ID: 1079044187

View in Genome Browser
Species Human (GRCh38)
Location 11:17085157-17085179
Sequence TAGTTAATACAGATGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079044185_1079044187 -10 Left 1079044185 11:17085144-17085166 CCTAGGAACATCTTAGTTAATAC 0: 1
1: 0
2: 1
3: 13
4: 147
Right 1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG 0: 1
1: 0
2: 1
3: 18
4: 196
1079044184_1079044187 -5 Left 1079044184 11:17085139-17085161 CCATACCTAGGAACATCTTAGTT 0: 1
1: 0
2: 2
3: 18
4: 162
Right 1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG 0: 1
1: 0
2: 1
3: 18
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079044187 Original CRISPR TAGTTAATACAGATGGAACA AGG Intronic
903050998 1:20600986-20601008 CAGTTAATACAGTTGGAATATGG - Intronic
903624712 1:24722152-24722174 TAGCTAATATAGCTGGGACATGG + Intergenic
907197797 1:52700693-52700715 AATTTAATAAACATGGAACATGG - Intergenic
909508970 1:76429267-76429289 TAGATCATACAGATAGGACATGG - Intronic
909619944 1:77656391-77656413 TTCTTAAGACAGATGGAGCATGG - Intronic
910615382 1:89192063-89192085 AAGTTAATACAGATATAACTTGG + Intronic
912023848 1:105141238-105141260 TAGTAAATATAGATTGAAAAGGG + Intergenic
913283443 1:117207301-117207323 TAGTGATTTCAGATGAAACAGGG + Intronic
917025330 1:170635730-170635752 AACTTAATAGACATGGAACATGG + Intergenic
918206672 1:182315632-182315654 AACTCAAAACAGATGGAACAGGG + Intergenic
918303348 1:183223972-183223994 TGGGAAATAAAGATGGAACATGG + Intronic
918576855 1:186071513-186071535 TACTTAATACAGATGTGAAACGG + Intronic
919443046 1:197663222-197663244 TAGTACATACTGATGTAACAGGG - Intronic
923580028 1:235200788-235200810 TAGTCAATGCAGATAGAAAATGG + Intronic
923643016 1:235784789-235784811 TAGTTAAATCAGATGGAGCTGGG - Intronic
1067927881 10:50529031-50529053 TGGTTCCTACAGCTGGAACATGG + Intronic
1068314046 10:55319340-55319362 TTGTTAACATAAATGGAACAAGG + Intronic
1071541485 10:86488702-86488724 TAGTTATTACAGTATGAACATGG - Intronic
1071971297 10:90910226-90910248 TAGTTAATAAAGCAGTAACAGGG + Intergenic
1072492802 10:95924112-95924134 TATTTATTCCAGATGGAAAAGGG + Intronic
1075146827 10:119889549-119889571 AAGTTAATATGGATTGAACAAGG + Intronic
1076630687 10:131850224-131850246 AAGTTAATGCAGATGGACCTCGG + Intergenic
1078333742 11:10447320-10447342 GAGTTAATACAGAGAGAAGATGG + Intronic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079149269 11:17883223-17883245 TAGAAAATACAGCTGGACCAGGG + Intronic
1079504744 11:21141049-21141071 TAGTTTTTACAGATGAAAAATGG + Intronic
1079879114 11:25901403-25901425 TAGTTAATACAGTTGACTCAAGG + Intergenic
1080867596 11:36209246-36209268 TAGTTAATACAGTTGTTCCAAGG + Intronic
1080960743 11:37156777-37156799 TAGTTAATAAACAGGGAACTAGG + Intergenic
1084915658 11:72427082-72427104 TAATGAATACAGATGGCAGAGGG + Intronic
1085442048 11:76574355-76574377 TAGTTATTACACCTGGAAAAAGG + Intergenic
1085935731 11:81139531-81139553 TACTTAAAACAGGTGGAAAAAGG - Intergenic
1086155598 11:83662298-83662320 AAGTCAATACAGATTGAAAATGG + Intronic
1087252308 11:95916534-95916556 TAGTCAATACAGATCTAATATGG - Intronic
1091983173 12:4883065-4883087 TAGTTATTGCAGATGAAACGTGG - Intergenic
1092382557 12:8009618-8009640 TAGTTAATAAAGCAGTAACAGGG + Intergenic
1093132236 12:15405513-15405535 TGGTTAATACAAATGGGAAAAGG + Intronic
1093925511 12:24904497-24904519 CAGTTAATACAGATGGAGGCCGG - Intronic
1095839867 12:46681500-46681522 TAATTAATGCAGAAGGAAGATGG - Intergenic
1096036865 12:48479759-48479781 TCTTTTATACAGATGAAACATGG - Intergenic
1098043453 12:66376552-66376574 AAGTTAATACAGATGGAATCAGG + Intronic
1098667247 12:73179889-73179911 TAGTGAATACAGGTGGAGCCAGG - Intergenic
1099643763 12:85324362-85324384 TGGTTAATAAAAATGGAAGATGG - Intergenic
1102331642 12:112037551-112037573 TACTTATTACAGAGGGAAAAAGG + Intronic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1108867908 13:54943289-54943311 TAGAAAATACACAGGGAACAGGG - Intergenic
1109368108 13:61384247-61384269 TAGTTAATAAAGAGTGATCAAGG + Intergenic
1109368130 13:61384580-61384602 TAGTTAATAAAGAGTGATCAAGG + Intergenic
1109497952 13:63198850-63198872 AAGTTAGTACAGAGGTAACATGG - Intergenic
1112254680 13:97818999-97819021 TTGTTAATACTAATGGCACATGG - Intergenic
1112943424 13:104894394-104894416 TATTTTATACAGATGTTACAAGG - Intergenic
1113000846 13:105634349-105634371 CAGTTAATGCAGATCAAACAGGG + Intergenic
1114556069 14:23563013-23563035 TATTTAATTAAGATGGAAAAGGG + Intronic
1114943222 14:27642871-27642893 TAGTTAATAAAGGTGTAGCAGGG - Intergenic
1116477472 14:45358143-45358165 TACCTAATACTGATAGAACAGGG + Intergenic
1117605851 14:57428342-57428364 CAGGTAATACACATTGAACAAGG - Intergenic
1118430153 14:65710244-65710266 TAAATAATACATATGGTACATGG + Intronic
1118445203 14:65844299-65844321 TGGCTAATATAGATGGAAGAAGG + Intergenic
1119569556 14:75658451-75658473 TAGTTACAACTGGTGGAACAGGG - Intronic
1120816617 14:88866579-88866601 TAGTCAATGCAGCTGGAACTTGG - Intronic
1125632225 15:41156602-41156624 TAGTTTTTACAGATGTATCATGG + Intergenic
1126380631 15:48043165-48043187 TAGTGAATATAGAAGGAGCAGGG - Intergenic
1127107594 15:55633518-55633540 ATTTTAATACAAATGGAACAAGG - Intronic
1127717618 15:61664975-61664997 GAGTTAATAGGGATAGAACATGG + Intergenic
1127853602 15:62936462-62936484 CAGTTAATACAAATGGAATATGG - Intergenic
1128576441 15:68779005-68779027 TCTTTTATACAGATGAAACATGG + Exonic
1129882678 15:79017522-79017544 TAGGTGATACAGATGCAAGAGGG + Intronic
1134607682 16:15583840-15583862 TTGTTAATACGTTTGGAACATGG + Intronic
1135588087 16:23686387-23686409 TAGTAAAAATAGATGAAACATGG - Intronic
1140024951 16:71278951-71278973 CAGTTAATACAGAAGGAACCTGG + Intergenic
1140845709 16:78885266-78885288 AAGAAAATACAGATGGAAGAAGG - Intronic
1141197272 16:81869429-81869451 TAGTTCAGACAGAGGGATCATGG + Intronic
1142537987 17:633414-633436 AAGTTAATTCTGAAGGAACAGGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1150912317 17:69401316-69401338 TAGTTAATAAAGCAGCAACAGGG + Intergenic
1151050715 17:70975790-70975812 TTATTGATAAAGATGGAACATGG + Intergenic
1153160641 18:2200956-2200978 GAGTTAATACAGAAGGGAGAAGG + Intergenic
1153237475 18:3002074-3002096 TAGTTAATTCACTTGGGACAGGG + Intronic
1153381512 18:4445263-4445285 TAGTTATTAGAGAGGGAATAGGG - Intronic
1153449114 18:5206761-5206783 TAGTTTATATAAATGAAACAGGG + Intergenic
1155626543 18:27841611-27841633 TAGTTAATAAAGCAGCAACAGGG + Intergenic
1156860736 18:41833468-41833490 TGGTTAACAGAGAGGGAACATGG - Intergenic
1161412941 19:4126954-4126976 TAGGCAAAACAGAAGGAACATGG - Intergenic
1162005991 19:7779670-7779692 TACATGATTCAGATGGAACATGG - Intergenic
1163493127 19:17628683-17628705 CGGTTAACACAGATGAAACATGG + Intronic
1163929188 19:20372350-20372372 AAGTTAATACGGACTGAACAAGG + Intergenic
1166869108 19:45860153-45860175 CAGTTAATATATATTGAACACGG + Intronic
1167352206 19:48982481-48982503 TAGGTAATACAGAGGCATCACGG + Intronic
925711835 2:6748635-6748657 TAGTTACAGCAGGTGGAACAGGG - Intergenic
928536787 2:32248924-32248946 TAGTTATGGCAGATGGAACAGGG - Intronic
928646782 2:33362624-33362646 AAGTTAACACAGATGGAAAATGG - Intronic
931936925 2:67208976-67208998 AGGTTAATACTGATAGAACAAGG + Intergenic
931945733 2:67304834-67304856 TGGGTAATACAGTTGAAACATGG + Intergenic
934670919 2:96212156-96212178 TTGTTAATGAAGATGGAAAAAGG - Intergenic
935665388 2:105507754-105507776 TAGTTAAGGCTGGTGGAACAGGG + Intergenic
937174249 2:119911132-119911154 TAGACAATAAAGAAGGAACATGG + Intronic
938003207 2:127763420-127763442 TAGAAAATAGAGAAGGAACATGG - Intronic
942204435 2:173605364-173605386 AAGTTAAGATAGAAGGAACAGGG - Intergenic
942502567 2:176607075-176607097 TACTTAATAAAGCTGGAAGAAGG + Intergenic
943687684 2:190836311-190836333 TAGTTAATACTGATGAAAAGAGG + Intergenic
944805473 2:203276878-203276900 TAGTGAATATAGATAGAAAAAGG + Intronic
944959331 2:204852795-204852817 TATTTAATTGAGATGGAATAGGG + Intronic
944969207 2:204972675-204972697 TAGAAAATACAGCTGGAAAAAGG - Intronic
945337201 2:208606372-208606394 TAATTAATACATATGTTACAGGG - Intronic
946472356 2:219974018-219974040 GAGTAAATACAGAAGGAAAATGG - Intergenic
947126552 2:226874595-226874617 TATTTAACACAGATAGAAAAAGG - Intronic
1172906422 20:38373442-38373464 AAGTTAATATAGAAGGCACAAGG + Intronic
1177309985 21:19377495-19377517 TAGTTAATACAATTGGCACCAGG - Intergenic
1177333820 21:19697832-19697854 TAGTTGAGACAAATGTAACAGGG + Intergenic
1178053463 21:28772782-28772804 TAGTGAATACAGAAGCAATATGG - Intergenic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
950850547 3:16058198-16058220 TAGTAAATATAGATGGCAAAGGG - Intergenic
951547864 3:23846724-23846746 TGGGTAATAGAGATGGAAAATGG + Intronic
951855221 3:27188423-27188445 TAATTAATAATGAAGGAACAGGG - Intronic
953420097 3:42747596-42747618 TGGTTAATAAAGGTGGAACCTGG + Intronic
956573182 3:70719876-70719898 TGGCTAATAAAGAAGGAACAGGG - Intergenic
956693560 3:71899962-71899984 TAGTTAATCCATCTGGAAGAGGG - Intergenic
957038173 3:75314061-75314083 GAGGTAATACTGAGGGAACATGG + Intergenic
957265253 3:77955421-77955443 TAGTTAATTGAGATGTAACGTGG + Intergenic
958430419 3:94033551-94033573 TAGTAAATGCAGAAGGAATATGG + Intronic
962066286 3:131984638-131984660 TAGGTGATACAGTTGGAAGATGG - Intronic
962695773 3:137945743-137945765 TAATTGATACAGATGGATCCTGG + Intergenic
963697232 3:148576841-148576863 TAGTTAATATGGACTGAACAAGG + Intergenic
964517116 3:157523389-157523411 TATTTAATAGAGTTGGAAAAGGG - Intronic
966986023 3:185181074-185181096 GGGTTGATACAGATGTAACAGGG - Intergenic
969579156 4:8053993-8054015 GCAATAATACAGATGGAACAAGG - Intronic
970425151 4:15938942-15938964 TAGTAACTTCAGATGGAAAAAGG - Intergenic
970537966 4:17049147-17049169 TAGTTGATACAGCAGCAACAGGG - Intergenic
971279088 4:25226504-25226526 GAGTTAATACAGACGAAACAAGG - Intronic
971761398 4:30770768-30770790 CAGTTATAACAAATGGAACACGG - Intronic
972185633 4:36524459-36524481 TGGTTTATACAGAAGAAACAGGG - Intergenic
972438739 4:39062437-39062459 TAATGAATAAAGATGAAACACGG - Exonic
973004689 4:44992565-44992587 TAGATAATCCAGATAGAATATGG + Intergenic
973140458 4:46761238-46761260 TAGGTTGTACAGATAGAACAGGG - Intronic
974306142 4:60142751-60142773 GAGTCCATACAGATGGAACCTGG + Intergenic
974409881 4:61526179-61526201 AAGTTCATACAGATGTAATAGGG + Intronic
974743114 4:66033537-66033559 TACTTAAAACATATGAAACATGG - Intergenic
975495931 4:75035934-75035956 TAATTAAACCAGATGGAAAAAGG - Intronic
975755103 4:77564102-77564124 TAATTAATACAAATGGGACCGGG - Intronic
976813477 4:89121259-89121281 TAGTTATGGCTGATGGAACAGGG - Intergenic
977073344 4:92421368-92421390 GAGGAAATACAGATGGAAAAAGG + Intronic
977883409 4:102232898-102232920 TAGTTCTAACAGATGAAACATGG + Intergenic
979478601 4:121187533-121187555 TTGTTAATAAAGAAGGACCATGG + Intronic
979797720 4:124867842-124867864 TATTTAATACATTTGGACCATGG + Intergenic
980092676 4:128458677-128458699 TAGGTAACACAGCTAGAACATGG - Intergenic
980904921 4:138939007-138939029 TGGTGACAACAGATGGAACAAGG + Intergenic
981289744 4:143060471-143060493 TAGCAAATATAGATTGAACAGGG + Intergenic
981779288 4:148407813-148407835 TAGTAAATAGTGATGGGACAAGG - Intronic
983217647 4:165017021-165017043 TAGTGAGGACAGATGGGACAGGG - Intergenic
983403515 4:167295943-167295965 TAGTCAATACATATGTAAAAAGG - Intergenic
983646201 4:169993914-169993936 TCGCTAATTCAGATGGGACATGG + Intronic
983788714 4:171767094-171767116 TAGTAAATATTGATGTAACAAGG + Intergenic
984649960 4:182260399-182260421 TAGTTAACACAGTAGGAAAAAGG - Intronic
985173883 4:187180325-187180347 TATTTAATAGAGATGGAACTAGG - Intergenic
985507084 5:288468-288490 TAGTTTATACATATGAAAGAAGG - Intronic
985740889 5:1616670-1616692 TAGTTTATACATATGCAAGAAGG + Intergenic
990015639 5:51058765-51058787 TAGTTAAAACTGATGGCACTAGG - Intergenic
992408527 5:76482521-76482543 TAGTACATACAGAAGGAAGAGGG + Intronic
996039059 5:118790322-118790344 TAAGTAATACTGATGGATCAAGG + Intergenic
1004225169 6:13778400-13778422 TAGTTAGAAAAGATGGAACCAGG + Intergenic
1004812724 6:19277294-19277316 AAGTTAATATGGACGGAACAAGG + Intergenic
1005221203 6:23590989-23591011 AAGTTGTAACAGATGGAACAGGG - Intergenic
1005985020 6:30866604-30866626 TAGTTAATAAAGAAGCAGCAGGG - Intergenic
1009534014 6:64857684-64857706 TAGTAAATCCATATGGAAAATGG - Intronic
1009771581 6:68150573-68150595 TATTTAATAGAGATAGAACTTGG + Intergenic
1011482246 6:87806580-87806602 TTGTTAAAAGAGAAGGAACAGGG + Intergenic
1015316781 6:131825881-131825903 AAGTTAATAAAGATGAAAAATGG - Intronic
1017056554 6:150441867-150441889 GAAATATTACAGATGGAACAGGG + Intergenic
1017989579 6:159474295-159474317 TAGTTATTACAAATGTAAGAAGG + Intergenic
1018691604 6:166349340-166349362 TAGTTAATAAAGAAGTGACAGGG - Intergenic
1020774373 7:12434862-12434884 TAGTAAACCCAGATGGAATATGG - Intergenic
1021933055 7:25601117-25601139 TAGCTAATTCAGAGGGAAAAGGG + Intergenic
1022241864 7:28520184-28520206 TAGTTCATACTGAAGGAACACGG - Intronic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1023341089 7:39220541-39220563 TAGTTAATACAGAAGCTACATGG + Intronic
1023935703 7:44738299-44738321 GTGTTTATACAGATGGAACTGGG - Intergenic
1027534734 7:79383415-79383437 TAGTTAATACAGGTATAAAATGG + Intronic
1030265777 7:107620579-107620601 TAGGTAATTCTGATGGAAAAAGG - Exonic
1030824871 7:114142718-114142740 TAGTTAATCCACATGGAGAAAGG - Intronic
1032259134 7:130320707-130320729 AAGGAAATACAGATGGAAAATGG - Intronic
1032684168 7:134213864-134213886 TTGTAAATATAGATGGAAAATGG - Intronic
1032832122 7:135638657-135638679 CAGTTAATAGAGATGGACCGCGG + Exonic
1032841084 7:135714125-135714147 TATATAAAACAGATGGAACCAGG - Intronic
1033915253 7:146316108-146316130 TAATTAATACAGAAGGCAAATGG - Intronic
1034509752 7:151524053-151524075 TAGTGACTTCAGAGGGAACACGG + Intergenic
1034582126 7:152053295-152053317 TAATGAATACAGATGGATCACGG - Intronic
1036020019 8:4834142-4834164 TAATTCATACAGATAAAACAAGG + Intronic
1037228285 8:16622268-16622290 TACTTAAGACAGATGGATCCTGG - Intergenic
1038472293 8:27835486-27835508 AAGATAACACAGATGGAAGAAGG - Intronic
1039155402 8:34550373-34550395 AACTTAATACAGATGAATCATGG - Intergenic
1041379767 8:57242532-57242554 TAAATAATACAGTTGGATCATGG - Intergenic
1043183564 8:77116656-77116678 TAGTGAATTTAGAAGGAACAGGG - Intergenic
1043325733 8:79048775-79048797 TAGTTAATACAGAGGAAACTGGG + Intergenic
1043999540 8:86862719-86862741 TAATCAATACAGATGGAGTAAGG - Intergenic
1048099163 8:131329046-131329068 CAGATAATGCAGTTGGAACAAGG - Intergenic
1051046589 9:12882761-12882783 TAGTTTATACAGATGTAGGAAGG - Intergenic
1052388353 9:27849016-27849038 TAGATACTACAGAAGGAACAGGG + Intergenic
1052455686 9:28694406-28694428 TTGTTAATACAGATGTAGAAAGG - Intergenic
1055187945 9:73478647-73478669 GAGTTATGAGAGATGGAACAGGG - Intergenic
1055692846 9:78852133-78852155 TTGTTAGTACAGATGAAAGATGG + Intergenic
1058469314 9:105260942-105260964 TATTGAATACATATGGAACAGGG + Intronic
1186639444 X:11439881-11439903 TAGTAAATACAAATGCAACAAGG - Intronic
1187280081 X:17851841-17851863 TACTTAATACAGCTGCAATAGGG + Intronic
1187651092 X:21407375-21407397 TAGTTAAGACAGATGTACCTGGG + Intronic
1187787107 X:22904185-22904207 TGATTAATGCAGATGAAACATGG + Intergenic
1188812590 X:34669798-34669820 TATGTTATACAGAGGGAACAAGG + Intergenic
1188975729 X:36673028-36673050 AGGTTAATACACTTGGAACAAGG - Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1189915610 X:45851997-45852019 TAGTTAATGTAGAAGAAACAGGG - Intergenic
1195164654 X:102207256-102207278 TAGTTAACACAGAGGTAGCAAGG + Intergenic
1195194205 X:102479835-102479857 TAGTTAACACAGAGGTAGCAAGG - Intergenic
1195789089 X:108561550-108561572 TACCTAATACAGATGGAAAAAGG - Intronic
1195850693 X:109278887-109278909 AAGTTAATACAGACTGAACGAGG - Intergenic
1196055594 X:111351708-111351730 TAGTAAATACAGAAGGCTCAAGG + Intronic
1197169247 X:123412736-123412758 TACCTATTACAGATGGAAAAAGG - Intronic