ID: 1079043294

View in Genome Browser
Species Human (GRCh38)
Location 11:17078279-17078301
Sequence AGCGCCCCAGAGCCCTGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 233}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079043294_1079043302 1 Left 1079043294 11:17078279-17078301 CCTGCGCAGGGCTCTGGGGCGCT 0: 1
1: 0
2: 2
3: 12
4: 233
Right 1079043302 11:17078303-17078325 GGCTCGCCGGGGAGAAGGGTTGG 0: 1
1: 0
2: 0
3: 11
4: 185
1079043294_1079043306 15 Left 1079043294 11:17078279-17078301 CCTGCGCAGGGCTCTGGGGCGCT 0: 1
1: 0
2: 2
3: 12
4: 233
Right 1079043306 11:17078317-17078339 AAGGGTTGGGCAGAGGCTTACGG 0: 1
1: 0
2: 0
3: 21
4: 228
1079043294_1079043301 -3 Left 1079043294 11:17078279-17078301 CCTGCGCAGGGCTCTGGGGCGCT 0: 1
1: 0
2: 2
3: 12
4: 233
Right 1079043301 11:17078299-17078321 GCTGGGCTCGCCGGGGAGAAGGG 0: 1
1: 0
2: 2
3: 18
4: 173
1079043294_1079043303 2 Left 1079043294 11:17078279-17078301 CCTGCGCAGGGCTCTGGGGCGCT 0: 1
1: 0
2: 2
3: 12
4: 233
Right 1079043303 11:17078304-17078326 GCTCGCCGGGGAGAAGGGTTGGG 0: 1
1: 0
2: 0
3: 6
4: 97
1079043294_1079043300 -4 Left 1079043294 11:17078279-17078301 CCTGCGCAGGGCTCTGGGGCGCT 0: 1
1: 0
2: 2
3: 12
4: 233
Right 1079043300 11:17078298-17078320 CGCTGGGCTCGCCGGGGAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 147
1079043294_1079043305 8 Left 1079043294 11:17078279-17078301 CCTGCGCAGGGCTCTGGGGCGCT 0: 1
1: 0
2: 2
3: 12
4: 233
Right 1079043305 11:17078310-17078332 CGGGGAGAAGGGTTGGGCAGAGG 0: 1
1: 0
2: 2
3: 68
4: 654
1079043294_1079043299 -10 Left 1079043294 11:17078279-17078301 CCTGCGCAGGGCTCTGGGGCGCT 0: 1
1: 0
2: 2
3: 12
4: 233
Right 1079043299 11:17078292-17078314 CTGGGGCGCTGGGCTCGCCGGGG 0: 1
1: 0
2: 2
3: 30
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079043294 Original CRISPR AGCGCCCCAGAGCCCTGCGC AGG (reversed) Intronic