ID: 1079044591

View in Genome Browser
Species Human (GRCh38)
Location 11:17089907-17089929
Sequence TTGTTGTAGCTTGTATACAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079044591_1079044594 26 Left 1079044591 11:17089907-17089929 CCACTGTATACAAGCTACAACAA 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1079044594 11:17089956-17089978 TTAAAGTTTGTTTGGTTTCTTGG 0: 1
1: 0
2: 6
3: 57
4: 503
1079044591_1079044593 18 Left 1079044591 11:17089907-17089929 CCACTGTATACAAGCTACAACAA 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1079044593 11:17089948-17089970 ATCACAAATTAAAGTTTGTTTGG 0: 1
1: 0
2: 0
3: 24
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079044591 Original CRISPR TTGTTGTAGCTTGTATACAG TGG (reversed) Exonic
903058217 1:20651575-20651597 TTGTTGTTGCTAGTAGACCGAGG - Intergenic
904143450 1:28371150-28371172 TTGCTGAAGCTTGAGTACAGTGG + Intronic
909650230 1:77966745-77966767 TTGTTTTAAATTGTAGACAGTGG - Exonic
914677261 1:149914654-149914676 TTGTTGAAGCCTGTAAACATGGG - Intronic
916933437 1:169603551-169603573 TTTTTGTTGCTTCTAGACAGGGG + Intronic
917771378 1:178283284-178283306 TTATTATAGTTTATATACAGTGG + Intronic
918443920 1:184597318-184597340 TTAATGTTGCTTTTATACAGAGG + Intronic
918610741 1:186487979-186488001 ATGTTGTAAATAGTATACAGTGG + Intergenic
922549994 1:226487751-226487773 TTGTTGTAGCTTTTGTAAATGGG + Intergenic
1064852444 10:19724016-19724038 TTGTCCAGGCTTGTATACAGTGG - Intronic
1065058271 10:21870369-21870391 TTGTTGTTGCTTTTATGGAGGGG - Intronic
1065991962 10:31019341-31019363 TAGTTTTAGCTTTTATACATTGG - Intronic
1070271326 10:74958727-74958749 TTGTTGTTTCTTATATAAAGTGG + Intronic
1071239814 10:83693074-83693096 TGGTTGTGGCTAGTTTACAGAGG - Intergenic
1073859987 10:107727013-107727035 TTGTTTTAAATTGTTTACAGTGG - Intergenic
1075188785 10:120287047-120287069 TTGATCTAGCTTGTTTACAGTGG + Intergenic
1076349990 10:129808961-129808983 TTGTTGCAGCTTGCACACCGTGG - Intergenic
1078653184 11:13214911-13214933 CTGTTGTACCTTGTGCACAGAGG + Intergenic
1079044591 11:17089907-17089929 TTGTTGTAGCTTGTATACAGTGG - Exonic
1079852177 11:25548662-25548684 TTGTTTTAGCTGTTCTACAGGGG + Intergenic
1081211039 11:40334124-40334146 GTGTTTTAGTATGTATACAGAGG + Intronic
1083519684 11:63296754-63296776 TTGTTCTAGCTGGAACACAGAGG + Intronic
1086583234 11:88423474-88423496 TTGTTATAGCCTGAAAACAGAGG - Intergenic
1086966837 11:93036753-93036775 ATGATTTAGGTTGTATACAGTGG - Intergenic
1093956676 12:25228444-25228466 GTGTTGTAGCATGTATATACAGG - Intronic
1095865776 12:46970733-46970755 ATCTGGTATCTTGTATACAGGGG + Intergenic
1101479211 12:105081187-105081209 TTGTTGTCCCTTGTATTCATAGG - Intronic
1105321811 13:19331489-19331511 TGGTTGTAGCTTGTATAAGGGGG + Intergenic
1105392194 13:19990815-19990837 TTGAAGTGGCTTATATACAGTGG - Intronic
1105859610 13:24397478-24397500 TTCTTGTAGGCAGTATACAGTGG - Intergenic
1105876935 13:24564355-24564377 TGGTTGTAGCTTGTATAAGGGGG - Intergenic
1106496180 13:30278180-30278202 TTGTTGTTGATGGTATACATGGG + Intronic
1106777020 13:33017850-33017872 TTGTTTGAGATTGTATAAAGCGG - Intronic
1107900143 13:45004149-45004171 TTGCTGTTGTTTGTGTACAGTGG - Intronic
1108670700 13:52685104-52685126 TTGTTCCAGCTGGAATACAGAGG + Intronic
1109068660 13:57735049-57735071 TTGTTGATGCTTGCATCCAGTGG + Intergenic
1109087655 13:57996563-57996585 TTTTTGTAGCTTTTATAGAGAGG + Intergenic
1112364438 13:98744577-98744599 TTTTTGTATCTTGTGTAGAGAGG - Intronic
1115675604 14:35669817-35669839 TTTTTGTAGGTGGAATACAGAGG - Intronic
1120556069 14:85930984-85931006 TTTATGTTGCTTGTATCCAGTGG - Intergenic
1120574459 14:86164486-86164508 TTGTTGTATTTTGTACACAATGG + Intergenic
1123769362 15:23513046-23513068 TTGTTCAACCTTGTATACAAGGG - Intergenic
1123837599 15:24211962-24211984 TTGTGGTAGGTTGTTTACATTGG - Intergenic
1125294032 15:38183252-38183274 TTGTTGTATCTTCTATATAAAGG - Intergenic
1126278422 15:46913618-46913640 ATGTGGTATATTGTATACAGTGG + Intergenic
1126524521 15:49636160-49636182 TTGTTGTAGCATGTATCAATAGG + Intronic
1130334031 15:82943538-82943560 TTGTTTTAGCTTGTGTCCTGTGG - Intronic
1131025585 15:89138651-89138673 TTGTTGGAGCTTCTCTACAGTGG - Intronic
1134276329 16:12779822-12779844 TAGTTGTACCTTGTAAACCGAGG - Intronic
1135996101 16:27250263-27250285 TTGTTCTAGCTAGTGTACTGAGG - Intronic
1144350823 17:14394455-14394477 TTTTTGCTGTTTGTATACAGAGG + Intergenic
1153149873 18:2079924-2079946 TTGTTTTAGCTGTCATACAGAGG - Intergenic
1156743462 18:40361042-40361064 TAGGTGAAGCTTGTATACAGTGG + Intergenic
1158097537 18:53791165-53791187 TTGTTGTAGATTGTGTTCTGAGG - Intergenic
1158913379 18:62092333-62092355 TTGTTGTAGATATTATACATTGG + Intronic
1163515594 19:17761409-17761431 TTTTTGTAGCTAGTATAAATGGG + Intronic
1165294968 19:34919188-34919210 TTGTTGTATCTTCTCTTCAGGGG + Intergenic
1166575158 19:43830245-43830267 TTGTTGTATTTTTTATAGAGAGG + Intronic
930453116 2:51569525-51569547 TTTTTGTAGCTTCTATAAGGAGG + Intergenic
941355915 2:164490755-164490777 TTGTTTTAGCTGTTTTACAGTGG - Intergenic
945312596 2:208332353-208332375 TTGTTGGAGACTGTATACACTGG + Intronic
1168737415 20:153635-153657 TTTTTGTATCTTTTATAGAGAGG - Intergenic
1170513194 20:17100553-17100575 TTCTTGTTGCTGCTATACAGAGG - Intergenic
1181848887 22:25735640-25735662 TTCTTTTAGCTTGTCCACAGTGG + Intergenic
1184637911 22:45850024-45850046 TTGTTTTAGGTTGCATACTGTGG + Intergenic
951221430 3:20072561-20072583 TTGTTGTTGCTCTCATACAGAGG - Intronic
952854928 3:37762285-37762307 TTTATTTAACTTGTATACAGGGG + Intronic
956967535 3:74479393-74479415 TTGTGGTATCTTGTATAGAGAGG - Intronic
957454789 3:80427678-80427700 TTTTTGTAGCTATTATAAAGGGG - Intergenic
958646316 3:96879757-96879779 TTGTTGTAGCTATTATAAAAGGG + Intronic
960222946 3:115137296-115137318 TTTTAGTACCTTGTATACAAAGG + Intronic
960663450 3:120086623-120086645 TTTTTGTAGTTTTTATAGAGAGG - Intronic
960742130 3:120846056-120846078 TTGTTATAGCTTGTGTTCACTGG + Intergenic
962881512 3:139581523-139581545 TTGTTGTAGCATGTATCCATAGG - Intronic
967681442 3:192368742-192368764 TTGTTGTAGCATGAAAGCAGAGG - Intronic
970731066 4:19104039-19104061 TTTTTGTAGCTATTTTACAGGGG - Intergenic
974027342 4:56745328-56745350 TGGTTCTAGCTGGTTTACAGAGG + Intergenic
974737896 4:65962729-65962751 TTCTTGTAGATTGTATATATTGG - Intergenic
978924650 4:114228581-114228603 TTATTCCTGCTTGTATACAGTGG - Intergenic
980531215 4:134057640-134057662 CTGTTGTAACTTGTCAACAGTGG + Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
983195847 4:164805918-164805940 TTGTTGTAACCTTTATTCAGTGG - Intergenic
984084417 4:175291049-175291071 TGGTTGTAGCTTATTTTCAGTGG + Intergenic
984111466 4:175621611-175621633 GTATTGTAGCTCTTATACAGAGG - Intergenic
984308889 4:178031370-178031392 TTGTTATAGCTTGTACTCAAGGG - Intergenic
987623664 5:20369247-20369269 TTGTTTTAGCTGTTATACACAGG + Intronic
990262450 5:54039197-54039219 TTGTCGTACCTTGTATAGTGAGG + Intronic
990894528 5:60683992-60684014 TTTTTGTAGCTAGTATAAATGGG - Intronic
993359795 5:86960365-86960387 GTGTTGTAGGTTATATACACAGG + Intergenic
994216278 5:97141727-97141749 ATGTTGTATCTTATCTACAGTGG - Intronic
996700079 5:126442117-126442139 TTGTTTTATCTAGTATTCAGTGG - Intronic
1000753000 5:165120168-165120190 TTTATGTAGCTATTATACAGAGG - Intergenic
1001024437 5:168211636-168211658 TTTTTGTTTCTTGTATAAAGGGG - Intronic
1003322991 6:5069014-5069036 TTGTTGTAGCATGTCTGAAGAGG - Intergenic
1010374678 6:75153332-75153354 ATTTTGTAGCTTGTACACTGAGG - Intronic
1011253975 6:85402619-85402641 TTGCTCTAGCTTCTGTACAGGGG + Intergenic
1012084128 6:94801730-94801752 TTTTTGTATTTTGTATACAGTGG + Intergenic
1014039559 6:116810217-116810239 TTGTAATAACTTGTATATAGTGG - Intronic
1014226509 6:118854357-118854379 TTGTTGTTGTTTTTAGACAGAGG + Intronic
1022242417 7:28525923-28525945 GTACTGTAGCTTGTATTCAGGGG + Intronic
1023748407 7:43345331-43345353 TGGTTCTGGCTTGTTTACAGAGG - Intronic
1027800779 7:82746456-82746478 TTGTTGTAGCTACTATACCATGG + Intergenic
1028367993 7:90057079-90057101 TTATTTTAGTTTTTATACAGTGG - Intergenic
1028445718 7:90921197-90921219 TTGTTGCTCCTTGTATACTGTGG + Intronic
1033944695 7:146701530-146701552 TTGATGTAACTTATAGACAGGGG + Intronic
1036451189 8:8869310-8869332 TTGTTCTAGCTTATTTTCAGTGG - Intronic
1037449189 8:18999724-18999746 GTGGTGTAGTTAGTATACAGAGG - Intronic
1038607827 8:29026942-29026964 TTGTTGAAGCTGGTATGTAGGGG + Intronic
1040405082 8:47093117-47093139 TTGTTGTAGTTGGTGTATAGTGG - Intergenic
1040812609 8:51472699-51472721 TTGTTGTAAATTGTGTAAAGTGG - Intronic
1041473000 8:58231878-58231900 TTTTTGTACTTTGTATAGAGAGG + Intergenic
1042387546 8:68194905-68194927 TTGTTGTTGCTTGAACACACTGG - Intronic
1043267081 8:78279788-78279810 TGGTTGTGGCTTGTATCCAAGGG - Intergenic
1043597773 8:81904130-81904152 TTGTTGTAGCTTGGATACCCTGG + Intergenic
1046799356 8:118408193-118408215 CTTTTGTAGCATGTATACAAGGG - Intronic
1047245407 8:123138977-123138999 TTTTTGTAGTTTTTATAGAGAGG + Intronic
1048382797 8:133882929-133882951 TTGTTCTAGCTTGCATGAAGAGG + Intergenic
1048811586 8:138292159-138292181 TTTTTGTAGCTACTATACATGGG - Intronic
1050716140 9:8528617-8528639 TTGTTGTTGCTTGTGTCCACAGG + Exonic
1051482504 9:17575801-17575823 TTATTGTTACTTGAATACAGAGG - Intergenic
1056173808 9:84014390-84014412 TTATTCAAGTTTGTATACAGAGG - Intergenic
1057865615 9:98678091-98678113 TTATTATAGGTTGTAGACAGTGG - Intronic
1058015608 9:100029304-100029326 TTGTTGTTGCTTGTATATTCTGG - Intronic
1185786468 X:2895464-2895486 TTTTTGTATATTTTATACAGAGG - Intergenic
1187660108 X:21535618-21535640 TTTTTGTAGCTATTATAAAGGGG + Intronic
1188851969 X:35143210-35143232 TTGATTTTGGTTGTATACAGTGG + Intergenic
1189591344 X:42515457-42515479 TTGTTGTAGCTTTTTTTCTGTGG - Intergenic
1190583738 X:51916064-51916086 TTCTTGTAGATAGTATACATTGG + Intergenic
1191722269 X:64242314-64242336 TTTTTGTAGCTAGTATAAATAGG + Intergenic
1194711364 X:97240716-97240738 TCGTGGTAGCATGTATACAGTGG + Intronic
1195250926 X:103046281-103046303 TTGTTGTAGCTATTATAAATGGG + Intergenic
1197673272 X:129302277-129302299 TAGATGTAGCTTTTATGCAGGGG - Intergenic
1200869913 Y:8086668-8086690 TTTTTCCACCTTGTATACAGTGG - Intergenic
1200870244 Y:8090001-8090023 TTTTTCAACCTTGTATACAGTGG - Intergenic
1200890358 Y:8317076-8317098 TTTTTCAACCTTGTATACAGTGG + Intergenic
1201692440 Y:16781954-16781976 TTGTTTTAGCTTATACATAGGGG - Intergenic