ID: 1079041560

View in Genome Browser
Species Human (GRCh38)
Location 11:17064562-17064584
Sequence CTCTTCTGTGATTCTAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079041559_1079041560 -10 Left 1079041559 11:17064549-17064571 CCTACTTGGTTTACTCTTCTGTG No data
Right 1079041560 11:17064562-17064584 CTCTTCTGTGATTCTAAGTCAGG No data
1079041556_1079041560 21 Left 1079041556 11:17064518-17064540 CCCATACACAAAATGAGGACTGA No data
Right 1079041560 11:17064562-17064584 CTCTTCTGTGATTCTAAGTCAGG No data
1079041557_1079041560 20 Left 1079041557 11:17064519-17064541 CCATACACAAAATGAGGACTGAA No data
Right 1079041560 11:17064562-17064584 CTCTTCTGTGATTCTAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079041560 Original CRISPR CTCTTCTGTGATTCTAAGTC AGG Intergenic
No off target data available for this crispr