ID: 1079050112

View in Genome Browser
Species Human (GRCh38)
Location 11:17147501-17147523
Sequence TGAGGTACACACTTACTGTT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079050112 Original CRISPR TGAGGTACACACTTACTGTT CGG Exonic
900198130 1:1387765-1387787 TGAGGCACACACCTCCTCTTAGG + Exonic
909396238 1:75173828-75173850 AGAAGTACACACTTGCAGTTAGG - Intergenic
911325645 1:96468395-96468417 TGAAGTACACACTTAATATTTGG - Intergenic
913241381 1:116832940-116832962 TGAGGTCCCCACTTTATGTTTGG - Intergenic
920213079 1:204342786-204342808 TGAGCTGAGCACTTACTGTTGGG - Intronic
923166373 1:231367618-231367640 TTAGGTACGCAATAACTGTTTGG - Exonic
923215413 1:231844147-231844169 TTAGGGACACACTAACTCTTTGG + Intronic
1064181329 10:13118613-13118635 TGAGGTACACAGTGACTGTTTGG + Intronic
1065321758 10:24516570-24516592 TGAGGAAGACACTGAGTGTTTGG + Intronic
1070675918 10:78411124-78411146 TGAAGCACCCACTTGCTGTTGGG - Intergenic
1072143365 10:92610688-92610710 TGAGCTACAAAATTATTGTTAGG + Intronic
1074682251 10:115919089-115919111 TGAGGTCCACAGTTCCAGTTGGG + Intronic
1074920188 10:118000547-118000569 TGTGGTACAAACTTAGTATTAGG - Intergenic
1079050112 11:17147501-17147523 TGAGGTACACACTTACTGTTCGG + Exonic
1079320957 11:19450959-19450981 TGAGGTACAGAGTTACTTTTAGG + Intronic
1083508473 11:63183998-63184020 TGCAGTACACATTCACTGTTGGG + Intronic
1085959138 11:81438901-81438923 TGAGGAAAACAGTTTCTGTTTGG + Intergenic
1087587566 11:100141373-100141395 TGAGGAACACACGAACAGTTGGG + Intronic
1091922364 12:4315649-4315671 TGAGGTACACATGAATTGTTGGG - Intergenic
1093528966 12:20137974-20137996 TGAGGTAAAAACTAATTGTTTGG + Intergenic
1096191456 12:49622892-49622914 TGAGGTACATGCTTGCTGTGCGG - Intronic
1098809134 12:75061840-75061862 ACAGGTACACAGTTACTTTTTGG - Intronic
1098916292 12:76260228-76260250 TAAGGTAAACACTAACTGTGGGG + Intergenic
1101358226 12:104001091-104001113 ACATGTACACACTTACAGTTAGG + Intronic
1102178361 12:110892997-110893019 TGAGGCGCACACTTATTTTTGGG + Intronic
1103162171 12:118738596-118738618 TGAGGTTCACACTTTTTCTTGGG + Intergenic
1103837178 12:123831567-123831589 TTAGATACACACGTACTATTAGG - Intronic
1104276519 12:127333587-127333609 TGAGGTCCACACTTGCTGGGAGG - Intergenic
1108612609 13:52098890-52098912 TGAGGTACAAGCTTATTGTTTGG - Intronic
1109000575 13:56797637-56797659 TCATGCACACACTTAATGTTAGG + Intergenic
1109464141 13:62706429-62706451 TGAGGTACACTATTACTTTATGG - Intergenic
1120714096 14:87821915-87821937 TGAGGTGCACCCTTACCCTTGGG - Intergenic
1129608366 15:77035675-77035697 TGCTGTCCACACTTGCTGTTGGG - Intronic
1130938980 15:88492161-88492183 TAAGGTAACCACTTACTGTCAGG + Intergenic
1131275706 15:90978824-90978846 TGAGGTCCACCCTTAGTGGTGGG + Intronic
1133445469 16:5857394-5857416 TGAGGTATACACACACTGTTGGG + Intergenic
1138308716 16:56004652-56004674 TGAATTACAGACATACTGTTGGG - Intergenic
1147578863 17:41617571-41617593 TGGGGTCCACAATTACTGATGGG - Intergenic
1148647743 17:49229058-49229080 TCAGTTAAACACTTATTGTTTGG + Intronic
1151524475 17:74654930-74654952 TGAGGCACACACTTAACGTTTGG - Intergenic
1151792315 17:76315408-76315430 TGAGATACACAGTGCCTGTTGGG - Intronic
1155012938 18:21800188-21800210 TGATTTACACACTTACATTTTGG + Intronic
1159198838 18:65156581-65156603 TGAAGTGGACACATACTGTTGGG - Intergenic
1159383917 18:67697695-67697717 TGAGGTACACAGATATTTTTAGG - Intergenic
926567513 2:14492907-14492929 TGAGGTACTCAATTGCTGATAGG - Intergenic
926663348 2:15492828-15492850 TTTGGTCCACAGTTACTGTTGGG - Intronic
926719450 2:15948688-15948710 TTAGGTACACAATTAATGTGAGG - Intergenic
928982691 2:37153269-37153291 ATGGGTACACACTTTCTGTTTGG - Intronic
929267494 2:39935087-39935109 TAAGGTACTCATTTCCTGTTGGG - Intergenic
930268321 2:49226227-49226249 TGAATTACACAGTCACTGTTTGG - Intergenic
935036099 2:99375472-99375494 TGGGTTACACCCTTACTGTGGGG - Intronic
937193658 2:120130167-120130189 TGAGGTGCTCACTAACTCTTAGG - Intronic
937827391 2:126381663-126381685 TGGGGAACACACCCACTGTTAGG - Intergenic
941116838 2:161481314-161481336 TCAGGTATACACTTTCTGTTTGG - Intronic
943983818 2:194593565-194593587 TCAGGTACACACTGAATATTGGG - Intergenic
945862913 2:215144333-215144355 GAAGGTACACACTTACTGCAAGG + Intergenic
945924539 2:215789865-215789887 TGAACTACACAAATACTGTTTGG + Intergenic
947044404 2:225964087-225964109 TAATGTACACACATACTATTTGG + Intergenic
1171006372 20:21469149-21469171 TGAGGGAAACAATTACTCTTCGG + Intergenic
1174848638 20:53969008-53969030 TGTGGCTCACACTTACTTTTCGG - Intronic
1184967760 22:47993879-47993901 TGAGGAAGACACTCACTGTCTGG + Intergenic
949194424 3:1288235-1288257 TGATTTACACATCTACTGTTTGG - Intronic
949793635 3:7822481-7822503 TGAGGTACACAGTTCTAGTTTGG - Intergenic
951698697 3:25472436-25472458 TCAGGTACAGACCTACTTTTAGG + Intronic
952872723 3:37916143-37916165 TTAGGGACACTCTTCCTGTTGGG - Intronic
959898061 3:111627533-111627555 TGAGGCAGACATTTGCTGTTTGG + Intronic
961440230 3:126948366-126948388 TCCGGGACACACATACTGTTGGG + Intronic
963337325 3:143990381-143990403 TTTGGTACATATTTACTGTTAGG + Exonic
964884281 3:161463703-161463725 TCAGCTACACTCTTTCTGTTTGG + Intergenic
965158825 3:165103660-165103682 TGAAGTACACAATTATTATTTGG - Intergenic
965424191 3:168500733-168500755 TGAGGTCCACAATTTCTGTCTGG - Intergenic
967780924 3:193438484-193438506 TGAGGTACGCACTCAATGTTTGG + Exonic
969465509 4:7353978-7354000 TGGGGTGCACACTTACTTCTTGG - Intronic
971624880 4:28906616-28906638 TGAAGTACAGACTTAGTGTGGGG + Intergenic
972205016 4:36761064-36761086 TGAACTACACACTTATTTTTAGG - Intergenic
974431750 4:61807039-61807061 TGAGTCACACACATACTGATTGG + Intronic
977663803 4:99621547-99621569 TCAGATACACATTTACTGTCTGG + Intronic
977772781 4:100879622-100879644 TGAGAGACACACTCACTGTGAGG + Intronic
981064554 4:140469073-140469095 TAAGGGACACAAATACTGTTTGG - Intronic
981145863 4:141323372-141323394 TGCTGTACACACAAACTGTTAGG - Intergenic
981316212 4:143342227-143342249 TGAGATTCAGAATTACTGTTAGG + Intronic
984951232 4:185009271-185009293 TGTGGTACCCTCTTACTGTAGGG + Intergenic
985176361 4:187207232-187207254 TCAGATACACTCTTACTGGTAGG - Intergenic
993834275 5:92797418-92797440 TAAGGTATAAACATACTGTTAGG + Intergenic
1000822206 5:165998513-165998535 AGAGATACACAATTTCTGTTTGG - Intergenic
1006080659 6:31564144-31564166 TGAGGTACAACCTTACTCCTGGG + Intergenic
1008180867 6:48327018-48327040 TGAGGTCCATTCATACTGTTGGG + Intergenic
1011184648 6:84660823-84660845 TTAGGTTAACAATTACTGTTGGG + Intergenic
1016094915 6:140023390-140023412 TGAGGTACAAAATAACTTTTGGG - Intergenic
1018071322 6:160167046-160167068 TGAGGTCCACACTGGCTGCTGGG + Intergenic
1022346028 7:29515546-29515568 TGAGGTAGACACTGAATATTTGG + Intergenic
1031691059 7:124788287-124788309 GGAGGTGCACACTTTTTGTTTGG + Intronic
1032612175 7:133426368-133426390 AGAGTTAAACACTTATTGTTTGG + Intronic
1040609936 8:48973860-48973882 TCAGGGACACTCTTATTGTTAGG - Intergenic
1041601300 8:59719829-59719851 TGAGGTAAACAGTTCCAGTTTGG - Intergenic
1041763112 8:61388082-61388104 TGAGCTACACACTTATGATTTGG - Intronic
1043052552 8:75401807-75401829 AGAGGTACCTACTTCCTGTTTGG - Intergenic
1043131630 8:76470297-76470319 TGAAGACCACACATACTGTTAGG + Intergenic
1048779121 8:137981953-137981975 TGATGTACACACTTTCTACTTGG + Intergenic
1052791539 9:32879607-32879629 TCAGGTCCTCACTCACTGTTTGG - Intergenic
1055334096 9:75214522-75214544 TGATGTATACACTTTCTTTTAGG - Intergenic
1059878468 9:118662503-118662525 TGAGATTCTCACTTGCTGTTGGG + Intergenic
1060696043 9:125709933-125709955 TGAGGTATACTCATACTGGTAGG - Intergenic
1187202826 X:17152255-17152277 TGAAGTACACAGTTGCTTTTAGG + Exonic
1188230580 X:27658145-27658167 TGTGGTACACACTTACTTTTCGG - Intronic
1188403860 X:29782595-29782617 TCAGGTACACACATACTATATGG + Intronic
1193901989 X:87191577-87191599 TGAGATAAAGAATTACTGTTTGG - Intergenic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic
1200786636 Y:7266434-7266456 TGAGCTACATTCTTACTGATGGG - Intergenic