ID: 1079022665

View in Genome Browser
Species Human (GRCh38)
Location 11:16922736-16922758
Sequence CCTCAGTAGCAGCTGTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079022665_1079022672 19 Left 1079022665 11:16922736-16922758 CCCTGCCACAGCTGCTACTGAGG 0: 1
1: 1
2: 1
3: 29
4: 216
Right 1079022672 11:16922778-16922800 ACCAAGTACCTCTTTTAAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 116
1079022665_1079022671 18 Left 1079022665 11:16922736-16922758 CCCTGCCACAGCTGCTACTGAGG 0: 1
1: 1
2: 1
3: 29
4: 216
Right 1079022671 11:16922777-16922799 AACCAAGTACCTCTTTTAAGAGG 0: 1
1: 0
2: 0
3: 16
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079022665 Original CRISPR CCTCAGTAGCAGCTGTGGCA GGG (reversed) Intronic
900085986 1:897337-897359 CAACACTACCAGCTGTGGCAGGG + Intergenic
900354052 1:2251421-2251443 CCTCAGCAGGGGCTGGGGCAGGG - Intronic
901379814 1:8865538-8865560 CCTGTGTAGCAGCTGTTGAAGGG - Intronic
902391056 1:16106762-16106784 CAGCACTACCAGCTGTGGCAGGG + Intergenic
902635664 1:17733529-17733551 CCTCTGTAGCAGTAGTGGAAGGG + Intergenic
905369487 1:37475453-37475475 GTTCAGTAGGAGCTGTGGCGCGG + Exonic
906063318 1:42962342-42962364 CCTAAGTAGCCCCTGTGGCTGGG + Intergenic
907823245 1:57990941-57990963 CCCAAGTAGCAGTTGTGGCCTGG - Intronic
909148100 1:71964186-71964208 ACGCAGAAGCATCTGTGGCATGG - Intronic
910185805 1:84538579-84538601 TCTCAATAGTAGCTGGGGCAAGG - Intergenic
911136511 1:94446258-94446280 CGGCACTACCAGCTGTGGCAGGG - Intronic
911531380 1:99046975-99046997 CCTCAGTAGCTGCAGTGGATTGG + Intergenic
912561899 1:110556885-110556907 CCTCTGTAGAACCTCTGGCAGGG - Intergenic
914846685 1:151287413-151287435 CCTCAGAAGTAGGTGTTGCAGGG - Exonic
917846160 1:179022222-179022244 CCTGGGAAGCAGCTGAGGCAGGG + Intergenic
919380165 1:196849003-196849025 CCACACTTGCAGCTGTGCCATGG - Intronic
919754944 1:201060900-201060922 AGTCAGGAGCAGCTGTGGCCAGG + Intronic
919787424 1:201268702-201268724 CCTCAGCAGCAGCTGCTGCAGGG + Intergenic
919829748 1:201531996-201532018 GCTCAGCAGCAGCTGTGACACGG - Intergenic
920526665 1:206672119-206672141 CCTGAGGAGAAGCGGTGGCAGGG - Intronic
920789699 1:209078126-209078148 CCCCATTAGCAGCTAGGGCATGG - Intergenic
922707547 1:227797226-227797248 CCCAAGTAGCTGCTGTGGCCTGG + Intergenic
924277853 1:242406158-242406180 CCTGAGTAGCAGCTGTCCCTGGG - Intronic
1067036915 10:42927646-42927668 GCTCAGCAGCAGCTCTGCCAGGG - Intergenic
1067519068 10:46981400-46981422 ACTCAGTAGCAGCTGTAGCCAGG - Intronic
1067551970 10:47242614-47242636 CCTCAGGGGCAGCTGAGGGAGGG + Intergenic
1067643177 10:48070434-48070456 ACTCAGTAGCAGCTGTAGCCAGG + Intergenic
1067797113 10:49328597-49328619 CTTCTGTAGAAGCCGTGGCATGG - Intergenic
1068023599 10:51616312-51616334 CCACAGTAGCAGCAGTGGGATGG + Intronic
1072802103 10:98399427-98399449 CCACAGAACCAACTGTGGCAGGG + Intronic
1073481171 10:103786989-103787011 CATCACCAGCAGCTGTGACAGGG + Intronic
1074827119 10:117222723-117222745 CATCAAGAGCAGCTGGGGCAGGG - Intergenic
1074980229 10:118613690-118613712 CGGCACTACCAGCTGTGGCAGGG + Intergenic
1075414104 10:122249751-122249773 CTTCAGGAGCAGCAGTGGCCAGG - Intronic
1076016906 10:127034999-127035021 TCTCAGCAGCAGCTGTTGCCAGG + Intronic
1076320846 10:129580372-129580394 CCACAGTAGAAACTGAGGCATGG + Intronic
1077243003 11:1521017-1521039 CGTCAGAAGCAGCTGGGGCCAGG + Intergenic
1079022665 11:16922736-16922758 CCTCAGTAGCAGCTGTGGCAGGG - Intronic
1080928573 11:36784128-36784150 CCTCAGAAACAGCTGTGAAAGGG - Intergenic
1081036733 11:38157045-38157067 CATCAATAGCTGCTGTGGCTTGG + Intergenic
1083784085 11:64933942-64933964 CCTCAGAAGCCACTCTGGCAAGG - Exonic
1084548029 11:69824054-69824076 CGTCAGCAGCAGCTCAGGCAGGG + Intergenic
1085019520 11:73196713-73196735 CCTCTGGAGCAGCTGGGGGAAGG - Intergenic
1085524366 11:77155736-77155758 CCTCCTTAGGAGCTGGGGCAGGG - Intronic
1085541964 11:77279439-77279461 AATCAGTAGCATCTGTGTCAAGG + Intronic
1088842368 11:113637836-113637858 CCTCAGTGACAGCTTTGGCGTGG + Intergenic
1089743109 11:120598655-120598677 CCTCAGTATCAGCTGTGGCAAGG + Intronic
1090516856 11:127437908-127437930 CCTCATTAGCAGAGGTGGAAGGG - Intergenic
1090740446 11:129654740-129654762 CTCCTGTAGCAGCAGTGGCAGGG - Intergenic
1092744381 12:11659867-11659889 CCTCACTTGCAGGTGTGGCCTGG + Intronic
1093072780 12:14724106-14724128 CCTCTGTACCTGCTGTGGGATGG + Intergenic
1096491522 12:52015401-52015423 CCACAGTGGGAGCTGGGGCAGGG + Exonic
1096521722 12:52188281-52188303 ATACAGTAGCAGCTGTAGCAGGG + Intronic
1101524187 12:105512850-105512872 CCTCAGCTCCATCTGTGGCAAGG + Intergenic
1101902795 12:108803498-108803520 CCTCAGGACCAGGGGTGGCAGGG + Intronic
1102012184 12:109625613-109625635 CCTCAGGGGCAGCAGTGGCAGGG + Intergenic
1102297694 12:111749577-111749599 GCTCTGTAGCAGCAGAGGCAAGG + Intronic
1102474602 12:113180549-113180571 AATCAGTAGCAGCTGGAGCAAGG - Intronic
1102875280 12:116444155-116444177 CCTCCACAGCAGCTGTTGCAGGG + Intergenic
1103233624 12:119353102-119353124 CCTCAGATGCAGCTGTCTCAGGG + Intronic
1103422494 12:120798883-120798905 GCTCCGTAGCAGCTGTGCCTAGG - Intronic
1103845655 12:123900468-123900490 CCTCAGTACAAACTGTGGCCTGG - Intronic
1106131789 13:26946882-26946904 GCTCAGAGGAAGCTGTGGCAGGG - Intergenic
1106306381 13:28514905-28514927 CTTCAGAAGCAGATGTGGCAGGG - Intergenic
1107592072 13:41919443-41919465 ACACAGTAGCAGCTCAGGCAGGG - Intronic
1108747346 13:53409048-53409070 CCACTGCAGCATCTGTGGCAAGG - Intergenic
1109016361 13:57020492-57020514 CATCCCTGGCAGCTGTGGCATGG + Intergenic
1112796554 13:103063078-103063100 CCTAAGTTGCAGCTGTGCCATGG - Intronic
1113573927 13:111381642-111381664 CTACAGTAGAAGCTGGGGCAGGG + Intergenic
1115490033 14:33950356-33950378 CCGCGGGAGCAGCTGCGGCAGGG + Intronic
1119154216 14:72393600-72393622 TCTCAATAGCAGATATGGCAGGG - Intronic
1120939497 14:89933767-89933789 CCTCATTACAAACTGTGGCATGG + Intronic
1121669987 14:95701675-95701697 CAACAGTAGCAGGTGTTGCAGGG + Intergenic
1122548754 14:102538968-102538990 CCCCAATAGCAGCTGGGGCCAGG - Intergenic
1122744524 14:103890023-103890045 CCTCAGACGCAGCACTGGCAGGG + Intergenic
1123773037 15:23548307-23548329 CCCAAATAGCAGCTGTGCCAGGG - Intergenic
1126387811 15:48111909-48111931 CCTCAGTTGCTGCTGTTGCATGG - Intergenic
1128091999 15:64925589-64925611 CTTCATTAGCAGCTGTATCAAGG + Intronic
1131243815 15:90772727-90772749 CCCCAGTAACAGCTGTTACAAGG + Intronic
1131596004 15:93798889-93798911 TCTCAGGAGCAGCTGTAGGAAGG + Intergenic
1132263907 15:100449356-100449378 CCTAGGCAGAAGCTGTGGCATGG - Intronic
1133125009 16:3641094-3641116 CCACAGCTGCAGCTGTGGCAGGG + Intronic
1133247145 16:4456364-4456386 CCTGACTAGCAACAGTGGCAGGG - Exonic
1133269370 16:4602928-4602950 CCTAGGCAGCAGCTGTGGCTTGG + Intergenic
1136566989 16:31076549-31076571 CCCCTGTACCACCTGTGGCAAGG + Exonic
1138589901 16:57994005-57994027 CCTGAGTTGCAGCTGGGCCACGG + Intergenic
1139383481 16:66549425-66549447 CCTCAGAACCACCTGTGGGACGG - Intronic
1139773988 16:69302072-69302094 CCTTTGTGGCAGCAGTGGCATGG + Exonic
1143862964 17:9904717-9904739 CCTCTGCAGCAGCTGCAGCAGGG + Intronic
1147307564 17:39574237-39574259 TCTCAGTAGAAGCAGGGGCAGGG + Intergenic
1147496014 17:40916497-40916519 CCTCAGTTACAGCTGTTGCCTGG + Intergenic
1148957923 17:51369441-51369463 CCTCAGTAGTGGCCGTAGCATGG - Intergenic
1149389000 17:56171020-56171042 TCTCAGGACCAGGTGTGGCAGGG + Intronic
1150121836 17:62610019-62610041 TCTGGGTGGCAGCTGTGGCATGG - Intronic
1151053904 17:71010305-71010327 ACTGAGTAGCAGTTGTGGCATGG + Intergenic
1151395469 17:73819962-73819984 CCTGAGTTACAGCTGTGGCTTGG + Intergenic
1151961964 17:77410235-77410257 ACCCAGTAGCAGCAGTGGGATGG - Intronic
1152037425 17:77881747-77881769 GCTCAGCAGCAGCTGCGGCCAGG + Intergenic
1153016222 18:584702-584724 CGACAGCAGCTGCTGTGGCAGGG - Intergenic
1153795756 18:8620533-8620555 TCTGAGTAGCAGGTGTGGAATGG - Intronic
1153947640 18:10031509-10031531 GCGGAGTAGCAGCTGTGGGAAGG + Intergenic
1156527295 18:37778767-37778789 CGTCGGGAGCTGCTGTGGCAGGG + Intergenic
1157118240 18:44882641-44882663 CCTCAGCAACAGCTGGGGGAAGG - Intronic
1158481631 18:57826529-57826551 CCTCAGCAGTTGCTGTCGCATGG - Intergenic
1159623746 18:70669083-70669105 CCCAAGTTGCAGCTGTGGCTTGG + Intergenic
1159899015 18:74025006-74025028 TATCTGTAGCATCTGTGGCATGG - Intergenic
1159908459 18:74119869-74119891 TCTGAGGAGCAGCTGTGGCTGGG + Intronic
1160879167 19:1311712-1311734 CCTCAGGAGCAGCCCAGGCACGG - Intergenic
1161220972 19:3117994-3118016 CCGCACCAGCAGCTGTGGCCAGG - Intronic
1161240330 19:3219563-3219585 CCTCAGTAACATCCATGGCACGG + Intergenic
1161446106 19:4320164-4320186 CCTCAGCAGTAGCTGAGGCCTGG + Intronic
1162283127 19:9716488-9716510 CAGCACTACCAGCTGTGGCAGGG + Intergenic
1164438648 19:28254356-28254378 CCTCAAAAGCAGCTGTTCCATGG - Intergenic
1165950984 19:39473799-39473821 CCACAGTGTCAGCTGTGGAAGGG + Intronic
925365361 2:3307580-3307602 CCTCAGGAGCAGCCCGGGCACGG + Intronic
925689521 2:6506774-6506796 ACTCAGTAGCTGGTGTGGCAGGG - Intergenic
926767883 2:16338221-16338243 CCTGGGCAGCAGGTGTGGCATGG - Intergenic
928490521 2:31778352-31778374 TCACAGTGGCAGCAGTGGCATGG - Intergenic
929714772 2:44298766-44298788 TCTCAGGAGCAGGTGAGGCAGGG + Intronic
929948332 2:46387477-46387499 CCTCAGTTTCAGCTGTAGAATGG - Intergenic
930186995 2:48420448-48420470 CTTCAGAAGCCTCTGTGGCAGGG - Intergenic
932417604 2:71583321-71583343 CCTGAAGAGCACCTGTGGCAGGG - Intronic
934096826 2:88614526-88614548 CCACAGGAGCAGCTGAAGCAAGG - Intronic
935695824 2:105769733-105769755 CCACAGGAGCCACTGTGGCAGGG + Intronic
936279945 2:111130049-111130071 CCTGAGTTCCAGCTGTGCCAGGG - Intronic
937428103 2:121816514-121816536 CCTCTGTGGCAGGTGGGGCAGGG + Intergenic
938083045 2:128380441-128380463 CCTCAGGAGCCGCTGCAGCACGG - Intergenic
938607687 2:132912781-132912803 CCTCAATAGAAGAAGTGGCATGG - Intronic
938619129 2:133031246-133031268 CCCCAGCAGCAGCAGAGGCATGG + Intronic
942233030 2:173877425-173877447 CCTCAGAATCAACTGTGGTATGG - Intergenic
945249181 2:207749115-207749137 CTTCAGGAGCAGTGGTGGCAGGG + Intronic
947756611 2:232570623-232570645 TCTCAGTAGCAGCTGTTCCTTGG - Intronic
948032604 2:234831383-234831405 CACCAGGAGCAGCTGTGGCAAGG + Intergenic
948454421 2:238098164-238098186 CCTCAGCAGCAGCTGCAGCTCGG + Intronic
948703620 2:239776266-239776288 CCACAGTAGCAGAGGTGGCAGGG + Intronic
948724894 2:239928668-239928690 CCTCTGGAGCAGGTGAGGCAGGG - Intronic
948729038 2:239951980-239952002 CCTCGGTAGGTGCTGTGGCATGG + Intronic
1168867884 20:1104816-1104838 CCTTTGTAGCAGCAGTGCCAAGG - Intergenic
1170172451 20:13430453-13430475 CCTCAGAAGCAGCTGTTGGGAGG + Intronic
1170321490 20:15104138-15104160 CCAGAGTAGCAGATGTGACAAGG + Intronic
1170497915 20:16944804-16944826 CCTCAGCAGCTGCTGTGGGGGGG - Intergenic
1170706648 20:18749751-18749773 CCTCAGTGTCCTCTGTGGCAGGG - Intronic
1170892838 20:20390812-20390834 TCTCAGTAGCAGCTTTGGTCTGG - Intronic
1172281504 20:33711061-33711083 CCCCAGTAGCAGCTATAGGAGGG + Intronic
1173710770 20:45153695-45153717 CCTCAGGATCTGCTGTGGGATGG - Intergenic
1174196555 20:48776418-48776440 CCTGCTTAGCAGCTGTGGGAGGG + Intronic
1175169452 20:57070009-57070031 TCACAGTAGCTGCTGTGGCAGGG + Intergenic
1175274242 20:57756712-57756734 CCCCAGTTACAGCAGTGGCAGGG + Intergenic
1175750711 20:61495341-61495363 CCCCAGGAGGAGCTGTGGGAGGG + Intronic
1176088393 20:63308294-63308316 CCACATTAGCAGCTCTGGCTGGG + Intronic
1176258164 20:64164484-64164506 TCTCATTAGCAGCGGTGGCACGG - Exonic
1178931438 21:36822031-36822053 GCTCATTAGCAGCTGTGGGAGGG - Intronic
1179715747 21:43287197-43287219 CATCAGCGGCAGCTGTTGCAGGG - Intergenic
1179983181 21:44907030-44907052 CCTCATGAGCAGCTGTGGCCGGG + Exonic
1181409159 22:22705904-22705926 CCACAGGGGCAGCTGTAGCATGG + Intergenic
1181443324 22:22949826-22949848 CCTCTGTAACAGCTGCAGCAGGG - Intergenic
1182505631 22:30780322-30780344 ACTCCTCAGCAGCTGTGGCATGG - Intronic
1182681088 22:32080475-32080497 CCTCAGGAGCAGCAATGGGATGG + Intronic
950388228 3:12676377-12676399 CCTCAGCATCAGGTGTAGCAGGG + Intergenic
952284767 3:31957384-31957406 CCACAGTGGCAGCTGAGGCAAGG + Intronic
952334247 3:32391593-32391615 GCTCAGTACCAGCTGTGGTCCGG + Intergenic
953533432 3:43758476-43758498 CTTCAGTAGCAGCTGTGGAAGGG + Intergenic
954583854 3:51718129-51718151 TCCCAGGAGCAGCTGTGTCAGGG - Exonic
959626750 3:108461196-108461218 CCTGAGTAGCAACTGTGCGATGG + Intronic
959778420 3:110199371-110199393 TGTCAGTTGCAGCTGTGGTAGGG - Intergenic
961907764 3:130280297-130280319 CCCCATAAGCAGCTGTGGGATGG - Intergenic
962885287 3:139619523-139619545 CCTCAGGAGAAGCTTTGGCATGG - Intronic
963034368 3:141012792-141012814 CATGAGTAGAAGTTGTGGCATGG - Intergenic
964789338 3:160437230-160437252 CCTCTGGAGCAGCTGGGACAAGG - Exonic
965715567 3:171598928-171598950 CCTCCGTAGCAGGGGTGACAAGG - Intergenic
967606375 3:191451823-191451845 CCTCAGGATCTGCTGTGGAATGG + Intergenic
968035015 3:195541094-195541116 CTTCTGTAGTATCTGTGGCAGGG - Intronic
968620343 4:1601085-1601107 CCACTGTGGCAGCTGGGGCAGGG - Intergenic
968756879 4:2420962-2420984 CCTCCCTGGCAGCTGGGGCATGG - Intronic
969023802 4:4157857-4157879 CATCAGTGGAAGCTGTAGCACGG - Intergenic
969487641 4:7481185-7481207 CCTGAGTGGCAGGTGTGGCAAGG + Intronic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
975770121 4:77711476-77711498 CCTCAGAACCAGCTGCAGCAAGG + Intergenic
978138233 4:105289326-105289348 CCTAGATAGCTGCTGTGGCATGG + Intergenic
980755056 4:137147785-137147807 TTTCAGGTGCAGCTGTGGCAGGG - Intergenic
980825204 4:138064074-138064096 CCTGGGCAGCAGATGTGGCATGG - Intergenic
982405018 4:155009698-155009720 CCTCATTTGCAGCTATGGCATGG + Intergenic
982532066 4:156557964-156557986 CCTGCGCAGCAGGTGTGGCATGG + Intergenic
984418141 4:179486776-179486798 ACTCAGTAGCAGCTTTAGCCAGG + Intergenic
984808977 4:183777144-183777166 CATCAGTCCCAGCTGTGGCTAGG + Intergenic
985630465 5:1011368-1011390 CGTCAGTAGGATCTGTCGCAGGG - Intronic
985758211 5:1731624-1731646 TCTCACTGGCAGCTGTGCCATGG - Intergenic
988001068 5:25349030-25349052 TCTCAGAAGCAACTGTTGCAAGG + Intergenic
989157198 5:38355446-38355468 TTTCAGCAGCAGCTGTGGCATGG - Intronic
989389656 5:40886807-40886829 TTTCAGTCTCAGCTGTGGCAGGG - Intergenic
991677833 5:69106220-69106242 CCACAGTAGCAGCTGCAGCTTGG + Intronic
994722172 5:103392902-103392924 TCACGATAGCAGCTGTGGCATGG - Intergenic
998012432 5:138705952-138705974 GCTCTGTAGCAGCTGAGCCACGG + Intronic
998587559 5:143443408-143443430 CCTCCTCAGCTGCTGTGGCAGGG + Intergenic
999087986 5:148910537-148910559 CCATAGTAGAAGCTGTGGAAAGG + Intergenic
999462689 5:151771029-151771051 CCTTTGTGGCAGCTGAGGCACGG - Intronic
1000396468 5:160779834-160779856 GCTCAGTAAAAGCTGTGGTATGG + Intronic
1001255707 5:170182062-170182084 CCACAGCAGCAGCTGTGAGATGG - Intergenic
1006349618 6:33511691-33511713 CCTCAGAAACAGCTGAGGCCTGG + Intergenic
1018059432 6:160079010-160079032 CCCCAGCACCTGCTGTGGCACGG + Intronic
1019148613 6:169989348-169989370 CAGCAGTAGCAGCTGAGGAAAGG - Intergenic
1019160075 6:170063617-170063639 GCACATTAGCAGCTGTGGCGTGG - Intergenic
1019234266 6:170596680-170596702 CAGCAGTACCAGCTGTGGCAGGG + Intergenic
1021552236 7:21883481-21883503 CCTCAGCTCCATCTGTGGCAAGG + Intronic
1023306158 7:38830010-38830032 GCTGATTAACAGCTGTGGCAGGG - Intronic
1023978337 7:45050473-45050495 CCTCAGTATCTGCTGGGGCTTGG - Intronic
1025006748 7:55361650-55361672 CCACAGTACCACCTGTGGAAGGG - Intergenic
1031858975 7:126957322-126957344 TGTCTGGAGCAGCTGTGGCAGGG + Intronic
1032388098 7:131538360-131538382 CCCCACTAGCTGCTGTGCCAGGG - Intronic
1032442614 7:131953593-131953615 CCACAGAAGCAGCCGTGGGAGGG + Intergenic
1034741665 7:153479279-153479301 CCTTGGTTGCAGGTGTGGCATGG - Intergenic
1034941603 7:155234245-155234267 CCCAAGAGGCAGCTGTGGCATGG + Intergenic
1036698261 8:10993566-10993588 CCTCAGTAGCCGCAGGTGCAGGG - Intronic
1037926652 8:22848696-22848718 TCTTAGTAGTAGCTGTGGCAAGG + Intronic
1037953785 8:23037293-23037315 ACTCAGTAGCAGCTGTAGCCAGG - Intronic
1038225504 8:25653850-25653872 CCTGGGCAGCAGGTGTGGCATGG + Intergenic
1041556200 8:59159212-59159234 ACTCAGTAGTGGCTGTAGCAAGG - Intergenic
1042446471 8:68890676-68890698 CAGCACTACCAGCTGTGGCAGGG - Intergenic
1044537675 8:93375939-93375961 CCTCAATAGCACTTCTGGCAGGG - Intergenic
1047104450 8:121718092-121718114 ACTCATTAGCAGCTGTGGTCTGG + Intergenic
1048255523 8:132902396-132902418 CCTCAGAAGCAGGGGTGGGAGGG + Intronic
1048700626 8:137084777-137084799 CTTCAGAAGAAGCCGTGGCAGGG - Intergenic
1049378090 8:142298516-142298538 ACTCAGCAGCATCTGTGGCACGG - Intronic
1049461319 8:142729657-142729679 CCTCAGTCGCTTCTGTGGTATGG - Intronic
1049678658 8:143905221-143905243 CCAGAGTCGCAGCTGAGGCAGGG - Intergenic
1050694936 9:8268286-8268308 CATCTGTAACAGCTGTGTCAGGG + Intergenic
1055391505 9:75826772-75826794 CCTCAGCAGCATCAGTAGCAAGG + Intergenic
1056143593 9:83707798-83707820 CCTCAGTAGCAACGGGCGCAGGG + Exonic
1057254026 9:93528823-93528845 TTTAAGTACCAGCTGTGGCATGG + Intronic
1057918388 9:99075261-99075283 TCTCAGTAGGAGCTGGGGGAAGG + Intergenic
1060533104 9:124360395-124360417 CCTCTGTAGCAGCTGTCCCCGGG - Intronic
1061297464 9:129684672-129684694 CCTCAGTGGCACCTCTGGGACGG + Intronic
1061781487 9:132999056-132999078 CCTTCTTAGCAGCTGGGGCAGGG + Intergenic
1061864625 9:133485892-133485914 CATTAGCAGCAGCTTTGGCAAGG - Intergenic
1062290954 9:135794112-135794134 CCACAGTTCCAGCAGTGGCAGGG + Intergenic
1062457576 9:136646742-136646764 CCCCAGTAGCAGCTACGGCTGGG + Intergenic
1062569986 9:137180573-137180595 CCCAAGGAGCACCTGTGGCAGGG + Intronic
1188729791 X:33631742-33631764 CCTGAGCAGCATGTGTGGCATGG - Intergenic
1189012888 X:37064075-37064097 CCTAAGGAGGAGCTGTGGTAAGG - Intergenic
1190527776 X:51345420-51345442 ACTCAGCAGCAGCTGTAGCCAGG + Intergenic
1192230386 X:69260592-69260614 CCTCAGTAGCAGAAGGGGCAAGG + Intergenic
1192737318 X:73861727-73861749 CTTCAGTAGCAAAAGTGGCAGGG + Intergenic
1194151086 X:90325784-90325806 CCTGAGTGGCAGCTTTGCCAAGG - Intergenic
1198923597 X:141761064-141761086 GTGCAGTAGCAGATGTGGCAAGG + Intergenic
1198937860 X:141917365-141917387 TCTCAGTAGTAGCTGGGGGAAGG - Intergenic
1199216109 X:145262259-145262281 CCCTAGCAGCAGCAGTGGCAAGG + Intergenic
1200060804 X:153482923-153482945 CCTCAGCAGAAGCAGAGGCAGGG - Intronic
1200497454 Y:3902538-3902560 CCTGAGTGGCAGCTTTGCCAAGG - Intergenic