ID: 1079040268

View in Genome Browser
Species Human (GRCh38)
Location 11:17053026-17053048
Sequence GTGGGTTTAAAAAGGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079040265_1079040268 -7 Left 1079040265 11:17053010-17053032 CCATTCCTTTTGTAGTGTGGGTT 0: 16
1: 9
2: 4
3: 15
4: 195
Right 1079040268 11:17053026-17053048 GTGGGTTTAAAAAGGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079040268 Original CRISPR GTGGGTTTAAAAAGGCAGCA AGG Intergenic
No off target data available for this crispr