ID: 1079015944

View in Genome Browser
Species Human (GRCh38)
Location 11:16868771-16868793
Sequence TCTTCTCCTTGGAAGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 269}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079015941_1079015944 -5 Left 1079015941 11:16868753-16868775 CCTTAAAAAGGAGGTGCATCTTC 0: 1
1: 0
2: 1
3: 11
4: 155
Right 1079015944 11:16868771-16868793 TCTTCTCCTTGGAAGCTGGATGG 0: 1
1: 0
2: 0
3: 36
4: 269
1079015938_1079015944 27 Left 1079015938 11:16868721-16868743 CCAGGAGATGGGATCTAGAGGAA 0: 1
1: 0
2: 0
3: 23
4: 197
Right 1079015944 11:16868771-16868793 TCTTCTCCTTGGAAGCTGGATGG 0: 1
1: 0
2: 0
3: 36
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079015944 Original CRISPR TCTTCTCCTTGGAAGCTGGA TGG Intronic
904175826 1:28628081-28628103 GTTTTTCCTGGGAAGCTGGAGGG - Intronic
905025133 1:34844589-34844611 TCTTCCCCTTGGACAGTGGAGGG - Intronic
905743355 1:40391602-40391624 TTTTCCCCTAGGAAGCTGAAGGG - Intronic
905911066 1:41655138-41655160 ACATCTCATTTGAAGCTGGAAGG - Intronic
908105562 1:60838245-60838267 TCTTCACCTTGGAAGTTGCAAGG - Intergenic
909669166 1:78168819-78168841 TCTTCTCCATGGTGTCTGGATGG + Intergenic
912509228 1:110176904-110176926 GCCTCTCCTTGGAACCTGGAGGG - Intronic
912665887 1:111579166-111579188 TCCCCTCCTTGGAGGTTGGAGGG + Intronic
914217283 1:145643611-145643633 TCTGCTATTTGGAAGCTGGGAGG - Intronic
914469852 1:147966296-147966318 TCTGCTATTTGGAAGCTGGGAGG - Intronic
916177222 1:162052547-162052569 TCCTCTCCTTGGTAGCTCCAGGG + Intergenic
919911441 1:202113370-202113392 TTTCATCCTTGGTAGCTGGAGGG - Intergenic
920308182 1:205032212-205032234 AGTTCTCTTTGGAAGCTGCATGG - Intergenic
920437716 1:205958787-205958809 TCCTTTCCTGGGAAGCTGCAGGG - Intergenic
920930643 1:210384606-210384628 GCTTCTCCATGGAAGCAGGGAGG - Intronic
920965141 1:210695028-210695050 GCTTCTCCTTGGAGTCTGGATGG + Intronic
921555262 1:216591180-216591202 TCTTCTCTTTGGAAGTTGATGGG - Intronic
922324899 1:224518778-224518800 TCTTGTCCTTTGGAGCTGTACGG - Intronic
922486123 1:225974622-225974644 TCAACTCCTCGGAAGCTGGGCGG + Intergenic
922495690 1:226055833-226055855 TCCTGTCCTTGGAAACTTGAAGG + Intergenic
922654460 1:227369081-227369103 CCAGCTCCTTGAAAGCTGGAGGG - Intergenic
923526217 1:234774951-234774973 TCTTGTCCTTGGTATTTGGAGGG - Intergenic
924583699 1:245343771-245343793 TCTTCTCCTTTACAGGTGGAAGG - Intronic
924666499 1:246078535-246078557 TCTTGACCTTGAAAGATGGATGG - Intronic
1063522706 10:6755313-6755335 TTTTCTCCTTTGAAACTTGAAGG - Intergenic
1065350376 10:24790350-24790372 ATTTCTCTTTGGAAGTTGGAGGG - Intergenic
1065821005 10:29525646-29525668 TCTTCTAGCTGGAAGTTGGAGGG - Intronic
1066312379 10:34210521-34210543 TCTTCTCCTTGTAAGTAGAAAGG - Intronic
1068438337 10:57019262-57019284 TCGTGTCCTTTGAAGCAGGAAGG - Intergenic
1068689150 10:59898448-59898470 ACTTCATTTTGGAAGCTGGAAGG + Intronic
1069060919 10:63893700-63893722 TCTACTTCTGAGAAGCTGGATGG - Intergenic
1070834853 10:79441861-79441883 ACATCTCCCTGGAGGCTGGAGGG + Intronic
1071502109 10:86211547-86211569 TCTTCTCCAGGGAAGCAGGTGGG - Intronic
1071804454 10:89102033-89102055 TATACTCCTGGGAATCTGGAAGG - Intergenic
1072163361 10:92788502-92788524 TCTTGGCCATGGAAGTTGGAGGG + Intergenic
1072195628 10:93115438-93115460 TCTTCTCCTAAGACCCTGGAAGG - Intergenic
1073324745 10:102635901-102635923 TCATCTCCTTGTCTGCTGGATGG + Intergenic
1074396943 10:113105729-113105751 TCGTCTGCCTGGAACCTGGACGG - Intronic
1075050112 10:119177326-119177348 CCTTCTCCTAGGAGACTGGAAGG + Intronic
1075754377 10:124799472-124799494 TCTTCTCCCAGGCAGCTGCATGG - Intergenic
1075939120 10:126373395-126373417 TCTTGGCCTTGGCAGCTGCAGGG - Intronic
1078159239 11:8826604-8826626 TCTTATCCTAGGAACATGGAAGG + Intronic
1078850027 11:15155279-15155301 TCTTTTCCTGGGAAACTTGAGGG + Intronic
1078917399 11:15792384-15792406 TCTTCTCCTTGAGCGCTGGGTGG + Intergenic
1079015944 11:16868771-16868793 TCTTCTCCTTGGAAGCTGGATGG + Intronic
1079293583 11:19211069-19211091 TCTGCTCCTTTAAAGTTGGAAGG + Intergenic
1080471850 11:32553408-32553430 TCTTCAGCATGGAAGCTTGAGGG + Intergenic
1081847222 11:46249345-46249367 GCTTCTCTTAGGAAGCTGGAAGG - Intergenic
1082807498 11:57460233-57460255 TCTTCTCCTGGAAAGTTGGGAGG + Intergenic
1083107149 11:60369241-60369263 TCATCTCCATGGGAGCTGTATGG - Intronic
1083148033 11:60773145-60773167 TCGTCTTCTTGGAAGCTGCTAGG - Intronic
1084220621 11:67675408-67675430 TCTGCTCCCTGGAACCTAGAAGG - Intronic
1084243662 11:67840578-67840600 TATTTTCCTTGTAAGTTGGAAGG + Intergenic
1084660420 11:70543397-70543419 TCTCCTCCCTGGAGGCTGGAGGG - Intronic
1084936465 11:72589712-72589734 TCTTCTCGTTGGAGTCTGCAGGG - Intronic
1085426978 11:76413433-76413455 TCCTCTACTTCGAAGCTAGATGG + Intronic
1086251425 11:84819649-84819671 TCTTCTCCTTGGCAGGTCAATGG - Intronic
1087567901 11:99885997-99886019 TCTTTTCCTTGCAAGTTTGATGG - Intronic
1089335470 11:117720076-117720098 ATCTCTCCGTGGAAGCTGGAAGG + Intronic
1091111598 11:132974022-132974044 GCTTCTCCATAGCAGCTGGAGGG - Intronic
1091769595 12:3142337-3142359 TCCTTTCCTTGGAAACTGAATGG + Intronic
1094468975 12:30785020-30785042 TATTTTCCTTGGAAGCAGAAGGG + Intergenic
1096928704 12:55179020-55179042 TCTTCTCCCTGGAAGTTGCAAGG + Intergenic
1097980761 12:65735942-65735964 TCTGCTCCTTGGTAGCTGGGTGG + Intergenic
1097983073 12:65754171-65754193 GCTTCCCCTTGAAAGCTGGTTGG + Intergenic
1098848368 12:75565689-75565711 CCTTTTCCCTGGAAACTGGAAGG - Intergenic
1099501609 12:83420210-83420232 TCTTTTCCTTGAAAGTTGCAGGG - Intergenic
1100797844 12:98201326-98201348 TCTTCTCCTTTGCTGCTGGATGG + Intergenic
1101295193 12:103415913-103415935 TTTTCTTCTTGGAAACAGGAGGG - Intronic
1101909068 12:108849215-108849237 TCTTCTAGTTGGGAGCTGCAGGG - Intronic
1102213351 12:111143219-111143241 GCAGCTCCTTGGAAGCTGGAAGG - Intronic
1102260873 12:111442627-111442649 CCTCCTCCTGGGACGCTGGAGGG - Intronic
1104084870 12:125465136-125465158 TCTGCTACTAGGTAGCTGGATGG + Intronic
1104902992 12:132199131-132199153 TCGTCCCCTTGGGAGCTGCATGG + Intronic
1105283130 13:18981333-18981355 ACTCTTACTTGGAAGCTGGAAGG - Intergenic
1105823886 13:24105017-24105039 TCTTCTCCCTGGAAGCAGGCAGG - Intronic
1106102442 13:26706661-26706683 TCTCCTGCTTGGAAGCTGACTGG - Intergenic
1106614275 13:31312034-31312056 TCTTTTCCTTGCAAGATTGAGGG - Intronic
1107885346 13:44870493-44870515 TCTTCTCTTTGGGGGCTGCAAGG + Intergenic
1109992404 13:70075215-70075237 GATTCTCTTTGGAAGCTGGATGG + Intronic
1110163042 13:72402328-72402350 TATTCTCATTGGAGGCTTGATGG - Intergenic
1112632881 13:101181145-101181167 TCTTCTCCTTGGCATCTGCGTGG - Intronic
1112816057 13:103274871-103274893 TCTTTCCCTTTGGAGCTGGAAGG + Intergenic
1113768143 13:112893777-112893799 CTTTCTCCTGGGAAGCTGCAGGG + Intergenic
1113900119 13:113792060-113792082 TCTTCCTCTGGGAAGGTGGAGGG + Intronic
1114459586 14:22877916-22877938 TCCTCCCCTTGGGGGCTGGAGGG - Exonic
1114498096 14:23147878-23147900 TCTCCTGCTTGGCAGCTGGGAGG - Intronic
1114772554 14:25444821-25444843 TCCTCTCCCTGGAAATTGGAGGG - Intergenic
1115060191 14:29178356-29178378 TCTGCTCATTTGAAACTGGAAGG + Intergenic
1115919863 14:38360505-38360527 TCCCCTCCCTGGAGGCTGGATGG + Intergenic
1115960836 14:38835361-38835383 TCTGTTCCTTGGAAGCGTGAGGG - Intergenic
1116204477 14:41845552-41845574 ACATCTCCTTGGAAACTGCAAGG + Intronic
1118162267 14:63302138-63302160 CCTTTTCTTTGGAAGCTGGGAGG + Intergenic
1119140055 14:72258925-72258947 TTTTCTCCTTGGCTGCTAGAGGG - Intronic
1119959671 14:78840650-78840672 TCGTCACCCTGGAAGCAGGAAGG + Intronic
1120570648 14:86112593-86112615 TCTTTTCCTTGGAAGGGGGCTGG - Intergenic
1121385819 14:93523780-93523802 TCTTATCCTAGGAAAATGGATGG + Intronic
1121552457 14:94812946-94812968 TCATGCCCTTGGATGCTGGATGG + Intergenic
1121563012 14:94888048-94888070 ACTTGTCCTTGGAAGGAGGAGGG - Intergenic
1121704463 14:95981383-95981405 TCTGCTCCTTCTCAGCTGGAAGG - Intergenic
1122490462 14:102111936-102111958 TCTTCTCTCTGGAAGCTTGTAGG + Intronic
1122832236 14:104404200-104404222 TCTGCTCCATGGCAGCAGGAGGG + Intergenic
1123041870 14:105493570-105493592 GCTGCTGCTTGGAAGCTGGGCGG + Intronic
1125411732 15:39413129-39413151 TCTTCTCCTTGAAAGCTTCCTGG + Intergenic
1125671863 15:41479484-41479506 TCTCCTCCTGTGAAGCTGGCAGG - Intronic
1126850520 15:52794377-52794399 TCTTCTCTTTGGGATATGGAAGG - Intergenic
1129668265 15:77591897-77591919 TCTTCTCCTGGGAAGCTGAGTGG + Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130192322 15:81749194-81749216 CCGTCTCATTGGAAGATGGATGG - Intergenic
1130996715 15:88908213-88908235 TTCTCTGCTTGGCAGCTGGAAGG - Intronic
1131013416 15:89038294-89038316 TCTTCTGCGGGGAAGCTGGAAGG - Intergenic
1131108871 15:89751739-89751761 ACTTCTCCTTTGAGGCAGGATGG + Intergenic
1131267238 15:90923772-90923794 CCTTCTTCATGAAAGCTGGATGG - Intergenic
1131395293 15:92080815-92080837 TATTCACCCTGGAAGGTGGAGGG - Intronic
1132219423 15:100094210-100094232 TCTGTGCCTTGGCAGCTGGAAGG + Intronic
1132250815 15:100334486-100334508 TTTTCTTCTTGGAAGCTGGTTGG - Intronic
1133197245 16:4179837-4179859 TCTTCTCCTTGGGACTCGGAGGG - Intergenic
1137438464 16:48478010-48478032 GATTCTCTTTGGAAGCTGGTTGG + Intergenic
1137629432 16:49931772-49931794 TCTGCTCCTTGTTAGCTGGGTGG + Intergenic
1140850559 16:78931325-78931347 TCTTCTCTTTGGAGACTGAAAGG + Intronic
1141741156 16:85894025-85894047 TCATCTCCCTGGTAGCTGTAGGG - Intergenic
1141898193 16:86972018-86972040 TCATCACCTTGGCAGCTGCAGGG + Intergenic
1142048948 16:87945678-87945700 TCTTCTCCCTGGCAGCTGCTGGG + Intergenic
1143345427 17:6245468-6245490 CCTTCCCCTAGGATGCTGGAAGG + Intergenic
1144273306 17:13640861-13640883 GATTCTCTTTGGAAGCTGGATGG - Intergenic
1145047973 17:19634053-19634075 TCCTCTCCTGGGAATCTGGTGGG - Intergenic
1148367378 17:47066299-47066321 ACTTCGCCTTGGAAGATGGGAGG + Intergenic
1149518664 17:57301460-57301482 TATTCTCCTTCTAAGCCGGATGG - Intronic
1149620792 17:58043556-58043578 TCCTCTCCTTGGAAACTGTGGGG + Intergenic
1151246270 17:72797427-72797449 TCATCTTCATGGAAGATGGAAGG - Intronic
1151691798 17:75691091-75691113 TCTGCTGCTGGGAAGCTGGGTGG + Intronic
1152876691 17:82790430-82790452 TCTTGGCCTCGGAAGCAGGAGGG + Intronic
1155273355 18:24162627-24162649 TTTTCTTCTTGGAAGATGGAAGG + Exonic
1156001561 18:32390659-32390681 TCTTCCCAATGGAAGCTGGATGG + Intronic
1156347121 18:36267708-36267730 TCTTCTCCTGGCAACCTGCATGG - Intronic
1157198100 18:45636412-45636434 TCTTTTCCTTGGAAGGAGAATGG - Intronic
1157203920 18:45682566-45682588 TCTTATCCTGGGGATCTGGACGG - Exonic
1157833437 18:50878425-50878447 TCTTGTCCTTGAAAGCCGCAGGG - Intergenic
1158742740 18:60162532-60162554 TCTTCTCCATGGCAGCTGAGAGG + Intergenic
1159609133 18:70507214-70507236 TCTTCTCCATGGGACTTGGAAGG + Intergenic
1160354915 18:78219009-78219031 TTCTCTCCTGGGATGCTGGAGGG - Intergenic
1161888905 19:7019462-7019484 CCTTCTCCTTGGCTGCTGCAGGG + Intergenic
1161890463 19:7032559-7032581 CCTTCTCCTTGGCTGCTGCAGGG - Exonic
1161890985 19:7038174-7038196 CCTTCTCCTTGGCTGCTGCAGGG + Exonic
1161892549 19:7051287-7051309 CCTTCTCCTTGGCTGCTGCAGGG - Exonic
1161893070 19:7056635-7056657 CCTTCTCCTTGGCTGCTGCAGGG + Exonic
1161987150 19:7662157-7662179 TCCTCTCCTTGGGAGATGGAAGG + Intergenic
1162584640 19:11551524-11551546 TCTCCTCCTTGGAATCCTGATGG - Intronic
1164406946 19:27957580-27957602 CCTCCTCCTTTGATGCTGGAAGG - Intergenic
1167707601 19:51090768-51090790 TCCTATCTTTGGAAGCTGGGGGG + Intergenic
925044730 2:764215-764237 TCAGCTCCTTGGAAGCTGAATGG + Intergenic
926108861 2:10169615-10169637 GCTGCTCCTTGGAAGCTGGCAGG + Intronic
927659609 2:24981777-24981799 TCCTCTCCTTTGAATCTGGGTGG + Intergenic
927706293 2:25298482-25298504 TCTTGTCCTCAGAAACTGGACGG + Intronic
928372728 2:30752776-30752798 TCTCCTCCCAGGAAGCGGGAGGG + Intronic
930983320 2:57554557-57554579 TCTTTTGCTGGGAAGATGGAAGG - Intergenic
931126517 2:59284171-59284193 TCTCCTCCTTGGCTGCTTGATGG + Intergenic
932341357 2:70964532-70964554 TCTTCTCCTTACCAGCTGGTTGG - Exonic
934156681 2:89207544-89207566 TGTTCTCCCTGTGAGCTGGAGGG + Intergenic
934210635 2:89975207-89975229 TGTTCTCCCTGTGAGCTGGAGGG - Intergenic
934734882 2:96685129-96685151 TCTTCTGTTGGGAAGCAGGAAGG + Intergenic
934972409 2:98774030-98774052 TCATCTCCTTGGAAGGGAGACGG + Intergenic
936520819 2:113211103-113211125 TTTTCCCCTTGGGAGCTGGGAGG + Intergenic
936697479 2:114967328-114967350 TCTGCTCTGTGGAAGCAGGAAGG + Intronic
937031937 2:118747928-118747950 CCTTCTCCCTGGAAGCAGGTGGG + Intergenic
937309833 2:120895187-120895209 TTCTCTCCTTGGAAACTGGGAGG + Intronic
937707157 2:124934378-124934400 TCTTCTCCTAAGGAGCTGGGAGG + Intergenic
939055517 2:137360414-137360436 TCTTCCCCTGGGAAGCAGGAGGG + Intronic
942111636 2:172688445-172688467 TGTTCTCCTTGCCAGCTGGGTGG + Intergenic
944661175 2:201923243-201923265 GATTCTCCTGGGAGGCTGGATGG - Intergenic
949000182 2:241608881-241608903 TCTTCTCCAGGGTAGCTGCAGGG - Intronic
1169029126 20:2394648-2394670 TCTTCTCGTCTGCAGCTGGAGGG + Intronic
1169531506 20:6489990-6490012 TCTTATCCCTGGGATCTGGAAGG - Intergenic
1169906377 20:10608820-10608842 TTTTCTCCTTTCAAGCAGGAAGG - Intronic
1170351669 20:15448095-15448117 CCTTCTGCTTGGAAGGTAGAAGG + Intronic
1172241360 20:33414750-33414772 TCTTCTTCGTGGAGGCAGGATGG - Intronic
1173102461 20:40099500-40099522 TATTTTCCTTGGAAGCTAGTAGG + Intergenic
1173103894 20:40113229-40113251 GCTTCTCCTGGGCAGCTGAAGGG + Intergenic
1173296804 20:41766909-41766931 TCTTATCTTTGGAACCTAGAGGG + Intergenic
1173331716 20:42080755-42080777 TCTTCTCCTTGGAGTCAGGCAGG + Exonic
1174687285 20:52468116-52468138 TCCTCTCCTTGGAGGCTGAGAGG + Intergenic
1178137645 21:29645984-29646006 TCTTCTCTTTGGAATGTGCAAGG - Intronic
1180233975 21:46445621-46445643 TATCCTCCTTGGAGGCAGGAAGG - Exonic
1180944774 22:19686224-19686246 TCTTCTCTTTGGATCCTGGAAGG - Intergenic
1181011728 22:20044765-20044787 TGATGTCCTTGGAAGGTGGAAGG + Intronic
1181492358 22:23268566-23268588 TGTTCTCCTCGGGAGGTGGAGGG - Intronic
1182008271 22:26979428-26979450 CTTCCTACTTGGAAGCTGGAAGG + Intergenic
1182379946 22:29879912-29879934 CCTTCTCATTGGAAGCTAGGTGG + Intergenic
1182733246 22:32512159-32512181 TATGCTCCTGGGAACCTGGATGG + Intergenic
1183434029 22:37783061-37783083 TCTTCTCATTGGAGGCTGCCTGG + Intergenic
1183703651 22:39463799-39463821 TCATCTACTTGGAAGGTTGAGGG + Intronic
1184159449 22:42689203-42689225 TTCTCTCCTTGGAAGTTGGTGGG - Intergenic
1184234098 22:43173918-43173940 ACTTCTCCTTGGGAGCTGAGGGG + Intronic
950088915 3:10280975-10280997 GCTTTTCCTTGGCAGGTGGATGG - Exonic
951871779 3:27369585-27369607 TCTTCTGCTTGCAAGCTTGGTGG - Intergenic
951881236 3:27483620-27483642 TCTTCTCCTTCTAAGGAGGACGG - Intronic
951984839 3:28607545-28607567 TCTTCTCTTTGGAAGCTTTTAGG - Intergenic
952690125 3:36195702-36195724 TTTTTTCCTTGGCAGCTGTAAGG + Intergenic
955212831 3:56958180-56958202 TGTTTTCTTTGGAACCTGGAGGG - Intronic
955419048 3:58718829-58718851 TCTTCTCCCTGCAAGCCAGAAGG + Intronic
956716918 3:72087315-72087337 ACTTCTCCTTGGGAGCTGCCTGG - Intergenic
957343717 3:78934895-78934917 TCTAGTCCGTGGAAGATGGAAGG - Intronic
958270733 3:91496147-91496169 TCTTTTTCTTGGAATCTGAAGGG + Intergenic
960356010 3:116654465-116654487 TTTTCGCCTGGGAAACTGGAAGG - Intronic
960404391 3:117241116-117241138 TCTTCTCCTAGGAAACTGAATGG - Intergenic
960944883 3:122958951-122958973 TCTTCCCCATTGCAGCTGGAGGG - Intronic
962677999 3:137770461-137770483 TGTTCTCTTCGGAAGCGGGAAGG + Intergenic
964164849 3:153690728-153690750 TCCTCTCCATGGAAGCAGAAAGG - Intergenic
967521794 3:190440615-190440637 TTTTCTCCTTAGAAATTGGAGGG + Intronic
971297676 4:25412371-25412393 TCTCTTCCTTGGAGGCTGGCGGG + Intronic
973176063 4:47206342-47206364 TTCTCTACATGGAAGCTGGATGG + Intronic
973176748 4:47215146-47215168 TCTTCTTCATGGCTGCTGGATGG + Intronic
973646540 4:52956255-52956277 CCTTCCCCTTGGAGCCTGGAAGG + Intronic
973940622 4:55906403-55906425 TACTCCCCTTGGAAGCTGGAAGG + Intergenic
976177592 4:82370832-82370854 ACTTCTCTTTGGAGGCTGGTAGG - Intronic
978815778 4:112903164-112903186 GTTTCTCATTGGAAGGTGGAGGG + Intronic
980637708 4:135530132-135530154 CCTTCTCCTGGGAAGATGCATGG + Intergenic
981245530 4:142532580-142532602 CCTTCTCTTTTGAAGCTTGAAGG - Intronic
981496226 4:145396817-145396839 GATTCTCTTTGGAAGCTGAATGG - Intergenic
983287027 4:165752631-165752653 TTTTCTCCATGGAAGTTGCAGGG + Intergenic
984758558 4:183344980-183345002 CCTCCTCCTTGGAAGCAGGATGG - Intergenic
986458242 5:7941928-7941950 GCTTCTCCTGGGAGGCTGAATGG - Intergenic
987166668 5:15205066-15205088 TCTTATCCTGAGAAGCTGGATGG - Intergenic
987205195 5:15618288-15618310 TCTTCTACTTAAAAGCTAGAAGG - Intronic
988524170 5:31971974-31971996 TCTTCTCCCAGGTAGCTGCACGG + Intronic
989784521 5:45311819-45311841 TGGTCGCCTTGGAACCTGGAGGG + Intronic
990567225 5:57041866-57041888 TCCCCTCCTTGGAGGCTGGGTGG + Intergenic
992209110 5:74460127-74460149 TCTGCTGTCTGGAAGCTGGAGGG - Intergenic
992361496 5:76042931-76042953 TCTTCTCCCTTGAACCTAGATGG + Intergenic
992672521 5:79074522-79074544 TCTTTTCCCAGGAGGCTGGAAGG - Intronic
992778061 5:80105402-80105424 TCACCTGCTTGGAAGTTGGAGGG + Intergenic
995420832 5:111964748-111964770 TCTTGTACATGTAAGCTGGAAGG - Intronic
995782451 5:115792821-115792843 CCTTCTCCTTGGAGCCTGGTGGG + Intergenic
996351790 5:122551818-122551840 GCTACTTCTTGGAATCTGGATGG + Intergenic
996458637 5:123715287-123715309 TTTTCTGCCTGGAAGCTTGAAGG - Intergenic
997254025 5:132412991-132413013 TCTGCTCCTTGGAAGTTAGTAGG + Intronic
999127812 5:149259264-149259286 GCTTCTCCTTGAAAGAGGGAAGG - Exonic
999255728 5:150209191-150209213 TCTACCACTTGCAAGCTGGATGG - Intronic
999909360 5:156180803-156180825 GATTCTCTTTGGAAGCTGGGTGG + Intronic
1000217799 5:159180330-159180352 TCAGCTCCTGGGAATCTGGAAGG + Intronic
1000662804 5:163956697-163956719 TCTTCTCCTTGTAACCTGACAGG - Intergenic
1001352522 5:170982824-170982846 TCTTCTCTCTGGAAGCTTTAAGG - Intronic
1001396497 5:171422174-171422196 TGTTCTCCGTGGGAGCTGGAGGG + Intronic
1001407652 5:171487234-171487256 ACTTCCCCTTGGACACTGGAAGG - Intergenic
1001942441 5:175750336-175750358 CCTACTCCTTGGAATCTGGTTGG - Intergenic
1002793567 6:452568-452590 TCATCTCCTGGGATGCTGGCTGG - Intergenic
1003092430 6:3115286-3115308 TCTCCTGCTTGGCAGCGGGAGGG - Intergenic
1003753065 6:9084006-9084028 GATTCTCTTTGGGAGCTGGATGG + Intergenic
1004369367 6:15038795-15038817 TCTTCTGGTTGGCAGCTGGATGG - Intergenic
1005276802 6:24228196-24228218 GCTTCTTTTTGGAATCTGGAAGG + Intronic
1005292263 6:24391381-24391403 GCTTTTCCTTGGTTGCTGGAGGG - Intergenic
1007717705 6:43866791-43866813 TCTTCTCTGTAGCAGCTGGAAGG - Intergenic
1008441565 6:51537928-51537950 TCTTGTCCTTAGAAGCAGAACGG - Intergenic
1008452186 6:51665890-51665912 TCATCTCCCTTGAAGCAGGAAGG + Intronic
1009321967 6:62302768-62302790 TCTTCTCTTTTGAATCAGGAAGG + Intergenic
1011850038 6:91615106-91615128 TCATCTACTCGGAAGCTGTATGG - Intergenic
1012424895 6:99103058-99103080 TTTTCTCCTCAGAAGCTGGGAGG - Intergenic
1013216532 6:108032541-108032563 CATTCTTCTTGGATGCTGGATGG - Intergenic
1015788421 6:136941989-136942011 GTTTCTCTTTGGAAGCTGGATGG + Intergenic
1018372557 6:163181505-163181527 ACTTGTCCTTGGAAGGGGGAGGG - Intronic
1019482164 7:1271957-1271979 TCTTCCCTTTGCACGCTGGACGG + Intergenic
1019611737 7:1940185-1940207 GCTTCTCCTGGGAAGGAGGAGGG + Intronic
1020237560 7:6368117-6368139 TTTTCTCTTTGGAAGCTTGTAGG + Intergenic
1022837739 7:34133231-34133253 TCCCCTCCTTGGAGGCTAGAGGG - Intronic
1022970602 7:35513551-35513573 TCTTCTCCTTGGGAACTTGCTGG + Intergenic
1026828763 7:73599403-73599425 TCTTCTGCTTGGAGATTGGAGGG - Intronic
1026911144 7:74092678-74092700 GCATCTCCTTGGCAGCTGGGTGG + Intronic
1029339075 7:99928595-99928617 TCTTGTCCTTGTTCGCTGGAAGG + Intronic
1029726951 7:102412759-102412781 TCTTCTCCTAAAAAGCAGGAGGG + Intronic
1031304075 7:120102043-120102065 TCTTCTCCCTGGAAGTTAGGTGG + Intergenic
1032509895 7:132464381-132464403 TCTTCTCATTCCAAGCCGGACGG - Intronic
1032524787 7:132571943-132571965 TCTTCTCCTTGGCTGTTGGTAGG - Intronic
1035303901 7:157917332-157917354 TTTTCTCCTTGGAAACTGAAAGG + Intronic
1035796752 8:2364576-2364598 TCTTCTACATGGCAGCAGGAAGG - Intergenic
1036098135 8:5747706-5747728 TCTTCTCTATGGAAGATGGAAGG + Intergenic
1039393886 8:37206348-37206370 TCGTCTCCTTAGAAGGTGAAAGG + Intergenic
1039566265 8:38554368-38554390 CCTTCTCCTTCGGAGCAGGAAGG + Intergenic
1039723068 8:40185622-40185644 TTTTCCCCTTGGAACCAGGATGG - Intergenic
1042359483 8:67866551-67866573 TCATCTCCTTGTAAGATGGCAGG + Intergenic
1044077785 8:87844886-87844908 TCCTCTCCATGGAAGCTAGATGG - Intergenic
1044853859 8:96454616-96454638 TCTCTTCCTTGGAGGGTGGAGGG + Intergenic
1046577405 8:116047947-116047969 GCTTCTCCTTAAAATCTGGAAGG + Intergenic
1048084440 8:131161710-131161732 TCTTCTCCCTGGAATCTGCAAGG + Intergenic
1049549382 8:143249818-143249840 TCTGTTCCTTGGAAGCGTGAGGG - Exonic
1051658761 9:19407571-19407593 TCTTCTACTTGGGTTCTGGAGGG + Intergenic
1051890174 9:21933190-21933212 TTTTTTCTTTTGAAGCTGGATGG + Intronic
1056012141 9:82343357-82343379 TCTTCTCCTGGGATGGAGGAGGG - Intergenic
1057753374 9:97810080-97810102 GCTTTTCCGTGGAGGCTGGAAGG - Intergenic
1058718537 9:107742878-107742900 CCTTCTCCTTGGAGCCTGGTTGG + Intergenic
1058799784 9:108534383-108534405 TCTTCTAATGGGAGGCTGGATGG + Intergenic
1059126331 9:111689891-111689913 TCTTCTCATTGGAAAATGGGAGG + Intronic
1059178445 9:112189278-112189300 TCCTGATCTTGGAAGCTGGAAGG - Intergenic
1060235734 9:121861407-121861429 TCTGCCACTTGGAAGCTGCATGG + Intronic
1062384120 9:136302349-136302371 TCTTGTCCTTGGAAGGGTGAGGG - Intronic
1062552795 9:137097813-137097835 CCTTCTCCCCCGAAGCTGGAGGG + Exonic
1186023014 X:5277751-5277773 TCTTCTTCTTCTAAGCTGAAAGG - Intergenic
1187044845 X:15637100-15637122 TCTTCTCCATAGAAGCAGAATGG + Intronic
1188795918 X:34464715-34464737 TCTTCTCCTTGGTAGTAGTAAGG + Intergenic
1189610155 X:42723686-42723708 TCTTTTCATGGGAAGCTTGATGG + Intergenic
1190509620 X:51162322-51162344 TCATCGCCTTGGCAGTTGGAAGG - Intergenic
1191945547 X:66530948-66530970 TCTCCACCCAGGAAGCTGGAAGG - Intergenic
1195494236 X:105511352-105511374 CCTGCTTCTTGAAAGCTGGAAGG + Intronic
1196678770 X:118448790-118448812 TCTTCTCCCCTGAAGCTGGAGGG + Intronic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1200215330 X:154365709-154365731 TCTTCTTCTTGGAAGGGGGAGGG - Intronic
1200235373 X:154465505-154465527 CCTTCACCTCGGAAGCTGGGAGG - Exonic