ID: 1079040601

View in Genome Browser
Species Human (GRCh38)
Location 11:17055911-17055933
Sequence GGGTGTACAAAATGTCACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079040601_1079040610 30 Left 1079040601 11:17055911-17055933 CCCCTGTGACATTTTGTACACCC No data
Right 1079040610 11:17055964-17055986 TATATTACAAATAATATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079040601 Original CRISPR GGGTGTACAAAATGTCACAG GGG (reversed) Intergenic
No off target data available for this crispr