ID: 1079039049

View in Genome Browser
Species Human (GRCh38)
Location 11:17045152-17045174
Sequence ATCATATCTATCCTAATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079039049_1079039052 2 Left 1079039049 11:17045152-17045174 CCACACATTAGGATAGATATGAT No data
Right 1079039052 11:17045177-17045199 ACAAGCAATGGTGAGACTGGAGG No data
1079039049_1079039054 10 Left 1079039049 11:17045152-17045174 CCACACATTAGGATAGATATGAT No data
Right 1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG No data
1079039049_1079039050 -10 Left 1079039049 11:17045152-17045174 CCACACATTAGGATAGATATGAT No data
Right 1079039050 11:17045165-17045187 TAGATATGATAAACAAGCAATGG No data
1079039049_1079039053 3 Left 1079039049 11:17045152-17045174 CCACACATTAGGATAGATATGAT No data
Right 1079039053 11:17045178-17045200 CAAGCAATGGTGAGACTGGAGGG No data
1079039049_1079039051 -1 Left 1079039049 11:17045152-17045174 CCACACATTAGGATAGATATGAT No data
Right 1079039051 11:17045174-17045196 TAAACAAGCAATGGTGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079039049 Original CRISPR ATCATATCTATCCTAATGTG TGG (reversed) Intergenic
No off target data available for this crispr