ID: 1079052299

View in Genome Browser
Species Human (GRCh38)
Location 11:17172794-17172816
Sequence AATCACCGATGATGAAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079052299_1079052304 15 Left 1079052299 11:17172794-17172816 CCTCCACTTCATCATCGGTGATT 0: 1
1: 0
2: 1
3: 6
4: 126
Right 1079052304 11:17172832-17172854 TTAACTTATTTACTTGCTTAGGG 0: 1
1: 0
2: 3
3: 51
4: 427
1079052299_1079052303 14 Left 1079052299 11:17172794-17172816 CCTCCACTTCATCATCGGTGATT 0: 1
1: 0
2: 1
3: 6
4: 126
Right 1079052303 11:17172831-17172853 GTTAACTTATTTACTTGCTTAGG 0: 1
1: 0
2: 3
3: 28
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079052299 Original CRISPR AATCACCGATGATGAAGTGG AGG (reversed) Intronic