ID: 1079039047

View in Genome Browser
Species Human (GRCh38)
Location 11:17045138-17045160
Sequence AATGTGTGGTATCACATTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079039047_1079039054 24 Left 1079039047 11:17045138-17045160 CCAATAATGTGATACCACACATT No data
Right 1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG No data
1079039047_1079039051 13 Left 1079039047 11:17045138-17045160 CCAATAATGTGATACCACACATT No data
Right 1079039051 11:17045174-17045196 TAAACAAGCAATGGTGAGACTGG No data
1079039047_1079039050 4 Left 1079039047 11:17045138-17045160 CCAATAATGTGATACCACACATT No data
Right 1079039050 11:17045165-17045187 TAGATATGATAAACAAGCAATGG No data
1079039047_1079039052 16 Left 1079039047 11:17045138-17045160 CCAATAATGTGATACCACACATT No data
Right 1079039052 11:17045177-17045199 ACAAGCAATGGTGAGACTGGAGG No data
1079039047_1079039053 17 Left 1079039047 11:17045138-17045160 CCAATAATGTGATACCACACATT No data
Right 1079039053 11:17045178-17045200 CAAGCAATGGTGAGACTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079039047 Original CRISPR AATGTGTGGTATCACATTAT TGG (reversed) Intergenic
No off target data available for this crispr