ID: 1079011307

View in Genome Browser
Species Human (GRCh38)
Location 11:16830684-16830706
Sequence CTTGGTAAATACATGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 257}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079011307_1079011313 4 Left 1079011307 11:16830684-16830706 CCATTCACCATGTATTTACCAAG 0: 1
1: 0
2: 0
3: 25
4: 257
Right 1079011313 11:16830711-16830733 TATACAGCCCCCACTGGGACAGG 0: 1
1: 0
2: 0
3: 8
4: 80
1079011307_1079011311 -1 Left 1079011307 11:16830684-16830706 CCATTCACCATGTATTTACCAAG 0: 1
1: 0
2: 0
3: 25
4: 257
Right 1079011311 11:16830706-16830728 GCACCTATACAGCCCCCACTGGG 0: 1
1: 0
2: 0
3: 15
4: 116
1079011307_1079011317 12 Left 1079011307 11:16830684-16830706 CCATTCACCATGTATTTACCAAG 0: 1
1: 0
2: 0
3: 25
4: 257
Right 1079011317 11:16830719-16830741 CCCCACTGGGACAGGCACCTGGG 0: 1
1: 0
2: 2
3: 21
4: 240
1079011307_1079011310 -2 Left 1079011307 11:16830684-16830706 CCATTCACCATGTATTTACCAAG 0: 1
1: 0
2: 0
3: 25
4: 257
Right 1079011310 11:16830705-16830727 AGCACCTATACAGCCCCCACTGG 0: 1
1: 0
2: 1
3: 8
4: 108
1079011307_1079011315 11 Left 1079011307 11:16830684-16830706 CCATTCACCATGTATTTACCAAG 0: 1
1: 0
2: 0
3: 25
4: 257
Right 1079011315 11:16830718-16830740 CCCCCACTGGGACAGGCACCTGG 0: 1
1: 0
2: 9
3: 24
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079011307 Original CRISPR CTTGGTAAATACATGGTGAA TGG (reversed) Intronic
901907075 1:12422134-12422156 CTTGATAAAGACATACTGAAGGG - Intronic
902526525 1:17061972-17061994 CCTGATAAATACTTGCTGAATGG - Intergenic
902773630 1:18660615-18660637 CGTGGTAAATACAGGTTGCAGGG - Intronic
902941858 1:19806082-19806104 CTGGGGAAAAACAGGGTGAAAGG - Intergenic
903352397 1:22725615-22725637 CTTGGCAAATCCATAGTCAATGG - Intronic
904674741 1:32192083-32192105 CTTGGTAAGCACATGGTTTATGG - Intronic
907250868 1:53138254-53138276 TTTGGTAATTTCATGGTGATGGG + Intronic
909890305 1:80997023-80997045 CTTTGTGAACACATTGTGAAAGG - Intergenic
911363703 1:96911004-96911026 CATGGTGAATAGATGCTGAATGG + Intergenic
912960628 1:114192387-114192409 CTTGGTGAGTCCATGCTGAATGG - Intergenic
915823040 1:159045950-159045972 CTTTGTATATACATAATGAAAGG - Intronic
915823401 1:159050078-159050100 CTTTGTATATACATACTGAAAGG - Intronic
917490739 1:175496278-175496300 GTTGGGGAATACCTGGTGAAAGG - Intronic
918350022 1:183645310-183645332 CTTAGTAAGTACAGGGAGAATGG - Intronic
918387224 1:184021727-184021749 GTTATTAAATACATAGTGAAGGG - Intronic
919473978 1:198011795-198011817 CTTGGGAAATACATGGTTTTTGG - Intergenic
921676889 1:217986289-217986311 TTTGATAAATATTTGGTGAATGG - Intergenic
922851484 1:228736716-228736738 CTTGGTAGATACAAAGAGAAAGG + Intronic
924905286 1:248445594-248445616 CTTATTAAATACATTGTGTAGGG - Intergenic
924922603 1:248646457-248646479 CTTCTTAAATACATTGTGTAGGG + Intergenic
1064037337 10:11925471-11925493 CTCAGTAAATATTTGGTGAATGG - Intronic
1064499374 10:15952297-15952319 CTTAGTAAATACTTGTTGAATGG + Intergenic
1064527786 10:16276003-16276025 CTTCCTAAAGACATGCTGAAAGG + Intergenic
1065208396 10:23378962-23378984 CTTAGAAAATACAAGGTGAAAGG - Intergenic
1067384555 10:45806507-45806529 CTCAGTAAATATCTGGTGAATGG + Intergenic
1067666921 10:48286938-48286960 CTTGATAAATGCATGCTGATTGG + Intergenic
1067879641 10:50032299-50032321 CTCAGTAAATATCTGGTGAATGG - Intergenic
1068646031 10:59469479-59469501 TTAAGTAAATAGATGGTGAATGG + Intergenic
1069282275 10:66669732-66669754 CTTGGAAAATTCATGCTCAAGGG - Intronic
1070718061 10:78736931-78736953 CTTAGTAAATACTTGCTGATTGG - Intergenic
1071122349 10:82293891-82293913 CTTGCTAAATACAAGGTTGAAGG - Intronic
1071395720 10:85221889-85221911 CATGGTAAGGACCTGGTGAAAGG + Intergenic
1072126476 10:92449931-92449953 ATTGGTCAATACAGGGGGAAGGG + Intergenic
1074564675 10:114566462-114566484 ATTGGTAAATACATGAAGAAGGG + Intronic
1074692138 10:116015898-116015920 CTTTGTTATTAGATGGTGAAGGG - Intergenic
1075447057 10:122520298-122520320 CCTGGTAAATTCATTGTAAATGG + Intergenic
1075828968 10:125387805-125387827 CTTGGTATTTACATTGAGAAGGG + Intergenic
1076004327 10:126935863-126935885 CTTAGTAAATATTTGTTGAATGG + Intronic
1076025744 10:127111540-127111562 CTTGGAAAACACCTGGTGAGTGG - Intronic
1076662159 10:132062908-132062930 CTTGGATAATAACTGGTGAATGG + Intergenic
1079011307 11:16830684-16830706 CTTGGTAAATACATGGTGAATGG - Intronic
1082222510 11:49657009-49657031 ATTGGTGAGTGCATGGTGAATGG + Intergenic
1083971605 11:66080207-66080229 CTCAGTAAATATTTGGTGAATGG - Intronic
1085078643 11:73614940-73614962 CTTGCTAAATATCTGCTGAATGG - Intergenic
1085142605 11:74161255-74161277 CTGGGTAAAAACATGGGCAAAGG + Intronic
1086329477 11:85739162-85739184 CCTGGTACATAACTGGTGAATGG + Intronic
1087413746 11:97825890-97825912 TTGGGTATATACATGGTGATGGG - Intergenic
1087590997 11:100187697-100187719 CTTGGTCAATAAATGGTGTTGGG + Intronic
1088662125 11:112058150-112058172 CATGTTAAATAAATGTTGAATGG - Intronic
1089723164 11:120448800-120448822 CTTAGTAAATATTTGTTGAATGG + Intronic
1090383153 11:126340785-126340807 CCTGATAAATACATGTTGAATGG - Intronic
1090408847 11:126493782-126493804 CTGGGCAAACACATGGTGACAGG + Intronic
1092626069 12:10330244-10330266 CTTGGTTAATAAATGATGGATGG - Intergenic
1092944748 12:13442287-13442309 CTTTGGAAATACACGGTGAAGGG - Intergenic
1093250457 12:16796924-16796946 TTTGGTTAATAAATGTTGAATGG + Intergenic
1096654034 12:53077403-53077425 CTTGGTAAATGTTTGTTGAATGG - Intronic
1098889702 12:75996962-75996984 CATGGGAAATTCCTGGTGAAAGG + Intergenic
1102857219 12:116304772-116304794 CTTGGTAAGTAGGTGGAGAATGG - Intergenic
1103663209 12:122538939-122538961 ATTAGGAAATACTTGGTGAAAGG + Intronic
1104263381 12:127206145-127206167 CTTTATAAAAACATGGTGGAGGG - Intergenic
1105235223 13:18544962-18544984 CTGGGCAAAGACATTGTGAATGG + Intergenic
1106396810 13:29388188-29388210 TCTGGTAAATACATGGGGATTGG - Intronic
1107402808 13:40085879-40085901 CTTCCTGAATACATGGTGAGTGG + Intergenic
1108409887 13:50134846-50134868 CTGGGTAGATCCAAGGTGAAGGG + Intronic
1108757496 13:53521742-53521764 CTTGGTAAAAACAGAGTGAAGGG - Intergenic
1108825396 13:54407399-54407421 TATGATAAATACATGGTGGAGGG + Intergenic
1109294939 13:60518597-60518619 CTTTGTAAATACATGTAAAAAGG + Intronic
1110048482 13:70861271-70861293 CTTTGTAGATACTTGCTGAATGG - Intergenic
1111255883 13:85667872-85667894 CTTGGTAAATAATTTGCGAAAGG - Intergenic
1112100131 13:96179473-96179495 ACTGATAAATACATGGTGAATGG - Intronic
1112668980 13:101613318-101613340 CCTGGTAAATATATGTTGACTGG - Intronic
1112727890 13:102326459-102326481 ATTGGTAAATAAATAATGAATGG + Intronic
1112950328 13:104987784-104987806 ATTGGAAAACACCTGGTGAATGG - Intergenic
1113477728 13:110597024-110597046 TTTGGTAAATGCAGGGAGAATGG + Intergenic
1114524212 14:23358383-23358405 CTTGGTAAATACCTGATAAATGG + Intronic
1115175702 14:30559269-30559291 CTTGGTGAGTAAATGGGGAACGG + Exonic
1115557449 14:34554652-34554674 CTGGGTAAATACAAGGGGCAGGG + Intergenic
1118767557 14:68920340-68920362 CTTGCTAAATCCATGGTCACAGG + Intronic
1119448162 14:74684104-74684126 CATAGTCAATACATGATGAATGG + Intronic
1123628782 15:22246355-22246377 CTTCCTAAAGACTTGGTGAATGG + Intergenic
1124255198 15:28135588-28135610 CTTAATAAACACATGCTGAATGG + Exonic
1125413215 15:39426647-39426669 CTTGGTAAATATTTGCTGAACGG - Intergenic
1125842534 15:42817756-42817778 CATGGTAAATCCATTGTGGAAGG - Intronic
1125918903 15:43512790-43512812 CTTGGTACTTACATGATGATGGG + Intronic
1126351387 15:47748346-47748368 CTCAGTAAATACTTGATGAATGG - Intronic
1126612425 15:50543251-50543273 CTTTGTAAATAGAGGCTGAATGG - Intronic
1127840667 15:62828768-62828790 CTTGGGAAATGCATTTTGAATGG + Intronic
1128890601 15:71328483-71328505 CTTGATAAATATATATTGAATGG - Intronic
1128903201 15:71444132-71444154 CTTAATAAATGCATGATGAATGG + Intronic
1130151047 15:81312067-81312089 CTGGGTAAATGCAGCGTGAAGGG + Exonic
1131804995 15:96112430-96112452 ATTGATAAAGAAATGGTGAATGG - Intergenic
1134540319 16:15058763-15058785 CTTAGTAAATATTTAGTGAAAGG + Intronic
1137558432 16:49488078-49488100 CTCAGTAAATACTTGCTGAATGG + Exonic
1138766573 16:59612543-59612565 CTTAGTAACTGCTTGGTGAAAGG + Intergenic
1138816080 16:60204392-60204414 CAGTGTGAATACATGGTGAAAGG - Intergenic
1139041237 16:63001488-63001510 CTTGCTAAAGACTTGTTGAATGG + Intergenic
1140521452 16:75585413-75585435 CTTAGTAAACAACTGGTGAAGGG - Intergenic
1141975299 16:87511914-87511936 CTTCCTAAAGACTTGGTGAATGG - Intergenic
1142784743 17:2212097-2212119 CTTTGAAAATACATGTTGTATGG + Intronic
1143811963 17:9479099-9479121 CTTGGTAAACACCTGTTGAATGG + Intronic
1144262992 17:13541457-13541479 CTTGGTACACACATTGGGAATGG + Intronic
1146147592 17:30434684-30434706 CTTGGCAATTAGATGGTGAATGG + Intronic
1146747007 17:35340392-35340414 CCTTGAACATACATGGTGAAAGG - Intergenic
1146927597 17:36755599-36755621 CTTGGTAAGTACTTGGTAGAGGG + Intergenic
1151268936 17:72978260-72978282 CTCGGTAAATATCTGATGAAGGG - Intronic
1154514316 18:15145045-15145067 CTGGGCAAAGACATTGTGAATGG - Intergenic
1156433937 18:37105991-37106013 CTTGGTAATTCCATGTTTAAGGG - Intronic
1156636735 18:39040452-39040474 CTTGGTAGATAGATGGTCTAAGG - Intergenic
1157531032 18:48420882-48420904 GTTGGTAAATTCTTGTTGAAGGG - Intergenic
1158360572 18:56667837-56667859 TTTAATAAATATATGGTGAAGGG - Intronic
1160456063 18:79001622-79001644 CTTGGTACAGAAATGCTGAAAGG - Intronic
1161761040 19:6173035-6173057 CTGGGAAAAGACATGGAGAAGGG - Intronic
1162677838 19:12313659-12313681 CTTGGTAAGTTCATGGTCCAAGG + Intergenic
1163949070 19:20567439-20567461 CTTGGTGATTAAATGGTCAAGGG + Intronic
1166439427 19:42798498-42798520 CTTGGTAAAAACACAGTGCAGGG + Intronic
1166457465 19:42954049-42954071 CTTGGTAAAAACACAGTGCAGGG + Intronic
1166467793 19:43048478-43048500 CTTTGTAAAAACACGGTGCAGGG + Intronic
1166474410 19:43109268-43109290 CTTGGTAAAAACACAGTGCAGGG + Intronic
1166495054 19:43294821-43294843 CTTGGTAAAAACACAGTGCAGGG + Intergenic
1167739890 19:51318230-51318252 CTTGGGAAATATTTGTTGAATGG - Intronic
925196789 2:1932252-1932274 CTAGGTAAATACATGGCTCATGG - Intronic
927229420 2:20806425-20806447 CTTGGAAAATATATGGTGACTGG + Intronic
928010280 2:27601135-27601157 CTTGGCAAATATTTGGTTAATGG + Intronic
928416760 2:31099567-31099589 CTTGGTGTATACATGGTGTGAGG + Intronic
928673240 2:33623854-33623876 CTTGGTACATACTTAGTAAAAGG - Intergenic
929087983 2:38187285-38187307 ATTGGGAGATAAATGGTGAATGG - Intergenic
931129553 2:59319013-59319035 CTCGCTAAATAAATGGCGAAGGG + Intergenic
931386242 2:61800339-61800361 TTTGGTAAAGACATGGTAATTGG - Intergenic
932333377 2:70913838-70913860 CTTATTAAATACATGTTGAATGG + Intronic
932668459 2:73717035-73717057 ATTGGTCAAAACATGGTGAGTGG - Intergenic
935696626 2:105776383-105776405 CCTGGTATATGCATGGTGACAGG - Intronic
936373573 2:111922480-111922502 CTTGGACAATGCATGGGGAAGGG - Intronic
936552735 2:113462145-113462167 CTTAGTAAATACTTTGCGAATGG + Intronic
937008834 2:118543441-118543463 CTTCCTAAAAACATGTTGAATGG + Intergenic
937534117 2:122865360-122865382 CTTGGTATACTCATGGTTAAAGG - Intergenic
937697395 2:124823310-124823332 GTTTGTAAATATATAGTGAATGG - Intronic
938514558 2:131989655-131989677 CTGGGCAAAGACATTGTGAATGG - Intergenic
938685487 2:133733756-133733778 CTTGGTAAATACAAAGTAATTGG - Intergenic
940686413 2:156856730-156856752 CTTGCCAAATACTTGCTGAATGG - Intergenic
940738641 2:157481587-157481609 GTTTGTAAATACACAGTGAAAGG + Intronic
941585715 2:167355608-167355630 CATGGACAATAGATGGTGAAAGG - Intergenic
944437151 2:199702590-199702612 CTTGATAAATATTTGTTGAATGG - Intergenic
946861618 2:224005101-224005123 CATTGTAAAAACAGGGTGAAAGG + Intronic
948927360 2:241107879-241107901 CTTGGTGCCTACATGGTTAAAGG - Intronic
1169870235 20:10241382-10241404 CTCAGTAAATACATGGGGAGTGG - Intronic
1171066566 20:22022217-22022239 CTTCATAAATACTTGTTGAATGG + Intergenic
1171970854 20:31564168-31564190 CCTGGTAAATACTCAGTGAATGG - Intronic
1173255510 20:41392052-41392074 TTTGGTAAATATCTGTTGAATGG + Intergenic
1176779215 21:13173245-13173267 CTGGGCAAAGACATTGTGAATGG + Intergenic
1177517494 21:22174706-22174728 CTTGGAAACAAAATGGTGAAAGG - Intergenic
1177976860 21:27862283-27862305 CTGGGCAAAGACATTGTGAATGG + Intergenic
1181658722 22:24323760-24323782 CTTGGCACATACATGTTGAGAGG + Intronic
1181684179 22:24517116-24517138 CTATGTAAATAAATGTTGAATGG - Intronic
1181995482 22:26877644-26877666 GTTGGTAAAGACATGGAGCAAGG - Intergenic
1182583944 22:31332368-31332390 CTTGGTTAATCAGTGGTGAATGG - Intronic
1183244883 22:36685919-36685941 CTTGGTGAATAAATGGGGATAGG - Intronic
951148402 3:19257036-19257058 CTTAGTAAATACTTGCTGAAGGG + Intronic
952355638 3:32580801-32580823 CTTGGAAAATGGATGATGAATGG + Intergenic
953593888 3:44288998-44289020 TTTGTTAAATACATGGAGTATGG - Intronic
955801148 3:62687974-62687996 CTTGTTGAATAAATGATGAAAGG - Intronic
956604074 3:71053882-71053904 CTGGATAAATACATGTTGCATGG - Intronic
957454520 3:80423652-80423674 CTGTGTCCATACATGGTGAAAGG + Intergenic
958454620 3:94315167-94315189 CTTGGAAAATACAAAGTCAAGGG - Intergenic
958672517 3:97222841-97222863 CTTGGTAATTACCTGTTTAATGG - Intronic
959496762 3:107060866-107060888 CTAGGTAAAAAGAAGGTGAAAGG - Intergenic
959933194 3:112004199-112004221 CTTGGAAAACAGAAGGTGAATGG + Intronic
962279087 3:134036815-134036837 CTTGGTAAAAACATGTTTATGGG - Intronic
963885430 3:150576683-150576705 CTTAGTAAATACATGCTTCAAGG - Intronic
964155758 3:153583157-153583179 TTTGGTAAATAAATGGGGAAAGG - Intergenic
970521331 4:16887182-16887204 CCTGGTAATTACATAGTGACAGG + Intronic
971633522 4:29027168-29027190 CTCAGTATATACATAGTGAAAGG - Intergenic
971659999 4:29401215-29401237 TTTAGAAAATAAATGGTGAATGG - Intergenic
972657458 4:41078612-41078634 TTTAGTTAACACATGGTGAAGGG + Intronic
972700334 4:41488068-41488090 ATTGCTCAATACATGGAGAAAGG + Intronic
973206744 4:47569514-47569536 CTTGATAAATACTTGTGGAATGG - Intronic
977774192 4:100897848-100897870 TTTGAAAAATCCATGGTGAATGG - Intergenic
979871128 4:125823498-125823520 CTGTGTAATCACATGGTGAAAGG + Intergenic
979998925 4:127465863-127465885 TTTGGGAAATAAATGGGGAAGGG + Intergenic
980323279 4:131307050-131307072 TGTGGTAAATACATGGGGACAGG - Intergenic
981002967 4:139845714-139845736 CTTTATAAATCTATGGTGAATGG + Intronic
981997896 4:150994426-150994448 CTTAATAAATACATGTTGGATGG - Intronic
983848267 4:172545710-172545732 TTTGCTAAAAGCATGGTGAATGG + Intronic
983911450 4:173244089-173244111 CTCTGTAAATACATGGTTACTGG + Intronic
984444676 4:179820865-179820887 TTTAGTGAATACATGTTGAATGG - Intergenic
984781144 4:183526924-183526946 CTTAATAAATACATTTTGAATGG + Intergenic
986914563 5:12602611-12602633 TTATGTAAATACATGGTGAGAGG - Intergenic
988153822 5:27422969-27422991 CTTGGTCAATACTTGGAGATAGG - Intergenic
988362723 5:30256260-30256282 CTTCCTAGATACTTGGTGAATGG - Intergenic
988628381 5:32901437-32901459 CTTCTTAAAGACATGTTGAATGG - Intergenic
989271267 5:39536130-39536152 TATGTTAAATACATGGTGAAAGG + Intergenic
989489071 5:42029659-42029681 ATTTGAAAATACATGGTGAGAGG - Intergenic
990164544 5:52979828-52979850 CTCAATAAATACATGCTGAATGG + Intergenic
990745274 5:58952746-58952768 GATGGTAAATACATTTTGAAAGG + Intergenic
992755421 5:79900897-79900919 ATTGGTAATTTCAGGGTGAAGGG + Intergenic
993592713 5:89814502-89814524 TTTAGTAAATACATGCTGAATGG + Intergenic
993745044 5:91586808-91586830 CTTGGCAAAAATCTGGTGAAAGG + Intergenic
994380117 5:99060874-99060896 CTGGGAAAATAAATGCTGAATGG - Intergenic
994521242 5:100839213-100839235 CTGGGTAAATACATATTGCAAGG + Intronic
995425910 5:112022585-112022607 CTTGGTTAATTCAAGGTGAGTGG - Intergenic
995779897 5:115763690-115763712 CTTTGTAAAGACTTGTTGAATGG - Intergenic
996916546 5:128719315-128719337 CTTGGGAAATAAATGGTGTGTGG + Intronic
997979053 5:138457856-138457878 TTTGATAAATACTTGTTGAATGG + Intergenic
998189677 5:140012565-140012587 CTTGGTAATAACAAGGTGATGGG - Intronic
998901660 5:146861982-146862004 CTCAGTAAATACCTGCTGAATGG + Intronic
998938080 5:147251890-147251912 ATTGTTAAATACATGGATAAAGG - Intronic
999577473 5:152995482-152995504 TTTGTTAAATAAATGGTTAATGG + Intergenic
1000962878 5:167621088-167621110 CTTATTAAATACTTGCTGAATGG - Intronic
1003283343 6:4712842-4712864 CTTGGTACATACTTGGTAAATGG - Intronic
1003479626 6:6519152-6519174 CTTGGAAAATAAGTCGTGAAAGG - Intergenic
1003509368 6:6766557-6766579 GTTGGAAAATACAAGTTGAAAGG - Intergenic
1003605026 6:7551899-7551921 CTAGGTATATACCTTGTGAATGG - Intronic
1003791606 6:9552815-9552837 CTTCCTAAAGACTTGGTGAATGG - Intergenic
1004703952 6:18105280-18105302 CCTGGTAAACACATGGTTTAGGG - Intergenic
1004919227 6:20360602-20360624 GTAGGTTCATACATGGTGAACGG - Intergenic
1005227438 6:23658930-23658952 GCTGGTAAACACATGGTGACTGG + Intergenic
1005491326 6:26349975-26349997 TTTGGTAAATACTTGTGGAATGG - Intergenic
1006876227 6:37299504-37299526 CTTAATAAATACTTGTTGAATGG - Intronic
1007729045 6:43934733-43934755 CTTGGTCAGTACTTGGTGCATGG - Intergenic
1010618644 6:78045669-78045691 CTTTGTAAAGACTTGTTGAATGG - Intergenic
1011806868 6:91081927-91081949 CTTGCTAAATGCATGGAAAATGG + Intergenic
1012199488 6:96387792-96387814 TATGGTAAATATTTGGTGAACGG - Intergenic
1014353581 6:120375443-120375465 CCTGGTAAACACATAGGGAAAGG - Intergenic
1014477646 6:121893466-121893488 CTTAGTAAATATTTGTTGAAAGG + Intergenic
1016049911 6:139519938-139519960 CTTGTTAAAGCCATGGTGTACGG + Intergenic
1016428758 6:143961251-143961273 TTTGATAATTACTTGGTGAACGG - Intronic
1016867724 6:148784725-148784747 ATTGATGAATACCTGGTGAATGG + Intronic
1017538403 6:155373258-155373280 CTCAGTAAATACTTGTTGAATGG - Intergenic
1017677177 6:156826495-156826517 CTTAGTAAATGTGTGGTGAATGG + Intronic
1017740778 6:157404686-157404708 CTTGGTTCATAGATGCTGAATGG + Intronic
1017946276 6:159098896-159098918 CGTGGCGAATACCTGGTGAACGG + Intergenic
1018072741 6:160179755-160179777 CTTGGAAAATACTTCTTGAATGG + Intronic
1018883357 6:167907552-167907574 CTTTGTAAAAACATAGAGAAAGG + Intronic
1021075997 7:16305506-16305528 CCTGGGAAACACATGCTGAAAGG - Intronic
1021272945 7:18614551-18614573 CTTGGTAAATATTTGTTGAATGG + Intronic
1021873875 7:25030558-25030580 TCTGGTACAAACATGGTGAAGGG - Intergenic
1022749717 7:33212268-33212290 ATTTGAAAATACATGGTCAAAGG - Intronic
1024570487 7:50718988-50719010 CTTGGTAAATATTTGTTGAATGG - Intronic
1030746165 7:113169352-113169374 ATGGTGAAATACATGGTGAAGGG - Intergenic
1031728615 7:125268843-125268865 CTTAGTGAATAAATGATGAATGG + Intergenic
1032573315 7:133025232-133025254 CTTTCTAAATACCTGGTGACTGG + Intronic
1033093415 7:138407731-138407753 TTTGGGAAGAACATGGTGAATGG - Intergenic
1033754194 7:144384554-144384576 CTTGGGAACTGCAGGGTGAATGG - Intergenic
1035209529 7:157317629-157317651 CTTGGTGAATACCTTTTGAAGGG + Intergenic
1037350475 8:17949318-17949340 CTTGTTAGTTAAATGGTGAAAGG - Intronic
1038801658 8:30754926-30754948 CTTGTTTATTACATGGTTAAGGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043390283 8:79785136-79785158 CTTGCTAAATGCATGTTGAATGG - Intergenic
1046380272 8:113440689-113440711 CATAGTAAATACATGTTGAAGGG - Intergenic
1046471726 8:114683647-114683669 CTGGGTCATAACATGGTGAAAGG + Intergenic
1046516131 8:115263594-115263616 CTTAGTAAATAGTTGTTGAACGG - Intergenic
1047559670 8:125973037-125973059 CTTTGTCATTCCATGGTGAAGGG + Intergenic
1048259345 8:132932378-132932400 CTGGGCAAATACAGGGGGAAGGG + Intronic
1048658490 8:136570750-136570772 CTTCCTAAATACTTGTTGAATGG + Intergenic
1048762238 8:137807749-137807771 CTTAGTGAGTACATGTTGAATGG + Intergenic
1049900264 9:155036-155058 CTTAGTAAATACTTTGCGAATGG - Intronic
1050836731 9:10090484-10090506 GTTGTTAAAATCATGGTGAATGG - Intronic
1054966366 9:71031875-71031897 ATTAGTAAATACATGTTGGATGG - Intronic
1055020706 9:71666467-71666489 GTTGGTAAGAACATGGTGAAAGG - Intergenic
1055413237 9:76053728-76053750 CTTCGTAGAGACATGTTGAATGG - Intronic
1055663361 9:78529565-78529587 CTTGGGAATTACAGGGTGCAGGG - Intergenic
1055919219 9:81440194-81440216 CTCGGTAAATACATGGGGCCTGG + Intergenic
1056892083 9:90503690-90503712 CTTGGTAAATCAAGGGTCAAGGG + Intergenic
1058331941 9:103772877-103772899 CCTTTTAAATACATGGTGCAGGG - Intergenic
1058531573 9:105911003-105911025 CTTGATGTTTACATGGTGAATGG + Intergenic
1058762506 9:108148671-108148693 CTTGGTACCTACATGGTATATGG + Intergenic
1061313742 9:129780855-129780877 CTTAGGAGATACATGATGAAGGG + Intergenic
1061385621 9:130287754-130287776 CTGGGTAAATAGCTGGTGAATGG + Intronic
1186955865 X:14681423-14681445 GTGGATAAATACATGGTGGATGG - Intronic
1187176005 X:16897194-16897216 CTTTGGAAATACATGGTTCACGG - Intergenic
1188817209 X:34730076-34730098 CTTGGAAAATATTTGTTGAAAGG + Intergenic
1188863760 X:35288897-35288919 CTTGGTAAATACAAGTAAAATGG - Intergenic
1189022491 X:37355431-37355453 ATTGGTAAATTGCTGGTGAAAGG + Intronic
1189636144 X:43011872-43011894 CTTGGTAATTAGGTGGTGAAAGG - Intergenic
1190232068 X:48590031-48590053 CTTGGTAGATAGGAGGTGAATGG - Intronic
1190285710 X:48959961-48959983 CATAGTAAGTACTTGGTGAAGGG - Intergenic
1191688108 X:63913392-63913414 CTTGCTAGAGACATGTTGAATGG + Intergenic
1191710144 X:64140875-64140897 CTTAATAAATACTTGTTGAATGG + Intergenic
1192661810 X:73049708-73049730 CTTGTGAAATAGATCGTGAAGGG - Intergenic
1192913937 X:75634488-75634510 TTTGGAAAATAAATGCTGAAGGG + Intergenic
1195995507 X:110727747-110727769 CTTGATTAAAACATGATGAAGGG + Intronic
1196034768 X:111132264-111132286 TTTGGGAAATCCATGTTGAAAGG - Intronic
1198838064 X:140825641-140825663 CTGGGTCATTACATGGTGGAAGG + Intergenic
1201480304 Y:14431704-14431726 CTGTGTCCATACATGGTGAAAGG + Intergenic