ID: 1079052299 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:17172794-17172816 |
| Sequence | AATCACCGATGATGAAGTGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 134 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 6, 4: 126} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1079052299_1079052304 | 15 | Left | 1079052299 | 11:17172794-17172816 | CCTCCACTTCATCATCGGTGATT | 0: 1 1: 0 2: 1 3: 6 4: 126 |
||
| Right | 1079052304 | 11:17172832-17172854 | TTAACTTATTTACTTGCTTAGGG | 0: 1 1: 0 2: 3 3: 51 4: 427 |
||||
| 1079052299_1079052303 | 14 | Left | 1079052299 | 11:17172794-17172816 | CCTCCACTTCATCATCGGTGATT | 0: 1 1: 0 2: 1 3: 6 4: 126 |
||
| Right | 1079052303 | 11:17172831-17172853 | GTTAACTTATTTACTTGCTTAGG | 0: 1 1: 0 2: 3 3: 28 4: 253 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1079052299 | Original CRISPR | AATCACCGATGATGAAGTGG AGG (reversed) | Intronic | ||