ID: 1079022915

View in Genome Browser
Species Human (GRCh38)
Location 11:16924085-16924107
Sequence CCTTCCACTCCCACTCATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 152}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079022906_1079022915 3 Left 1079022906 11:16924059-16924081 CCACAGCCCTCCATTTAAGGCTG 0: 1
1: 0
2: 0
3: 13
4: 188
Right 1079022915 11:16924085-16924107 CCTTCCACTCCCACTCATTAGGG 0: 1
1: 0
2: 2
3: 14
4: 152
1079022904_1079022915 9 Left 1079022904 11:16924053-16924075 CCTGGTCCACAGCCCTCCATTTA 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1079022915 11:16924085-16924107 CCTTCCACTCCCACTCATTAGGG 0: 1
1: 0
2: 2
3: 14
4: 152
1079022903_1079022915 13 Left 1079022903 11:16924049-16924071 CCAGCCTGGTCCACAGCCCTCCA 0: 1
1: 0
2: 0
3: 61
4: 479
Right 1079022915 11:16924085-16924107 CCTTCCACTCCCACTCATTAGGG 0: 1
1: 0
2: 2
3: 14
4: 152
1079022899_1079022915 22 Left 1079022899 11:16924040-16924062 CCCCAGAGCCCAGCCTGGTCCAC 0: 1
1: 0
2: 6
3: 81
4: 856
Right 1079022915 11:16924085-16924107 CCTTCCACTCCCACTCATTAGGG 0: 1
1: 0
2: 2
3: 14
4: 152
1079022896_1079022915 28 Left 1079022896 11:16924034-16924056 CCACCTCCCCAGAGCCCAGCCTG 0: 1
1: 2
2: 18
3: 170
4: 1134
Right 1079022915 11:16924085-16924107 CCTTCCACTCCCACTCATTAGGG 0: 1
1: 0
2: 2
3: 14
4: 152
1079022898_1079022915 25 Left 1079022898 11:16924037-16924059 CCTCCCCAGAGCCCAGCCTGGTC 0: 1
1: 0
2: 3
3: 71
4: 586
Right 1079022915 11:16924085-16924107 CCTTCCACTCCCACTCATTAGGG 0: 1
1: 0
2: 2
3: 14
4: 152
1079022910_1079022915 -4 Left 1079022910 11:16924066-16924088 CCTCCATTTAAGGCTGGGCCCTT 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1079022915 11:16924085-16924107 CCTTCCACTCCCACTCATTAGGG 0: 1
1: 0
2: 2
3: 14
4: 152
1079022901_1079022915 20 Left 1079022901 11:16924042-16924064 CCAGAGCCCAGCCTGGTCCACAG 0: 1
1: 1
2: 16
3: 92
4: 996
Right 1079022915 11:16924085-16924107 CCTTCCACTCCCACTCATTAGGG 0: 1
1: 0
2: 2
3: 14
4: 152
1079022895_1079022915 29 Left 1079022895 11:16924033-16924055 CCCACCTCCCCAGAGCCCAGCCT 0: 1
1: 0
2: 11
3: 96
4: 923
Right 1079022915 11:16924085-16924107 CCTTCCACTCCCACTCATTAGGG 0: 1
1: 0
2: 2
3: 14
4: 152
1079022911_1079022915 -7 Left 1079022911 11:16924069-16924091 CCATTTAAGGCTGGGCCCTTCCA 0: 1
1: 0
2: 1
3: 10
4: 176
Right 1079022915 11:16924085-16924107 CCTTCCACTCCCACTCATTAGGG 0: 1
1: 0
2: 2
3: 14
4: 152
1079022902_1079022915 14 Left 1079022902 11:16924048-16924070 CCCAGCCTGGTCCACAGCCCTCC 0: 1
1: 0
2: 2
3: 57
4: 763
Right 1079022915 11:16924085-16924107 CCTTCCACTCCCACTCATTAGGG 0: 1
1: 0
2: 2
3: 14
4: 152
1079022900_1079022915 21 Left 1079022900 11:16924041-16924063 CCCAGAGCCCAGCCTGGTCCACA 0: 1
1: 0
2: 2
3: 80
4: 707
Right 1079022915 11:16924085-16924107 CCTTCCACTCCCACTCATTAGGG 0: 1
1: 0
2: 2
3: 14
4: 152
1079022909_1079022915 -3 Left 1079022909 11:16924065-16924087 CCCTCCATTTAAGGCTGGGCCCT 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1079022915 11:16924085-16924107 CCTTCCACTCCCACTCATTAGGG 0: 1
1: 0
2: 2
3: 14
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079022915 Original CRISPR CCTTCCACTCCCACTCATTA GGG Intronic
901649353 1:10734774-10734796 CCTTCCACCCCCAAACATTGTGG - Intronic
902195758 1:14796751-14796773 CCTTCCTTTCCCACTCCTTCAGG - Intronic
902658424 1:17885289-17885311 CCTGCCACACCCCCTCAGTAGGG - Intergenic
903786122 1:25862512-25862534 CCTTCCACTGCCACTCACTGGGG - Exonic
904814385 1:33183974-33183996 CTTTCCCCACCCCCTCATTAGGG - Intergenic
905272417 1:36795798-36795820 CCCCCCACTCCCACTCAACATGG - Exonic
905912747 1:41664896-41664918 CCTTCCCCTCCACCTCATTAGGG - Intronic
906630457 1:47362938-47362960 CCTTCCAGTCCCACCCATAGAGG - Intronic
908655128 1:66380486-66380508 CCTGCTCCTCCCACTCACTACGG - Intergenic
909825493 1:80121291-80121313 CCTCCCACTCCCAACCAATAGGG - Intergenic
911056260 1:93710945-93710967 CCTGCCACGCTCACTCATTGTGG + Intronic
913704924 1:121411180-121411202 CCTTTCTCTCTCTCTCATTATGG - Intergenic
916038587 1:160943094-160943116 CCTTCCACCACCACTCATTGCGG + Intergenic
916407982 1:164516238-164516260 CTGTCCAGTCCCACTCATGAGGG + Intergenic
918835632 1:189461487-189461509 TCTTCAACTCCCACTTATGAGGG - Intergenic
920180341 1:204128605-204128627 CCTTCCTCGCCCCCTCACTAGGG + Intergenic
921383600 1:214549518-214549540 CATTCAGCTCCCGCTCATTAAGG + Intronic
921604124 1:217136225-217136247 CCTTTCCCTCCCACTCACTCCGG - Intronic
922850849 1:228732671-228732693 CATCCCACGCCCACTCATTTGGG - Intergenic
1064357946 10:14636794-14636816 CCTTGAACTCCAAGTCATTATGG + Intronic
1066456508 10:35576971-35576993 TCTTTCACTGCCACTGATTAGGG + Intergenic
1068132830 10:52916092-52916114 CCTTCCACTCCCACCCCTCCAGG - Intergenic
1071549020 10:86551838-86551860 ACTTCCCCTCCCATTCATTGTGG + Intergenic
1072617377 10:97058865-97058887 CCTCCCTCTCCCACTCACCAAGG - Intronic
1072845970 10:98830807-98830829 CCTTCCTTTCCCATTGATTATGG - Intronic
1073473245 10:103736840-103736862 TCTTCCACTCCCAGTCCTTGTGG + Intronic
1074541269 10:114367103-114367125 CCTTCACCTCCCACACATTTGGG - Intronic
1074895243 10:117771778-117771800 CTTTCCACTTCGACTCCTTAGGG + Intergenic
1075127175 10:119709905-119709927 CCCTCCCCTCCCACTCAGTGGGG - Intergenic
1077958410 11:7046889-7046911 TCTTCCACTCATACTCGTTAGGG + Intronic
1078092581 11:8276335-8276357 CCTTCCATTCCTACTCGCTAAGG - Intergenic
1079022915 11:16924085-16924107 CCTTCCACTCCCACTCATTAGGG + Intronic
1082560786 11:54618438-54618460 CATTCAACTCCCACTTATGAGGG + Intergenic
1088721303 11:112594315-112594337 CATTCCACTCCCTCTCCTTTGGG - Intergenic
1097421317 12:59383396-59383418 TCTACCACTACCTCTCATTAAGG + Intergenic
1102971578 12:117172022-117172044 TCTTCCTCTCCCACTCATGTGGG + Intronic
1106288297 13:28337255-28337277 AATTCCAATCCCACTCACTAGGG + Intronic
1107027832 13:35821827-35821849 CCTTCCTCACCCAGTTATTAAGG - Intronic
1109918449 13:69023088-69023110 CCTTCCACTTCCACTTCGTATGG - Intergenic
1114867342 14:26612889-26612911 CCTACCACTCACACTTATAATGG + Intergenic
1115749768 14:36477575-36477597 CCTACCACCCCCACAGATTAAGG + Intronic
1118289934 14:64510452-64510474 CCTTCCTCTCCCACTATTTTAGG - Intronic
1118835367 14:69474079-69474101 CCCTCCCCACCCACTCATCAAGG + Intergenic
1121744331 14:96276219-96276241 CCCTCAACTCCCACTCTTTCAGG - Exonic
1123753588 15:23378982-23379004 CTTTGTACTCTCACTCATTATGG - Intergenic
1124066896 15:26353350-26353372 ACTTCCAGTCCCACACATTTTGG + Intergenic
1128901458 15:71426151-71426173 CCATCCACTCACACTCAGTGTGG + Intronic
1129206904 15:74042745-74042767 CCTTCCTCCCCTACTCATGAGGG + Intronic
1133141360 16:3747026-3747048 TCTCCCACTCCCAATTATTATGG + Intronic
1133754501 16:8752285-8752307 CCTTCCACTCCCACACAAAGGGG - Intronic
1134462785 16:14444040-14444062 CTTTGTACTCTCACTCATTATGG + Intronic
1137354446 16:47746792-47746814 TCTTCCTCTCCCACACTTTAAGG - Intergenic
1137995651 16:53208359-53208381 CCTCCTCCTCCCACTCATTCAGG - Intronic
1139173840 16:64663030-64663052 CCTTCAACTCTCACCTATTAAGG + Intergenic
1144430239 17:15184485-15184507 CATTCCAATTCCACTCTTTAAGG - Intergenic
1146267016 17:31459578-31459600 GCTTCCACTCCCACGCCTGATGG + Intronic
1147326676 17:39672988-39673010 CCTTCCTTGCCCACTCCTTAGGG - Intronic
1147747298 17:42702671-42702693 ACTTCCCCTCCCACTCCTTAAGG + Intronic
1148589368 17:48804278-48804300 CCTTCCTCTTCCCCCCATTAAGG + Intronic
1148819416 17:50351983-50352005 CTCTCCACTGCCACTCCTTATGG - Intronic
1149120505 17:53158144-53158166 CCTTCTACTACCACCCATTATGG + Intergenic
1151444119 17:74152208-74152230 CCTCCCACTCCCACTCCAAATGG + Intergenic
1153726851 18:7965483-7965505 CCATCCAATCTCACTCAATAAGG - Intronic
1158774012 18:60555238-60555260 CCTTCCACACCAACTTGTTAGGG - Intergenic
1160831474 19:1106621-1106643 CCTTCCACCGGCACTCATGACGG + Exonic
1161080133 19:2306483-2306505 CCTTCTATTCCCACTCAGCAAGG + Intronic
1162554583 19:11378838-11378860 CCCTCCACTCCCAGTCATAGAGG + Intronic
1163312569 19:16522925-16522947 CCTTCATCTCCCACTCCCTAGGG - Intronic
1164159558 19:22617658-22617680 CCTGCCACTTTCTCTCATTATGG - Intergenic
1164807092 19:31125348-31125370 CTTTCCACACCCACACATAAGGG - Intergenic
1165470996 19:36004540-36004562 CCTTCCACTCCCAGACCTTCAGG + Intronic
927826828 2:26315167-26315189 CCTTTCACTCCCACTCCCTCAGG - Intronic
930387212 2:50711873-50711895 CCTTCCACTGCCACTGAGTGAGG + Intronic
930702101 2:54468889-54468911 CATTCCACTGCGACACATTATGG - Intronic
931064787 2:58573249-58573271 CCTTCCCCCTCCACTCATTAGGG - Intergenic
933565374 2:83943995-83944017 CCTTACACTCCAACTTATAAAGG - Intergenic
934615622 2:95768875-95768897 CCTCTCACTCCCACTCATGGGGG - Intergenic
934645276 2:96055683-96055705 CCTCTCACTCCCACTCATGGGGG + Intergenic
934808920 2:97265246-97265268 CCTTCCACCCCCAGTCATTTGGG - Intergenic
934828585 2:97491923-97491945 CCTTCCACCCCCAGTCATTTGGG + Intergenic
934838681 2:97611772-97611794 CCTCTCACTCCCACTCATGGGGG + Intergenic
937143751 2:119624796-119624818 TCTTCAACTCCCACTTATGAGGG - Intronic
937339989 2:121085178-121085200 CCTGCCACCCCCACTAATGACGG - Intergenic
937421257 2:121757484-121757506 TCTTCCACTTCCACACAGTATGG + Intronic
938120249 2:128628126-128628148 CCTTGCACTCCCACTCAGTGAGG + Intergenic
940329795 2:152462424-152462446 TCTGCCACTCCCACACATTCTGG + Intronic
941099985 2:161284808-161284830 CTTTCCACTCCCACTGAGCAAGG + Intergenic
941128035 2:161610565-161610587 ACTTCCACTTCCAGTCATTATGG - Intronic
944151540 2:196563766-196563788 CCTTCCACTCCCCCTTAATATGG - Intronic
944891764 2:204124803-204124825 ACTTCCCCTACCACTCTTTAAGG + Intergenic
945813661 2:214577461-214577483 CCCCTCACTCCCACTCCTTAGGG - Exonic
947762939 2:232616983-232617005 CCTTCCAGCCCTACTCACTAGGG - Intronic
947824701 2:233097775-233097797 CCTTCCAATGCAACTCATTTAGG + Intronic
948260945 2:236604061-236604083 CCTGCCACTCCCACCCAGTCAGG + Intergenic
1170624188 20:18018988-18019010 CCTTCCATTCCCATTCCATAGGG - Intronic
1171336366 20:24389210-24389232 CCAGCCACTCCCACTCCTTCTGG + Intergenic
1172498895 20:35410730-35410752 CCTTCCCCTGCCACCCTTTAGGG - Intronic
1174285712 20:49471499-49471521 CCTTCCTCTTCCACTCAGGACGG - Intronic
1178782253 21:35614699-35614721 CCTCCAACTCCCACTCATTCTGG - Intronic
1183404556 22:37624000-37624022 GCTTCCATTCACCCTCATTAGGG - Intronic
950831175 3:15877854-15877876 CCATCCACTCCCTCCCCTTAAGG - Intergenic
951360070 3:21714482-21714504 TCTACCACTCCCACTTTTTATGG + Intronic
953532915 3:43754233-43754255 CCTGTCACTCCCTCTAATTAAGG - Intergenic
953542625 3:43835632-43835654 GCTTCCAGTCCCACTCCTCAAGG - Intergenic
955858317 3:63298609-63298631 CTTTCCACTTCCATTCCTTATGG + Intronic
958867397 3:99517141-99517163 CCTTTCACTCCCACTCCTTAGGG + Intergenic
959596344 3:108133168-108133190 CTTACAACTCCCACTCATCAGGG - Intergenic
961752391 3:129104544-129104566 CCCTCCTCTCCCACTCAGCAAGG + Intronic
962406424 3:135104309-135104331 CTTTCCCAGCCCACTCATTACGG - Intronic
962923994 3:139975186-139975208 CCTGCTACTCCCCCTCCTTAGGG - Intronic
965449318 3:168818014-168818036 CAATCCACTCCCATTAATTAAGG - Intergenic
966084985 3:176060103-176060125 CTTTCCACTCCTACTCCTAATGG - Intergenic
966277082 3:178186538-178186560 TGTTCCACTCCCACTTATAAGGG - Intergenic
967193613 3:187006869-187006891 CTTTCCTCTTCCTCTCATTAGGG - Intronic
968434697 4:578444-578466 CCTTCCACCCTCACCCTTTAGGG - Intergenic
970642056 4:18077798-18077820 CCTTCCAATAACATTCATTAAGG + Intergenic
972723500 4:41724417-41724439 ACTTTTTCTCCCACTCATTATGG - Intergenic
974521527 4:62987147-62987169 CCTGCCACTCCCACCCCTTGGGG - Intergenic
975286697 4:72629706-72629728 GGTTCCACTCACACTCATTGTGG + Intergenic
975447319 4:74481014-74481036 CCTTACTCTCCCTCTCATAAAGG - Intergenic
976496431 4:85735058-85735080 CCTTCCACTCCCACCTTTTCAGG + Intronic
979283479 4:118894513-118894535 CCACCCACTCCCACTTATGAAGG - Intronic
983274962 4:165605689-165605711 ACTTCCAAGCTCACTCATTAGGG + Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
985515099 5:338865-338887 CTTTCCCCTCCTATTCATTAGGG + Intronic
985799759 5:1997239-1997261 CCTTTCTCTCCCACCCATGAGGG - Intergenic
986494391 5:8328123-8328145 CCTTCCCCTCACACTAAATATGG + Intergenic
988246923 5:28697221-28697243 TCTTGCACTCCAACTCACTAGGG + Intergenic
996160873 5:120162513-120162535 CTTTCCACTCTTACTCATCAAGG - Intergenic
997751909 5:136354900-136354922 CCAACCACTCCTACTCATTAAGG + Intronic
998664709 5:144283362-144283384 ACTTTCTCTCCCACTGATTATGG - Intronic
999539803 5:152558992-152559014 CCTGACTCTACCACTCATTATGG + Intergenic
1001933434 5:175688612-175688634 CCTAGCTCTGCCACTCATTAAGG - Intergenic
1002182605 5:177438711-177438733 ACTTCCACTCACACCCACTATGG - Intronic
1002277967 5:178115364-178115386 CATTCCAGTCCCATTCCTTAGGG + Intronic
1002516909 5:179765745-179765767 CCTTCCACTCCTGCTCGTTAAGG - Exonic
1007247582 6:40473434-40473456 GTTTCCACTCCCAGTCATTGGGG + Intronic
1009671385 6:66756268-66756290 CCTTCCTTTCCCACTCAAAAAGG - Intergenic
1012556219 6:100515774-100515796 CCTTCTACTCCCTCTCTTCAGGG - Intronic
1012924133 6:105250584-105250606 CCTTCCCCTCCCCATAATTATGG - Intergenic
1014391559 6:120871935-120871957 CCTTCCTCTCCAACTCAGAAGGG - Intergenic
1017251519 6:152285145-152285167 TCTTCCACCACCTCTCATTATGG + Intronic
1018631371 6:165825743-165825765 CCTCCCACTCCCACTGCTGAAGG - Intronic
1019175873 6:170159294-170159316 CCTTCACCTGCCACTGATTAGGG + Intergenic
1020371950 7:7441979-7442001 CCCTCCACTACCACTAATTTAGG + Intronic
1021476487 7:21067183-21067205 CCTTCCTCTAACACTTATTATGG + Intergenic
1021696035 7:23277220-23277242 GCTTCCATGCCCACTCATTCGGG - Intergenic
1027184153 7:75960339-75960361 ACGTCCACTCCCACTCACTCAGG + Intronic
1027210189 7:76140969-76140991 CCTTCCACACACACTCATGTCGG - Intergenic
1031148795 7:118028538-118028560 CCTTCCAGAACCACTCATTGAGG + Intergenic
1031991886 7:128203739-128203761 CCTCCCACTTCCACTTAATAGGG - Intergenic
1037838673 8:22229282-22229304 CCCTCCACCCCCACACATGAGGG - Intronic
1039891796 8:41690501-41690523 GCTTCCACTTCCAGTCATTTCGG - Exonic
1040122187 8:43695716-43695738 CCTTCTCCTCCCACTTAATAGGG + Intergenic
1042501541 8:69514596-69514618 CCTCCCACTCCCCCACTTTAGGG - Intronic
1045887928 8:107122522-107122544 CCTGCCCCTCCCACTCAGAAAGG - Intergenic
1049296207 8:141840990-141841012 CTTTCCACTTCCAGTCATGAGGG - Intergenic
1049306266 8:141905918-141905940 CCTTCCCCTCTCTCTCATCATGG + Intergenic
1049877060 8:145031024-145031046 CATTCCCCTCCCACTTAATAGGG - Intergenic
1050228448 9:3489368-3489390 CCTTCCACTGCCATTCAGAAAGG - Intronic
1056729033 9:89148043-89148065 CTTTCCAGTCCTACTCACTAGGG - Intronic
1057010580 9:91597936-91597958 CCTCTCAATCCCACTCATGAGGG - Intronic
1058881876 9:109292511-109292533 CCTCCCATTCCCATTCATGAGGG - Intronic
1060767392 9:126305062-126305084 CATTGGACTCCCACTCATTGTGG - Intergenic
1061715354 9:132515167-132515189 CCTTCCACCCCCAGACATTCTGG - Intronic
1189113593 X:38320719-38320741 CCTTCCACTCACCCTTAGTAAGG + Intronic
1197446166 X:126553572-126553594 CCTTCCACTCCCTCTCCTTAGGG - Intergenic
1199151978 X:144497930-144497952 CCTTCCTCTCCCAGTGATTTTGG - Intergenic
1199540846 X:148956318-148956340 GCTGCCACTGCTACTCATTAAGG - Exonic