431926 9:114255494-114255516 GGACACAATGGAAGGCCAGCGGG + Intronic
1060812665 9:126618882-126618904 AGACCCGCTGGGGTGCAAGCGGG + Intronic
1061999977 9:134211082-134211104 GCACACACTGGGGGACAAGCAGG + Intergenic
1062038457 9:134393128-134393150 GGACCAAGTGCAGGGCGAGCTGG + Intronic
1062299505 9:135857147-135857169 GGACCCAGTGGGTGGCCAGCAGG - Intronic
1062618228 9:137407576-137407598 GGACCCTCTGAAGGGCCTGCGGG - Intronic
1186401120 X:9260986-9261008 GGACCCTCAGGAAGGCCAGCAGG + Intergenic
1187087265 X:16053867-16053889 AGACCAACTGGAGGGGAAGTTGG + Intergenic
1187124836 X:16445359-16445381 GAAACCACTAGAGGGCGAGCAGG - Intergenic
1187216641 X:17283283-17283305 GGTTCCAGTGGAGGGGAAGCGGG + Intergenic
1189781018 X:44514474-44514496 GGACCTACTGGAGAGCTAGAGGG - Intergenic
1190119563 X:47649438-47649460 GGACTCACGGGAGGGTATGCGGG + Intronic
1190245272 X:48686774-48686796 GGACCCACTGGAGGGCCTGTGGG - Exonic
1190297963 X:49039600-49039622 GGACACACTGGAGGTCAGTCTGG + Intronic
1200158214 X:153989540-153989562 GGCCCCAGTGGAGGTCAAGTGGG - Intergenic