ID: 1079043179

View in Genome Browser
Species Human (GRCh38)
Location 11:17077600-17077622
Sequence CTTGATGCCCCGAGCTCACC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 80}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079043172_1079043179 -4 Left 1079043172 11:17077581-17077603 CCCCCGCCCAGCAATCCGGCTTG 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG 0: 1
1: 0
2: 0
3: 9
4: 80
1079043166_1079043179 12 Left 1079043166 11:17077565-17077587 CCTGTCTTCCTCCCACCCCCCGC 0: 1
1: 1
2: 4
3: 81
4: 993
Right 1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG 0: 1
1: 0
2: 0
3: 9
4: 80
1079043174_1079043179 -6 Left 1079043174 11:17077583-17077605 CCCGCCCAGCAATCCGGCTTGAT 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG 0: 1
1: 0
2: 0
3: 9
4: 80
1079043171_1079043179 -3 Left 1079043171 11:17077580-17077602 CCCCCCGCCCAGCAATCCGGCTT 0: 1
1: 0
2: 0
3: 6
4: 162
Right 1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG 0: 1
1: 0
2: 0
3: 9
4: 80
1079043164_1079043179 20 Left 1079043164 11:17077557-17077579 CCACACTCCCTGTCTTCCTCCCA 0: 1
1: 1
2: 27
3: 352
4: 3772
Right 1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG 0: 1
1: 0
2: 0
3: 9
4: 80
1079043173_1079043179 -5 Left 1079043173 11:17077582-17077604 CCCCGCCCAGCAATCCGGCTTGA 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG 0: 1
1: 0
2: 0
3: 9
4: 80
1079043169_1079043179 0 Left 1079043169 11:17077577-17077599 CCACCCCCCGCCCAGCAATCCGG 0: 1
1: 0
2: 1
3: 20
4: 253
Right 1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG 0: 1
1: 0
2: 0
3: 9
4: 80
1079043163_1079043179 21 Left 1079043163 11:17077556-17077578 CCCACACTCCCTGTCTTCCTCCC 0: 1
1: 1
2: 21
3: 240
4: 3004
Right 1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG 0: 1
1: 0
2: 0
3: 9
4: 80
1079043175_1079043179 -7 Left 1079043175 11:17077584-17077606 CCGCCCAGCAATCCGGCTTGATG 0: 1
1: 0
2: 0
3: 9
4: 75
Right 1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG 0: 1
1: 0
2: 0
3: 9
4: 80
1079043161_1079043179 28 Left 1079043161 11:17077549-17077571 CCCGCTGCCCACACTCCCTGTCT 0: 1
1: 0
2: 6
3: 65
4: 628
Right 1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG 0: 1
1: 0
2: 0
3: 9
4: 80
1079043168_1079043179 1 Left 1079043168 11:17077576-17077598 CCCACCCCCCGCCCAGCAATCCG 0: 1
1: 0
2: 0
3: 14
4: 262
Right 1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG 0: 1
1: 0
2: 0
3: 9
4: 80
1079043162_1079043179 27 Left 1079043162 11:17077550-17077572 CCGCTGCCCACACTCCCTGTCTT 0: 1
1: 0
2: 6
3: 84
4: 821
Right 1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG 0: 1
1: 0
2: 0
3: 9
4: 80
1079043165_1079043179 13 Left 1079043165 11:17077564-17077586 CCCTGTCTTCCTCCCACCCCCCG 0: 1
1: 1
2: 5
3: 73
4: 1052
Right 1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG 0: 1
1: 0
2: 0
3: 9
4: 80
1079043176_1079043179 -10 Left 1079043176 11:17077587-17077609 CCCAGCAATCCGGCTTGATGCCC 0: 1
1: 0
2: 0
3: 1
4: 66
Right 1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG 0: 1
1: 0
2: 0
3: 9
4: 80
1079043167_1079043179 4 Left 1079043167 11:17077573-17077595 CCTCCCACCCCCCGCCCAGCAAT 0: 1
1: 0
2: 10
3: 146
4: 1990
Right 1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG 0: 1
1: 0
2: 0
3: 9
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079043179 Original CRISPR CTTGATGCCCCGAGCTCACC CGG Exonic
900692417 1:3988569-3988591 CTTTTTGCCCTGAGCTCTCCTGG + Intergenic
900917029 1:5646322-5646344 GCTGCTGCCCCCAGCTCACCTGG + Intergenic
901627493 1:10632230-10632252 CTTGGTGGCCCCAGCTCTCCAGG - Intergenic
901746262 1:11375703-11375725 CTTGATTCCCTGGGCTCTCCTGG - Intergenic
902651556 1:17840947-17840969 CTTCTTGCCCCCAGCTGACCTGG - Intergenic
904799794 1:33084194-33084216 CTTGCTCCCCAGAGCCCACCTGG - Intronic
909348700 1:74623483-74623505 CTTGATGTCCAGAATTCACCAGG - Intronic
913268664 1:117070878-117070900 CTTGATGCCACTACTTCACCAGG - Intronic
915724590 1:158008383-158008405 CTTTATCCCCGGAGCTCCCCTGG + Intronic
920779182 1:208971249-208971271 CTTCTTCCTCCGAGCTCACCAGG + Intergenic
921619514 1:217310550-217310572 CTTGATGTCCCAGCCTCACCTGG - Intergenic
921834125 1:219760406-219760428 TTTTCTGCCCCCAGCTCACCCGG + Intronic
1068135691 10:52949824-52949846 CTTCATGCCCCAAGCTCTCGGGG - Intergenic
1069834151 10:71298026-71298048 CTAGATGCCCCCAACTCACGGGG + Exonic
1071467873 10:85957626-85957648 CTTGACACCCTGAGCCCACCTGG + Intronic
1074969482 10:118524028-118524050 CATGATGACCCAAGCTCACTAGG - Intergenic
1076337092 10:129714120-129714142 CTAGGCGCCCCGAGCTCTCCTGG + Intronic
1077096856 11:802681-802703 CCAGACGCCCCGAGTTCACCAGG - Exonic
1079043179 11:17077600-17077622 CTTGATGCCCCGAGCTCACCCGG + Exonic
1081219092 11:40438049-40438071 CTTCATGTCCCATGCTCACCAGG + Intronic
1081868277 11:46371622-46371644 CTTGATGCCCCGTACGCACTTGG + Intronic
1088758552 11:112907621-112907643 CTTGGTGCCTTGAGTTCACCAGG - Intergenic
1089531690 11:119134062-119134084 CTTTATGCTCCTACCTCACCAGG + Exonic
1097010743 12:55952013-55952035 CTTCATGTCCCGAACTCTCCAGG + Exonic
1101049830 12:100849925-100849947 CTTGATGGCCCGAGCCCACAAGG - Intronic
1103844658 12:123893005-123893027 CTAGATGCCGCCAGCTCGCCTGG - Intronic
1104365240 12:128170789-128170811 CCTGATGCCCAAAGCTCTCCCGG + Intergenic
1113861921 13:113491712-113491734 CTGGAGGCCCCGAGTCCACCCGG - Intronic
1120858947 14:89236857-89236879 CCTGATGCCAGGAGCTGACCTGG + Intronic
1121109315 14:91301799-91301821 CATGATGCCCAGCACTCACCAGG - Intronic
1122152580 14:99732872-99732894 CCTGCTGCCCCGCACTCACCCGG - Intergenic
1124618006 15:31256507-31256529 CTTGAAGCCCCGGGCTCCCCAGG - Intergenic
1137425855 16:48380223-48380245 CTTGAGGCCAGGAGTTCACCAGG + Intronic
1137559627 16:49494370-49494392 CTTGATGCCCCAAGGGGACCAGG + Intronic
1137673306 16:50291701-50291723 CTTGGGGCACCGGGCTCACCAGG + Intronic
1139529568 16:67536493-67536515 CTTCCTGCCCCCAGCTCACATGG - Intronic
1147394472 17:40131044-40131066 CTTGATGCCCCTATCTCAAGAGG + Intronic
1148437762 17:47695946-47695968 CTTCCTGCCCCGAGCTCAGCAGG - Exonic
1152998125 18:427475-427497 CTTGATGGGCAGAGCTGACCTGG + Intronic
1161171343 19:2813855-2813877 CTTGATGGCCAGAGCTGAGCAGG - Exonic
1165528821 19:36379300-36379322 CTTCCCGCCCCGAGCGCACCCGG - Intergenic
1165873676 19:38991021-38991043 CTGGCTGCCCCGTGGTCACCCGG - Intronic
932398092 2:71461966-71461988 CTATATGCCCAGAGCTCACTGGG - Intronic
935349011 2:102137572-102137594 CTTGATGCCCAGAGCTTGCCAGG - Intronic
936087740 2:109480741-109480763 CTGGATCCCCTGGGCTCACCTGG + Intronic
938318916 2:130349149-130349171 GATGATGCCCAGGGCTCACCTGG - Intergenic
949073144 2:242038913-242038935 CTGGATGCCTCCAGCCCACCTGG - Intergenic
1169502128 20:6170689-6170711 CTTGATGCCCCCAGTACAACTGG - Intergenic
1173154959 20:40600995-40601017 CTTGGTGGCCCGTGCTCACTGGG + Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1176146811 20:63569129-63569151 CCTGTTGCCCCCAGCTCACTTGG + Exonic
1181493231 22:23273810-23273832 CTGCATGCCCCCAGCTCAGCAGG - Intronic
956202233 3:66718609-66718631 CTTGATGCCCAGACCACACCCGG + Intergenic
960892685 3:122466789-122466811 CTTGAGGCCAGGAGTTCACCTGG + Intronic
965736632 3:171827518-171827540 CTTGATGCCTCCAGCCCACTTGG - Intergenic
968292245 3:197547731-197547753 CTGGAGGCCCCTAGCTCACTGGG + Intronic
968569362 4:1331404-1331426 CCTGCTGCCCCGGGCTCTCCTGG + Intronic
970314903 4:14819916-14819938 CTTGGTCCCCCGATTTCACCTGG - Intergenic
974310416 4:60201040-60201062 CTTAATGCCTAGAGCTCATCTGG + Intergenic
975668261 4:76754909-76754931 CTTGGGGCCCCGAGCACTCCAGG + Exonic
986534019 5:8767703-8767725 CCTGATGCCCAGAACTCACATGG - Intergenic
997351498 5:133234433-133234455 CTTGGTGCCCAGTGCTCATCAGG - Intronic
1003392008 6:5722552-5722574 CTTGATGGCAAGAGCTCACAGGG + Intronic
1005738373 6:28769667-28769689 CTTCATACCCCGAGCTCTCTCGG - Intergenic
1008455782 6:51709086-51709108 CTTGATGCCCTGAACTTTCCTGG + Intronic
1018968991 6:168512290-168512312 CATGCTTCCCTGAGCTCACCAGG + Intronic
1033000031 7:137493317-137493339 CTGGAAGCCCCTGGCTCACCAGG + Intronic
1036079717 8:5541999-5542021 CTTGACTCCCCGAGCACCCCTGG - Intergenic
1037755198 8:21705874-21705896 CTTGCTGCCCCCATCTCAGCAGG - Intronic
1037756160 8:21711416-21711438 CCTGCTGCCCTGAGCTCACTTGG - Intronic
1038021981 8:23558478-23558500 CATGATCCCGCCAGCTCACCTGG + Intronic
1038391795 8:27208714-27208736 CTGAATGCCACGAGCTCACTAGG - Intergenic
1038990321 8:32860191-32860213 CTTGATGCCTCTAGCACAGCAGG + Intergenic
1039573553 8:38605672-38605694 CTTCCTGCCCCGAGCTCTCTGGG + Intergenic
1040061614 8:43108129-43108151 CTTGATGCCCCTAGATAACTTGG + Intronic
1049500757 8:142963665-142963687 CTTGATGTCCCAAGATAACCTGG - Intergenic
1050880010 9:10687946-10687968 CATGATGCCCTGAGCTCTCCCGG - Intergenic
1060882084 9:127124283-127124305 TTTGAAGCCCCGAGCTAAGCTGG + Intronic
1061214400 9:129212698-129212720 TAGGCTGCCCCGAGCTCACCTGG + Intergenic
1061295949 9:129676799-129676821 CGTGATGCCCCCAGCTCAGAGGG + Intronic
1187551250 X:20307733-20307755 CTTGAGGTCCCCAGCTCTCCTGG + Intergenic
1195128582 X:101832518-101832540 CTTGATATCCAGACCTCACCTGG + Intronic
1195177613 X:102326320-102326342 CTTGATTCCCAGACCTCACCTGG - Exonic
1195181251 X:102360773-102360795 CTTGATTCCCAGACCTCACCTGG + Exonic
1195203354 X:102571271-102571293 CTTGATTCCCAGATCTCACCTGG - Intergenic
1197938488 X:131764238-131764260 CTTGAGGCTCCGAGACCACCAGG + Intergenic
1200074873 X:153545962-153545984 CTTCATGCCCCGTCCTCTCCAGG - Intronic
1200687593 Y:6270708-6270730 CATGTTGCCCCGGGCTCATCTGG + Intergenic
1201047678 Y:9904001-9904023 CATGTTGCCCCGGGCTCATCTGG - Intergenic
1201282754 Y:12355467-12355489 CTTCATACCCCGAGCTCTCAAGG - Intergenic