ID: 1079039054

View in Genome Browser
Species Human (GRCh38)
Location 11:17045185-17045207
Sequence TGGTGAGACTGGAGGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079039047_1079039054 24 Left 1079039047 11:17045138-17045160 CCAATAATGTGATACCACACATT No data
Right 1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG No data
1079039049_1079039054 10 Left 1079039049 11:17045152-17045174 CCACACATTAGGATAGATATGAT No data
Right 1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079039054 Original CRISPR TGGTGAGACTGGAGGGAAGT AGG Intergenic
No off target data available for this crispr