ID: 1079039049 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:17045152-17045174 |
| Sequence | ATCATATCTATCCTAATGTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 5 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1079039049_1079039052 | 2 | Left | 1079039049 | 11:17045152-17045174 | CCACACATTAGGATAGATATGAT | No data | ||
| Right | 1079039052 | 11:17045177-17045199 | ACAAGCAATGGTGAGACTGGAGG | No data | ||||
| 1079039049_1079039054 | 10 | Left | 1079039049 | 11:17045152-17045174 | CCACACATTAGGATAGATATGAT | No data | ||
| Right | 1079039054 | 11:17045185-17045207 | TGGTGAGACTGGAGGGAAGTAGG | No data | ||||
| 1079039049_1079039050 | -10 | Left | 1079039049 | 11:17045152-17045174 | CCACACATTAGGATAGATATGAT | No data | ||
| Right | 1079039050 | 11:17045165-17045187 | TAGATATGATAAACAAGCAATGG | No data | ||||
| 1079039049_1079039053 | 3 | Left | 1079039049 | 11:17045152-17045174 | CCACACATTAGGATAGATATGAT | No data | ||
| Right | 1079039053 | 11:17045178-17045200 | CAAGCAATGGTGAGACTGGAGGG | No data | ||||
| 1079039049_1079039051 | -1 | Left | 1079039049 | 11:17045152-17045174 | CCACACATTAGGATAGATATGAT | No data | ||
| Right | 1079039051 | 11:17045174-17045196 | TAAACAAGCAATGGTGAGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1079039049 | Original CRISPR | ATCATATCTATCCTAATGTG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||