ID: 1079017355

View in Genome Browser
Species Human (GRCh38)
Location 11:16880530-16880552
Sequence CAGCATGTTCAGCCTGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 272}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079017353_1079017355 -8 Left 1079017353 11:16880515-16880537 CCACATTGCAGACTCCAGCATGT 0: 1
1: 0
2: 1
3: 16
4: 179
Right 1079017355 11:16880530-16880552 CAGCATGTTCAGCCTGCTCTAGG 0: 1
1: 0
2: 0
3: 12
4: 272
1079017351_1079017355 16 Left 1079017351 11:16880491-16880513 CCAATAGAGTTGTTTTGCCTTTT 0: 1
1: 0
2: 4
3: 56
4: 579
Right 1079017355 11:16880530-16880552 CAGCATGTTCAGCCTGCTCTAGG 0: 1
1: 0
2: 0
3: 12
4: 272
1079017352_1079017355 -1 Left 1079017352 11:16880508-16880530 CCTTTTTCCACATTGCAGACTCC 0: 1
1: 1
2: 3
3: 43
4: 318
Right 1079017355 11:16880530-16880552 CAGCATGTTCAGCCTGCTCTAGG 0: 1
1: 0
2: 0
3: 12
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079017355 Original CRISPR CAGCATGTTCAGCCTGCTCT AGG Intronic
901126115 1:6929994-6930016 CAGCATTTACAGCCTGGTGTAGG - Intronic
901256629 1:7834206-7834228 CACCACGCCCAGCCTGCTCTAGG + Intronic
901623148 1:10605266-10605288 CAGCTGGTGCAGACTGCTCTGGG + Intronic
902590655 1:17472007-17472029 CATCATGGTCAGGCTGGTCTGGG - Intergenic
902744104 1:18461729-18461751 CAGCAGGAGCAGCTTGCTCTTGG + Intergenic
903216730 1:21847572-21847594 CAGCCTGTTGAGGCTGCTATCGG + Intronic
904458987 1:30664266-30664288 CAGCAAGTTCCTTCTGCTCTGGG - Intergenic
904566250 1:31429969-31429991 CAGCATGAGCTGCCTTCTCTCGG - Intronic
907606796 1:55826337-55826359 AGGCATCTTCTGCCTGCTCTTGG - Intergenic
907636149 1:56136298-56136320 GAGCATCTTCAGCCTGCTGGAGG - Intergenic
909874009 1:80779776-80779798 CAGAATGATCAGCCTGGGCTGGG - Intergenic
912397935 1:109362011-109362033 CAGCTTGTTGACACTGCTCTTGG - Intronic
917069196 1:171130768-171130790 CACCATGTCCAGCCTGGTCCTGG - Intergenic
919807507 1:201389077-201389099 CAGCATATTCAGTCTGCTCAGGG - Intronic
920738809 1:208560574-208560596 CAGCATCTTCAGCATGACCTGGG - Intergenic
921364411 1:214360066-214360088 CAGCACATTCACTCTGCTCTGGG + Intronic
921710913 1:218372118-218372140 GAGCTTTTCCAGCCTGCTCTCGG + Intronic
921946429 1:220888931-220888953 CAGCATGTTTAGGGTCCTCTTGG - Intergenic
922118778 1:222641709-222641731 CAGCATGTTCAGACAGTCCTTGG + Intronic
922641367 1:227235173-227235195 CACCATCTGCAGCCTGGTCTGGG + Intronic
923548580 1:234943042-234943064 CAGCAGGTGCAGCCAGTTCTAGG + Intergenic
1064933029 10:20648870-20648892 CAGCAGGTGCAGCCAGTTCTAGG - Intergenic
1065156380 10:22874139-22874161 CAGCAGGTGCAGCCAGTTCTAGG + Intergenic
1067053125 10:43036723-43036745 CAGCGTTTGCAGCCCGCTCTGGG + Intergenic
1067069014 10:43119182-43119204 CAGCATCCCCAGCCTGCACTGGG + Intronic
1067850198 10:49749798-49749820 CAGCACGTTCAGCCTTCCCCTGG + Exonic
1069046882 10:63752409-63752431 CAGCAGGTGCAGCCAGTTCTAGG + Intergenic
1069325348 10:67225576-67225598 CAGCAAGTCTACCCTGCTCTGGG - Intronic
1070942447 10:80359048-80359070 CAGCAGCTGCAACCTGCTCTGGG - Intronic
1071042953 10:81336564-81336586 CAGCATTTTGTCCCTGCTCTAGG + Intergenic
1072725749 10:97812541-97812563 TAGCATGTCCAGCCTTCTGTTGG + Intergenic
1074020914 10:109581739-109581761 CAGTATTTTCAGCCTTCTTTCGG - Intergenic
1074826523 10:117218918-117218940 CAGCAGGTGCAGCCGGTTCTGGG - Intergenic
1077025491 11:438145-438167 CAGCAGGATCAGCCTCCCCTGGG + Intronic
1077143111 11:1033519-1033541 CAGCCGGTTCTCCCTGCTCTCGG + Intronic
1078993846 11:16676526-16676548 CAGAATCTTCAACCTTCTCTGGG + Intronic
1079017355 11:16880530-16880552 CAGCATGTTCAGCCTGCTCTAGG + Intronic
1080486197 11:32709582-32709604 CACCATGCACAGCCTGCTGTTGG + Intronic
1080571364 11:33559838-33559860 CAGCCTCCTCAGCCAGCTCTCGG + Exonic
1081877133 11:46416420-46416442 TAGCCTGCTCAGGCTGCTCTTGG - Intronic
1082809012 11:57467500-57467522 CACCATATTCAGCCGGGTCTAGG + Intronic
1083350748 11:62027186-62027208 CAGCAGGTGCAGCCAGTTCTAGG - Intergenic
1083812276 11:65112546-65112568 CACCATGTTCCACCTGCTCCTGG + Exonic
1084289000 11:68149848-68149870 CAGCATGCCCAGCCTGGACTTGG - Intergenic
1084466959 11:69328952-69328974 CACCATGTCCACCCTGGTCTTGG - Intronic
1084907164 11:72357127-72357149 AAGCATATTCTGGCTGCTCTGGG + Intronic
1085980413 11:81717932-81717954 CAGCAGGTTCTGCCTGGTGTTGG + Intergenic
1087519463 11:99212764-99212786 CAGCATGATCATTCTGCTCATGG - Intronic
1088278703 11:108115870-108115892 CAGCAGGTGCAGCCAGGTCTAGG + Intergenic
1088355069 11:108934381-108934403 CAGCATATTCAACCAGCTCCTGG - Intronic
1090617364 11:128527482-128527504 CAACATGCTCAGCCTGCTTCAGG - Intronic
1091466534 12:689575-689597 CAGCAGGTGCAGCCAGTTCTAGG + Intergenic
1092015090 12:5151938-5151960 CAGCTTTTCCAGCCTGCTTTGGG - Intergenic
1094180196 12:27584411-27584433 CGTCTTGTTCAGCCTGCGCTGGG + Intronic
1095896659 12:47286795-47286817 CAGCAGGTGCAGCCAGTTCTAGG + Intergenic
1101498059 12:105274758-105274780 CAGCATGTCCACCATGCTATGGG + Intronic
1101731260 12:107428399-107428421 GAGCATGTTCAGCCTCACCTGGG + Intronic
1103012160 12:117465879-117465901 CTGCATGCCCAGCCTGCTCTCGG + Exonic
1105112923 13:16648264-16648286 CAGCATTTCAAACCTGCTCTAGG - Intergenic
1105142719 13:17134477-17134499 CAGCATTTCAAACCTGCTCTAGG - Intergenic
1107031202 13:35855646-35855668 CATCTCATTCAGCCTGCTCTGGG - Intronic
1108691965 13:52867231-52867253 CAGGATGTACAGCCTGGTCAGGG - Intergenic
1110321798 13:74168569-74168591 CAGCCTTTTCAGCCAGCACTAGG - Intergenic
1110596053 13:77321870-77321892 CACCATGCTCAGCTTGCTCAGGG - Intronic
1111531339 13:89541396-89541418 TAGCTTGTTAAGCCTGCTCCTGG - Intergenic
1113513987 13:110876878-110876900 CAGCAGGTACAGCCAGTTCTAGG - Intergenic
1113728040 13:112619756-112619778 CAGCAGGTGCAGCCAGTTCTGGG + Intergenic
1114060137 14:19010525-19010547 CTGGATGCTCTGCCTGCTCTAGG - Intergenic
1114060432 14:19012296-19012318 CTGGATGCTCTGCCTGCTCTAGG - Intergenic
1114101822 14:19387682-19387704 CTGGATGCTCTGCCTGCTCTAGG + Intergenic
1114101921 14:19388310-19388332 CTGGATGCTCTGCCTGCTCTAGG + Intergenic
1114102410 14:19391246-19391268 CTGGATGCTCTGCCTGCTCTAGG + Intergenic
1117256306 14:53981376-53981398 CAGCCTGTTCATCCTCCCCTGGG - Intergenic
1118713096 14:68538783-68538805 GAGCAGGATCAGCCTGCCCTGGG + Intronic
1118840498 14:69506408-69506430 CAGCAAGTTCTGGCTGCTCCAGG + Intronic
1119389037 14:74277677-74277699 CACCATGTCCAGCCTGCAGTGGG + Intergenic
1121610274 14:95273920-95273942 CAGCCAGTCCAGCCTGCACTTGG + Intronic
1122105068 14:99446806-99446828 CAGCATCTGCATCCTGCCCTCGG - Intronic
1122719043 14:103712080-103712102 GCCCATGTTCAGCCTGCTCAGGG + Exonic
1123503472 15:20913694-20913716 CAGTATCTTCAGCCTTCCCTTGG - Intergenic
1123560719 15:21487359-21487381 CAGTATCTTCAGCCTTCCCTTGG - Intergenic
1123596958 15:21924655-21924677 CAGTATCTTCAGCCTTCCCTTGG - Intergenic
1127613618 15:60661429-60661451 CAGCTTGATCAGTCTGCCCTGGG - Intronic
1128249887 15:66156562-66156584 CAGCATCTTCTCCCTCCTCTCGG - Intronic
1128464209 15:67895881-67895903 CAGCAGGTGCAGCCAGTTCTAGG + Intergenic
1130229752 15:82087581-82087603 CAGCTTGGTCCCCCTGCTCTGGG + Intergenic
1130286115 15:82556005-82556027 CAGCAAGAGCAGCTTGCTCTTGG + Exonic
1131097631 15:89666296-89666318 CCGCCTGTTCATCCTGCGCTCGG - Intronic
1202969066 15_KI270727v1_random:214523-214545 CAGTATCTTCAGCCTTCCCTTGG - Intergenic
1132499494 16:279040-279062 CAGCAGGTGCAGCCAGTTCTAGG + Intronic
1133269205 16:4602382-4602404 CAGCAGGTTCAGCCTCCTGGTGG - Intergenic
1133657445 16:7879616-7879638 CAGCATTTTCCTCCTGCCCTTGG + Intergenic
1134780508 16:16891025-16891047 CAGCAGGTGCAGCCAGTTCTAGG + Intergenic
1138148623 16:54635084-54635106 CAGCATGTTCAGCATCCCTTAGG - Intergenic
1138511366 16:57510316-57510338 CAGCACTTTCAGCCTTTTCTGGG + Intergenic
1138582677 16:57951910-57951932 CAGCTAGTTCAGGATGCTCTTGG - Intronic
1141021762 16:80503315-80503337 CATCATTATAAGCCTGCTCTAGG + Intergenic
1141725900 16:85788168-85788190 CATCATGTACTGACTGCTCTGGG + Intronic
1141752510 16:85968304-85968326 CTGCATTTCCAGCCAGCTCTCGG + Intergenic
1142569947 17:867168-867190 CAGCATGGTCAGCAAGTTCTCGG + Intronic
1142569977 17:867294-867316 CAGCATGGTCAGCAAGTTCTCGG + Intronic
1142569996 17:867378-867400 CAGCATGGTCAGCAAGTTCTCGG + Intronic
1143015632 17:3889865-3889887 CAGCAGGGTCTGCCTGCTCTGGG - Intronic
1145093945 17:20009055-20009077 CAGCAGCTTCAGCCTCATCTGGG - Intergenic
1145840243 17:27988553-27988575 AGGCATGTTCAGCTTGCTCTTGG + Intergenic
1146590522 17:34124678-34124700 CAGCATGGTCAGGCTCTTCTTGG + Intronic
1148086785 17:44998451-44998473 CAGCATGGGCACACTGCTCTAGG - Intergenic
1148356070 17:46976868-46976890 CAGGAAGTCCAGCCTGATCTGGG - Intronic
1149598376 17:57877266-57877288 CTGGGTGTTCAGCCTGCTGTGGG - Intronic
1149627549 17:58090487-58090509 CAGCATGGTCATCCTGTCCTGGG - Exonic
1151703910 17:75756979-75757001 CGGCACGGTCAGCCGGCTCTCGG - Exonic
1152101569 17:78304730-78304752 CCGGATGTCCAGCCAGCTCTGGG + Intergenic
1152193415 17:78902394-78902416 CACCATGCCCAGCCTGCACTGGG + Intronic
1152311333 17:79551849-79551871 CTTCATGTACAGCCTGCTCATGG + Intergenic
1155071350 18:22319218-22319240 CAGCAAGCTCAGTCAGCTCTAGG - Intergenic
1155495330 18:26436786-26436808 ACGGCTGTTCAGCCTGCTCTGGG - Intergenic
1157117483 18:44875624-44875646 ATGCATGTTCACCCTGCTTTTGG + Intronic
1157539936 18:48493653-48493675 CAGCATGGTGAGCTTCCTCTGGG - Intergenic
1157948030 18:52003003-52003025 CTGGATGATCAGGCTGCTCTTGG - Intergenic
1159946649 18:74448818-74448840 CACCATGCTCAGCCTGATTTTGG - Intronic
1160362660 18:78297090-78297112 CATCATGTTCAGCCTGTGGTGGG + Intergenic
1160604467 18:80039024-80039046 CACCATGTCCAGCCTCATCTGGG - Intronic
1161144573 19:2670178-2670200 CAGCAGGGTCAGCCTCCTCAGGG + Intronic
1162003087 19:7760511-7760533 CACCATGCCCAGCCTGTTCTAGG + Intergenic
1163129031 19:15260562-15260584 CAGCCTGTTTCGCCTGCCCTTGG - Intronic
1163268599 19:16235830-16235852 CAGGAAGTGCTGCCTGCTCTTGG + Intronic
1163604077 19:18264732-18264754 CGCCATGCTCAGCATGCTCTGGG + Exonic
1166863801 19:45824255-45824277 CAGCAGGTGGAGCCTGGTCTGGG - Intronic
1167625785 19:50588196-50588218 CACCATGCCCAGCCTGCTCTTGG - Intergenic
926396860 2:12452381-12452403 AAGCATTTTCATCCTGCTCATGG - Intergenic
926429827 2:12774439-12774461 TTTCATGTTCAGCCTGCTTTCGG - Intergenic
927293904 2:21431308-21431330 CAGCGTGTCCAGCCTTCTGTAGG - Intergenic
928298787 2:30107755-30107777 CAGCATGATCAGCCTCTACTGGG - Intergenic
928389952 2:30901838-30901860 CAGGATGGTGAGACTGCTCTAGG + Intergenic
928437097 2:31261753-31261775 CAGGCTGCTCAGCCAGCTCTCGG - Intronic
929448692 2:42021530-42021552 CAGGATGTGCAGCCTGGCCTCGG - Intergenic
930879202 2:56252515-56252537 CACTATGATCAGGCTGCTCTGGG + Intronic
933861912 2:86477938-86477960 CACCATCTTCAACCTGCACTGGG + Exonic
934552745 2:95272117-95272139 CAGCATCTTCATCCCGCCCTGGG + Intergenic
934950304 2:98571322-98571344 CAGCATCTTCTGACTGCTGTAGG + Intronic
935236994 2:101147849-101147871 TAACAAGTTCAGCCAGCTCTGGG - Intronic
936485376 2:112920947-112920969 CTGCATGTTCGGCCTCCTCAAGG - Intergenic
937067836 2:119031846-119031868 CACTATGTTCAGCCTGCTTTTGG - Intergenic
941749270 2:169118347-169118369 CAGCAGGTGCAGCCAGTTCTAGG - Intergenic
942925270 2:181425116-181425138 GTGCATCTTCAGTCTGCTCTGGG + Intergenic
945396367 2:209323993-209324015 CAGCAGGTGCAGCCAGTTCTAGG - Intergenic
947293009 2:228598363-228598385 CAGCAAGTGCAGCCAGCACTTGG + Intergenic
948651064 2:239444191-239444213 CCCCATCTTCAGCCAGCTCTGGG - Intergenic
948901380 2:240958421-240958443 CAGCCTGTGCCCCCTGCTCTTGG - Intronic
1168974518 20:1954111-1954133 CAGCATCTTCAGCATCCTCTGGG + Intergenic
1171032796 20:21692190-21692212 CCCCATCTTCAGCCTGCTGTGGG - Intergenic
1173433984 20:43016255-43016277 CAGCATGGCCAGCCCACTCTTGG - Intronic
1174036163 20:47669532-47669554 CCCCCAGTTCAGCCTGCTCTAGG + Intronic
1176065227 20:63190865-63190887 CAGCATGTCAAGGCTGCCCTCGG + Intergenic
1176173472 20:63707080-63707102 CAGCGTGTACATCCTGCCCTGGG + Exonic
1176424084 21:6537108-6537130 CACCATGTCCAGCCAGCCCTTGG + Intergenic
1179354315 21:40644429-40644451 CAGCAGGTTCGGCCAGTTCTAGG + Intronic
1179551835 21:42148356-42148378 CAGCAGGTGCAGCCAGTTCTAGG - Intergenic
1179699577 21:43145423-43145445 CACCATGTCCAGCCAGCCCTTGG + Intergenic
1180478618 22:15733137-15733159 CTGGATGCTCTGCCTGCTCTAGG - Intergenic
1180478913 22:15734908-15734930 CTGGATGCTCTGCCTGCTCTAGG - Intergenic
1181161629 22:20963256-20963278 CAGCACTTTTAGCCTGCCCTTGG + Intergenic
1181531190 22:23518414-23518436 CAGCATCTTTAGCCTTCCCTGGG - Intergenic
1183260804 22:36794622-36794644 CAGCCAGCTAAGCCTGCTCTCGG - Intergenic
1183402295 22:37611633-37611655 CAGCATGTGGCGCCTGCCCTGGG - Intronic
1184384185 22:44164923-44164945 CTGCCTGTTCATCCTCCTCTTGG + Intronic
1184825436 22:46947481-46947503 CAGCAGGTTCAGCAGGTTCTAGG - Intronic
1185326764 22:50229499-50229521 GAGCATCAGCAGCCTGCTCTCGG - Exonic
949213503 3:1535866-1535888 CACTGTGTTCAGGCTGCTCTTGG - Intergenic
952166110 3:30751087-30751109 CAGCAGGTGCAGCCAGTTCTAGG + Intronic
953180438 3:40589756-40589778 CAGCATGCTCAGAGGGCTCTTGG - Intergenic
954752329 3:52820649-52820671 CAGCAACTTGAGACTGCTCTTGG + Exonic
955031845 3:55229647-55229669 CAGCATGTTCAGTTTCCTGTTGG - Intergenic
956732068 3:72205408-72205430 GAGCATGTGCACCCTTCTCTAGG - Intergenic
956897181 3:73674423-73674445 CAGCAGCCTCAGCCTTCTCTGGG + Intergenic
957763042 3:84584364-84584386 GAGCATGTTTAGCATGCTCAAGG - Intergenic
957804219 3:85125649-85125671 CACCATGCCCAGCCTACTCTTGG + Intronic
959690558 3:109193073-109193095 CAGCAGGTGCAGCCAGTTCTAGG + Intergenic
959800440 3:110487589-110487611 CAACAAGTTCTGCCTGCCCTGGG + Intergenic
961207461 3:125096439-125096461 CAGCATGTTCCCCCAGCACTTGG + Intronic
961636402 3:128335681-128335703 CAGCCTGTTCTTCCTGTTCTTGG - Intronic
962388531 3:134952831-134952853 CTGCAGGCTCAGTCTGCTCTGGG + Intronic
962597292 3:136959454-136959476 CAGCATGCTTAGCCTGTGCTAGG - Intronic
963513773 3:146281950-146281972 CAGCATTTTTAGTCTGCCCTGGG + Intergenic
963735293 3:149011878-149011900 CAGCATCTCCAGCCGGCCCTGGG - Intronic
964011823 3:151900655-151900677 CAGGATGTTTAGCCTGGGCTGGG + Intergenic
964609301 3:158594191-158594213 CAGGAAGTTCAGCATGCTATGGG + Intronic
965169087 3:165237176-165237198 CACCATGTCCAGCCTCTTCTAGG + Intergenic
967144429 3:186594480-186594502 CTACATTCTCAGCCTGCTCTAGG + Intronic
967428848 3:189358536-189358558 GAGAATTTTCAGCATGCTCTGGG - Intergenic
969585006 4:8086544-8086566 CACCATGTCCAGGCTGGTCTCGG + Intronic
970422201 4:15915803-15915825 CAGCAGGTGCAGCCAGTTCTAGG - Intergenic
972917728 4:43901903-43901925 CACCATGATCAGCCTATTCTTGG - Intergenic
973576687 4:52296821-52296843 CAGCATCTTCAGCATCCTCTGGG - Intergenic
978726615 4:111977221-111977243 CAGCAAGTTTACCCAGCTCTGGG + Intergenic
979144693 4:117229426-117229448 GAGCATGTTAAGCTTGATCTTGG - Intergenic
981108834 4:140912423-140912445 CATCATGTTCTGCCTACTTTGGG - Intronic
981374325 4:143996247-143996269 CAGCAGGTGCAGCCGGTTCTAGG + Exonic
982663774 4:158235871-158235893 CAGGATGCCCACCCTGCTCTGGG + Intronic
982796892 4:159657146-159657168 CAGCATCTTCAGCTTCCCCTAGG - Intergenic
983835407 4:172377797-172377819 CAGCCTGTGCAGCCAGCCCTGGG - Intronic
987372024 5:17202266-17202288 CAGCATCTTCACCTTCCTCTTGG - Intronic
990384904 5:55250962-55250984 CACCACGTTCAGCCTACACTTGG + Intergenic
990525179 5:56618424-56618446 CAGCAGGTGCAGCCAGTTCTAGG - Intergenic
992046303 5:72893682-72893704 CAGCATGTTAAGCCTTGTATAGG + Exonic
992738440 5:79747358-79747380 CTGCATTTTCAGCCTAATCTAGG + Intronic
993250265 5:85512893-85512915 CAGCAAGTCCACCCAGCTCTGGG + Intergenic
996190788 5:120538843-120538865 GAGCATGTGCAGCCTGCTTAGGG + Intronic
996744067 5:126830216-126830238 CAGCAGGTGCAGCCAGCTCCGGG + Intronic
1001409835 5:171503123-171503145 CAGCATGTGCAGCCTCCACCTGG - Intergenic
1002425924 5:179175868-179175890 CAGCCTGCTGAACCTGCTCTGGG - Intronic
1002606026 5:180383205-180383227 CAGCATGTACCGCCTGCTGTGGG - Intergenic
1003057541 6:2835891-2835913 CAGCATGGTCATCCTGCTGCCGG - Exonic
1003841852 6:10128650-10128672 CAGCACCTTCTGCCTCCTCTAGG - Intronic
1005952153 6:30639843-30639865 CACCATGCTCAGCCAGCTGTAGG - Intronic
1006932156 6:37695054-37695076 CAGCTTCTCCAGCCTTCTCTAGG - Intronic
1007004748 6:38350225-38350247 CAGCATTCTCTGCCTGTTCTGGG + Intronic
1007378430 6:41471564-41471586 AAGAATGTCCAGCCTGCACTGGG + Intergenic
1007388696 6:41537130-41537152 CAGCACTTCCGGCCTGCTCTGGG - Intergenic
1008037337 6:46759618-46759640 CAGCATGTTAAGCCTCTACTAGG + Intergenic
1010743361 6:79533491-79533513 TAGCATGTTTAGCCAGCTTTAGG - Intronic
1011499534 6:87972744-87972766 GAGCATGCTCAGCCTGAGCTGGG + Intergenic
1012080102 6:94746950-94746972 CAAAATGTTAAACCTGCTCTTGG + Intergenic
1015666108 6:135630988-135631010 CAGCATGTGCTTCCTGGTCTGGG + Intergenic
1016322927 6:142867038-142867060 CAGTATTTCCAACCTGCTCTGGG + Intronic
1017947398 6:159106801-159106823 CAGCAGGTGCAGCCAGTTCTAGG + Intergenic
1018801154 6:167223213-167223235 CAGCATGTTAAATCTCCTCTCGG - Intergenic
1019144702 6:169969229-169969251 CAGCATGCTCAGCCTTCTCCCGG - Intergenic
1019581939 7:1768882-1768904 CAGCAGGTGCAGCCAGTTCTAGG + Intergenic
1020012504 7:4814456-4814478 CAGCATGTTCAGCGTTTTCCAGG + Intronic
1020177867 7:5897473-5897495 CAGCAGGTGCAGCCAGTTCTAGG + Intergenic
1020248892 7:6451466-6451488 CAGCAGGTGCAGCCAGTTCTGGG - Intronic
1020305047 7:6827501-6827523 CAGCAGGTGCAGCCAGTTCTAGG - Intergenic
1020358519 7:7303170-7303192 CAGCAAGTTCACCAGGCTCTGGG + Intergenic
1020502270 7:8938340-8938362 CAGCAGGTGCAGCCAGTTCTTGG - Intergenic
1021487846 7:21186889-21186911 AAGCAAGTTCAGCCTGCACTTGG - Intergenic
1021697009 7:23285710-23285732 CAGCAGGTGCAGCCAGTTCTAGG + Intergenic
1022738285 7:33096670-33096692 CTGCATGTTCAACATGTTCTAGG + Intronic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1024245218 7:47464518-47464540 AAGTCTGTTCAGCCTGTTCTAGG - Intronic
1024812188 7:53225129-53225151 CATCTTGGTCAGCTTGCTCTAGG + Intergenic
1026339729 7:69424834-69424856 CTGAATGTTCAGGCTGTTCTAGG - Intergenic
1027666360 7:81046337-81046359 CAGCATTGTCACCCTACTCTAGG + Intergenic
1029080977 7:97973588-97973610 CAGCAGGTGCAGCCAGTTCTAGG - Intergenic
1029169360 7:98619809-98619831 CAGCGCGTTCAGGGTGCTCTCGG - Exonic
1029400802 7:100344654-100344676 CAGCTTGTCCAGCCTGGCCTGGG - Intronic
1030314128 7:108097004-108097026 AATAATGTTCAGCCTGTTCTTGG + Intronic
1031923667 7:127619369-127619391 CAGCATCCTCAGACTGGTCTTGG + Intergenic
1031998306 7:128247321-128247343 CAGCATGTCCAGCCAGTACTAGG + Intronic
1032790389 7:135238281-135238303 CAGCTTGGCCAGCATGCTCTGGG + Intronic
1033589404 7:142797268-142797290 CAGCACGGTCAGCCTGCTGCCGG - Intergenic
1034037567 7:147840458-147840480 CAGCATGTCCAGGTAGCTCTAGG + Intronic
1034354920 7:150444295-150444317 CAGCCGGTGCAGCCGGCTCTGGG - Intergenic
1034787420 7:153937772-153937794 CATCATGTTCAGCTTGGTGTTGG + Intronic
1036588937 8:10150108-10150130 CTGCATTTTCAGTCAGCTCTCGG - Intronic
1038487548 8:27947670-27947692 CGCCATGTTCAGGCTGGTCTCGG - Intronic
1042339877 8:67667363-67667385 TGGCCTGCTCAGCCTGCTCTTGG - Intronic
1044598204 8:93978877-93978899 CAGCATGTTCAAATTGCTATGGG + Intergenic
1045057765 8:98384083-98384105 CAGCAGGTGCAGCCAGTTCTAGG + Intergenic
1046039234 8:108882108-108882130 CAGCATTTACAGACTGTTCTGGG - Intergenic
1047529632 8:125663346-125663368 CAGCAAGGTCTGCGTGCTCTAGG + Intergenic
1048933550 8:139336562-139336584 CAGTACGTTCAGCTAGCTCTGGG + Intergenic
1050543710 9:6691814-6691836 CACCACGCTCAGCCTACTCTTGG - Intergenic
1053872540 9:42507522-42507544 CAGCAGGGTCCACCTGCTCTGGG + Intergenic
1056539654 9:87560282-87560304 CACCATGCCCAGCCTGCCCTTGG + Intronic
1056594903 9:87999504-87999526 CAGCAGCTTCAGCCTCCTGTAGG + Intergenic
1057198945 9:93130260-93130282 CAACATGTGCAGCCTGCAGTGGG - Intronic
1057334974 9:94148450-94148472 CAGCTTGTTCAGTATGCGCTGGG + Intergenic
1058438128 9:104982695-104982717 CAGCAGGTGCAGCCAGTTCTAGG + Intergenic
1059091204 9:111360459-111360481 CAGCATATTCAGCCAAGTCTAGG + Intergenic
1060234300 9:121851859-121851881 CAGCATGTCCAGGGAGCTCTCGG - Intronic
1060873673 9:127064004-127064026 CAGCATGGTCAGCCTCCTCCTGG + Intronic
1061796663 9:133089380-133089402 CAGCAGGTGCAGCCAGTTCTAGG + Intergenic
1061832135 9:133303016-133303038 CAGCAGGTGCAGCCAGTTCTAGG + Intergenic
1062273403 9:135719883-135719905 CAGCCTGGTCAGGCCGCTCTGGG - Intronic
1062407760 9:136404994-136405016 CAGCCGGTGCAGCCTGCCCTTGG - Intronic
1062578028 9:137217621-137217643 CAGCAAGGCCTGCCTGCTCTGGG - Intergenic
1062612592 9:137381776-137381798 CTCCATGTGCAGCCGGCTCTAGG + Intronic
1186760948 X:12721093-12721115 CACCATCTTCATCCTGCCCTCGG - Exonic
1186816910 X:13246982-13247004 CAGGATGTGCAGACTGCCCTGGG - Intergenic
1194583443 X:95704804-95704826 CAGCACCTTCAGCCTGGTGTGGG + Intergenic
1195079846 X:101360437-101360459 GAGCATGTTCAGTCTGGTGTGGG + Intronic
1195699138 X:107689265-107689287 AAGCATGTTCAGTATGCTCAGGG + Intergenic
1200143523 X:153913713-153913735 GAGCCTGTACAGCCTGCTGTTGG - Intronic
1202093748 Y:21221882-21221904 CTGCATGCTCTGCATGCTCTTGG + Intergenic