ID: 1079054489

View in Genome Browser
Species Human (GRCh38)
Location 11:17194010-17194032
Sequence CCAAAGCCTGCATCTTCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 211}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079054489_1079054498 26 Left 1079054489 11:17194010-17194032 CCTAAAGAAGATGCAGGCTTTGG 0: 1
1: 1
2: 2
3: 19
4: 211
Right 1079054498 11:17194059-17194081 TATGAAGGCCCTTGTAAAGGAGG 0: 1
1: 0
2: 1
3: 11
4: 183
1079054489_1079054492 -3 Left 1079054489 11:17194010-17194032 CCTAAAGAAGATGCAGGCTTTGG 0: 1
1: 1
2: 2
3: 19
4: 211
Right 1079054492 11:17194030-17194052 TGGCAGGCCATCAGTCCACGTGG 0: 1
1: 0
2: 0
3: 5
4: 79
1079054489_1079054497 23 Left 1079054489 11:17194010-17194032 CCTAAAGAAGATGCAGGCTTTGG 0: 1
1: 1
2: 2
3: 19
4: 211
Right 1079054497 11:17194056-17194078 GGCTATGAAGGCCCTTGTAAAGG 0: 1
1: 0
2: 1
3: 5
4: 127
1079054489_1079054493 2 Left 1079054489 11:17194010-17194032 CCTAAAGAAGATGCAGGCTTTGG 0: 1
1: 1
2: 2
3: 19
4: 211
Right 1079054493 11:17194035-17194057 GGCCATCAGTCCACGTGGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 86
1079054489_1079054495 11 Left 1079054489 11:17194010-17194032 CCTAAAGAAGATGCAGGCTTTGG 0: 1
1: 1
2: 2
3: 19
4: 211
Right 1079054495 11:17194044-17194066 TCCACGTGGTGAGGCTATGAAGG 0: 1
1: 0
2: 0
3: 14
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079054489 Original CRISPR CCAAAGCCTGCATCTTCTTT AGG (reversed) Intronic
900105778 1:980465-980487 CCACAGCTCGCCTCTTCTTTCGG + Exonic
901011900 1:6206879-6206901 CCGAAGCCTGCAACTTCTGGCGG - Intronic
902198267 1:14814512-14814534 CCAAAGGCTGCATCTTCTATTGG + Intronic
903780556 1:25817701-25817723 CCAAAGTCTGCATCTGGATTTGG + Exonic
907917982 1:58888160-58888182 CCTAAACCTGCTTCTTTTTTTGG + Intergenic
908914001 1:69104957-69104979 CCAAAGCCTGCAAACTGTTTTGG - Intergenic
909173256 1:72321881-72321903 CCAAATCCTGAATCTAATTTAGG + Intergenic
909249032 1:73327906-73327928 CCAAAGCCAGCAGCCTCATTTGG + Intergenic
910051716 1:82982064-82982086 AGAAAGCCTCCATGTTCTTTTGG - Intergenic
910160322 1:84265426-84265448 CCAGAGCCTGCATCTTCTTTAGG + Intergenic
912183061 1:107241678-107241700 CCAATGACTGCATTTTCTTGAGG - Intronic
916480565 1:165210862-165210884 CAAAAGACTGTATCTGCTTTAGG + Intronic
916607302 1:166355703-166355725 TCATATCCTGCATCCTCTTTGGG - Intergenic
916850540 1:168698626-168698648 GCAATGTCTGCAACTTCTTTTGG + Intronic
917017079 1:170544747-170544769 CTAAAGCCTGCAACTCCTTCTGG - Exonic
917839263 1:178964254-178964276 TCATAACCTGCATCTTATTTAGG + Intergenic
917979889 1:180262548-180262570 CCAAAGTATGCAACTTTTTTTGG + Intronic
918222050 1:182444214-182444236 CCAAAGGATGCATTTGCTTTAGG - Intergenic
919658870 1:200223713-200223735 CCAAAGCCTGGACTTTCTTGTGG - Intergenic
919827831 1:201516377-201516399 CCAAAGTCTCCTTCCTCTTTGGG - Intergenic
920578889 1:207086024-207086046 TCCAAGCCTGCATATTCTTCAGG - Intronic
921087670 1:211811284-211811306 CCCAAGCCTGCCTTATCTTTTGG - Intronic
922505939 1:226125675-226125697 CCAAATCCTGCATCTTCTGCAGG - Intergenic
923035700 1:230283716-230283738 CCTCAGCCTGGGTCTTCTTTGGG - Intergenic
923050346 1:230387423-230387445 CCCAAGCCTGCAGCCTGTTTGGG - Intronic
923107652 1:230867313-230867335 CAAACGCCTGAATCTTCTGTAGG - Intronic
1064323229 10:14325415-14325437 ACAAAGTCTGGATCTTGTTTGGG - Intronic
1065220345 10:23490195-23490217 CAAAAGGCTTCATATTCTTTTGG + Intergenic
1065444396 10:25782860-25782882 TCAAAGCCTGCATAGTATTTAGG + Intergenic
1065739753 10:28786431-28786453 CCAGAGCCCGCATCTCCTTTAGG + Intergenic
1069786948 10:70994571-70994593 TCAAAGCCGGCAGCCTCTTTGGG + Intergenic
1070718337 10:78738924-78738946 CCATAGGCTGCATCAGCTTTAGG - Intergenic
1070747425 10:78942806-78942828 CAAGAGTCTGCACCTTCTTTGGG - Intergenic
1070958428 10:80481196-80481218 ACAAAGACTGGATCTTCTTTAGG + Intronic
1074717265 10:116231159-116231181 CCAATCCCTGCATCTTTTTCAGG - Intronic
1075542233 10:123324658-123324680 ACAAAGCCTCAATTTTCTTTGGG + Intergenic
1076321041 10:129581699-129581721 CCAAAGCCCTCTTCCTCTTTAGG - Intronic
1077336442 11:2007027-2007049 CCTAAGCCTGCAGCTCCTCTGGG + Intergenic
1078549355 11:12269699-12269721 TCAAAGCTTGCATCTTCCTCAGG + Intergenic
1078709713 11:13779231-13779253 CCAAAGCCTGCATCTCTCCTTGG + Intergenic
1078961099 11:16272891-16272913 TCAAGGCCAGCATCTTCTTCAGG - Intronic
1079054489 11:17194010-17194032 CCAAAGCCTGCATCTTCTTTAGG - Intronic
1080673981 11:34407477-34407499 CCAGGGCCTTGATCTTCTTTTGG - Intergenic
1081229207 11:40564020-40564042 CAAATTCCTGCAGCTTCTTTGGG - Intronic
1082834352 11:57640592-57640614 CCCACCCCTGCATCTCCTTTTGG - Intergenic
1083860175 11:65416219-65416241 CCGAGGCCTGCACCTCCTTTGGG - Intergenic
1084314507 11:68337247-68337269 CCAAAGCCTGGGTCTGCTTCCGG - Intronic
1084747444 11:71182120-71182142 CCCAAGGCAGCATCTTCTTTAGG + Intronic
1084981153 11:72829426-72829448 CCGAAGCCTGAAGCTTCCTTCGG + Exonic
1085706374 11:78789753-78789775 GAAAAGCCTGCCTCTTCTCTTGG - Intronic
1087405429 11:97723554-97723576 ACAAAGCCTGCAACTAATTTGGG + Intergenic
1089565420 11:119368793-119368815 CCAACCCCTGGATCTTCTTGGGG + Intronic
1089808154 11:121110208-121110230 CAAAAGCCTGCAGCTTGTTTGGG + Intronic
1090162673 11:124511329-124511351 CCAAAGCCAGCAACTTACTTTGG + Intergenic
1090925353 11:131244993-131245015 CCAATGCCTGCAGCTGCATTTGG - Intergenic
1091324005 11:134670696-134670718 TCAAAGCCAGGATATTCTTTAGG - Intergenic
1202819426 11_KI270721v1_random:62209-62231 CCTAAGCCTGCAGCTCCTCTGGG + Intergenic
1092053488 12:5490156-5490178 CCAGGGCCTGTATTTTCTTTGGG + Intronic
1092832174 12:12455239-12455261 CCAAAGGCTGCCTCTTTTTAGGG - Intronic
1092854710 12:12662230-12662252 CCACAGCCAGCATCTTCTTTGGG - Exonic
1094266381 12:28564955-28564977 TGTTAGCCTGCATCTTCTTTAGG + Intronic
1095715018 12:45334673-45334695 GAAAAGCCTGCTTGTTCTTTAGG - Intronic
1097776829 12:63656992-63657014 CCAATATCTGTATCTTCTTTGGG + Intronic
1098992717 12:77082228-77082250 CCAAATACTGCATGTTCTCTGGG + Intergenic
1101918643 12:108915414-108915436 CCAAATACTGCATGTTCTCTGGG - Intronic
1104514887 12:129415858-129415880 CCAGAGCCTGGTTCTCCTTTGGG + Intronic
1105454417 13:20526907-20526929 CCAAAGCTTCCATCTTCTGATGG + Intergenic
1105947286 13:25201190-25201212 TCACAGCTTGCTTCTTCTTTGGG + Intergenic
1107064463 13:36197585-36197607 CAAAAGCCAGTATCATCTTTGGG + Intronic
1107083180 13:36396854-36396876 ACAAAGGTTGCAGCTTCTTTGGG + Intergenic
1111300841 13:86348427-86348449 CCAAAGACTGCATCCTTTTCAGG - Intergenic
1112440565 13:99421858-99421880 CCACACCCTGCATCTCATTTTGG + Intergenic
1112837736 13:103536340-103536362 CGAAAGCCTGCATTTCCTTTGGG - Intergenic
1113322668 13:109250910-109250932 CCAAAACCTGCCTTTTGTTTGGG + Intergenic
1114426529 14:22628581-22628603 CCACAGCCTGCATCTGCCTGTGG - Intergenic
1116364384 14:44041220-44041242 CAAATGCCTGCAGCTTTTTTTGG - Intergenic
1117557548 14:56901533-56901555 CACAACCCTGCATTTTCTTTTGG + Intergenic
1117708282 14:58496575-58496597 CCTTAGCCTGACTCTTCTTTAGG - Intronic
1119652631 14:76394499-76394521 CACAAGGCTGCATCCTCTTTGGG - Intronic
1121403892 14:93706316-93706338 TCAAAGCCTGGCTCTTCTATAGG - Intronic
1124461401 15:29895579-29895601 AGAAAGCCTCCATCTTCTTACGG - Intronic
1125961430 15:43833082-43833104 CCAAAGGCTGCATACTCATTGGG + Intronic
1126397591 15:48235484-48235506 TTAAAACCTGCATCTTGTTTAGG - Intronic
1126615996 15:50580480-50580502 CAAAACCTTGCATCTGCTTTTGG - Intronic
1126743558 15:51802082-51802104 CCTCAGCCTGCATCTTTTTTTGG - Intronic
1127397366 15:58553293-58553315 CCAATGCCTGCCCCTTCTGTGGG - Intronic
1127658466 15:61077645-61077667 GGAAAGCCTGCATCTTTCTTAGG - Intronic
1127705605 15:61544625-61544647 TTATAGCCAGCATCTTCTTTAGG - Intergenic
1128866973 15:71121395-71121417 CCTGAGCCTGCATCTCCTTTGGG + Intronic
1132041006 15:98524657-98524679 CCAAGGTCAGCATCTTCTTGGGG - Intergenic
1133133484 16:3692897-3692919 CCAAAACTTGCCTATTCTTTAGG + Intronic
1135669709 16:24364878-24364900 CCAAGGGAAGCATCTTCTTTTGG - Intergenic
1135877622 16:26217777-26217799 CCAAAATCTGCATCTTGGTTTGG + Intergenic
1140349703 16:74250720-74250742 TCAAAGCCTGTGTCTTGTTTTGG - Intergenic
1141539636 16:84709824-84709846 TCAAAGCCTGCAGCCTGTTTGGG + Intronic
1143332288 17:6146586-6146608 CCAAAACTTTCTTCTTCTTTAGG + Intergenic
1143514357 17:7411900-7411922 CCAAAACCAGCCTTTTCTTTGGG + Intronic
1150494520 17:65597095-65597117 CTGTAGCCTGCAGCTTCTTTTGG - Intronic
1150722602 17:67626323-67626345 CTAATTCCTGCATGTTCTTTGGG - Intronic
1150967690 17:69990260-69990282 CCAAAGCCTGTCTGTTCTTCTGG - Intergenic
1155319810 18:24608192-24608214 TCAAAGGCTGCTTCTTCCTTTGG + Intergenic
1157322101 18:46642498-46642520 CCAAGGTCTGCATCTACTTGGGG - Intronic
1157713482 18:49866010-49866032 ATAAAGCATGCATATTCTTTTGG - Intronic
1160114449 18:76064383-76064405 GCAGAGCCTGGATCTTGTTTAGG + Intergenic
1165304552 19:34995481-34995503 CCCAAGCCTGTTTCCTCTTTTGG - Intronic
1165336337 19:35172635-35172657 CCAAACCCTGCAGTTTCTTTGGG - Intergenic
925428887 2:3774157-3774179 CCAAAGCCTAAAGCTTCATTAGG - Intronic
926948754 2:18218136-18218158 CCAAAGCCTGAGTCTTCATGTGG + Intronic
927242954 2:20934745-20934767 CTTAAGCCTCCATCTTCTTGGGG + Intergenic
930932650 2:56906142-56906164 CAAAAGTCTGCATTTGCTTTTGG - Intergenic
931421621 2:62133286-62133308 CCAACTCCTGAATGTTCTTTTGG + Intronic
932907907 2:75773858-75773880 CCAATGCCTGCAGCTTCTGAGGG + Intergenic
932927393 2:75992892-75992914 GCAAAGCCTTCATGATCTTTGGG - Intergenic
932998585 2:76890444-76890466 CCAGATCCTACATCCTCTTTTGG - Intronic
934593068 2:95575604-95575626 ATAAAGACTGCATTTTCTTTAGG - Intergenic
934721733 2:96582634-96582656 CCAATGTCTGCATCATCTCTGGG + Intergenic
935568795 2:104637208-104637230 CCAAAGCCTGCAACTTCCCATGG + Intergenic
935678244 2:105614661-105614683 CCAAGGCCTTCATCTTGTTTTGG + Intergenic
936644642 2:114354897-114354919 CCCAAGCTTGAATTTTCTTTGGG + Intergenic
936768531 2:115883951-115883973 AGAAAGCCGGCATATTCTTTGGG + Intergenic
938735176 2:134179457-134179479 CCCAACCCTGTATCTTCTCTAGG + Intronic
940151311 2:150605109-150605131 CTAATGCATGCATTTTCTTTAGG - Intergenic
944364685 2:198904034-198904056 CCAAAGCCTGAATTTCATTTAGG + Intergenic
944501747 2:200368180-200368202 ACCAAGTATGCATCTTCTTTTGG - Intronic
944669771 2:201985094-201985116 CCAGGGCCGGCATCTTCTGTCGG + Intergenic
945474100 2:210261615-210261637 CCAAAGCAGGCATCTTATTCTGG - Intergenic
945896078 2:215483006-215483028 CCAAAGCCTTCCTCTCCTTTAGG + Intergenic
946377167 2:219318475-219318497 CCAACGCCTGTATTTTTTTTGGG + Intergenic
947226312 2:227843806-227843828 CTAAAGCCTGCATGTGATTTTGG + Intergenic
948384136 2:237571190-237571212 GGAAAGCCTGCCTGTTCTTTAGG + Intergenic
1171079812 20:22167996-22168018 CCCCAGCCTACAGCTTCTTTAGG - Intergenic
1171308188 20:24123894-24123916 CCCAAGCCTGCATAAGCTTTGGG - Intergenic
1172167712 20:32909006-32909028 CCCAAGCCTCCACCTTCTTGTGG - Intronic
1176967135 21:15223985-15224007 ACACAGCCTTCATCTTCTTAAGG + Intergenic
1178500640 21:33123278-33123300 CCAAAGCCAGCTTATCCTTTTGG - Intergenic
1179949193 21:44700159-44700181 CCAAAATCAGCATCTTCTCTTGG - Intronic
1181153278 22:20900585-20900607 CCAAGGTTTGTATCTTCTTTAGG - Intergenic
1182601822 22:31471120-31471142 CCAAAGCCTTCTTCTTCTGAGGG + Intronic
1182958819 22:34452952-34452974 CCACATCCAGGATCTTCTTTGGG - Intergenic
1182961320 22:34478028-34478050 CCAAATCCAGCATCCTCTCTTGG - Intergenic
1183976000 22:41512717-41512739 CCCAAGGATGGATCTTCTTTTGG + Intronic
1184634949 22:45820276-45820298 TCAGAGCTTGCATCTTCCTTAGG - Intronic
1184667543 22:45996781-45996803 GCAGAGCCTGCCTCTTCTCTTGG + Intergenic
949931815 3:9084483-9084505 CCTAAGTCTGCTTCCTCTTTTGG - Intronic
950025631 3:9818084-9818106 CCAAAGCCTGCAGCCTTTTTTGG - Intronic
950368153 3:12503892-12503914 CCAAAGCCTGCTGCTTCCCTTGG - Intronic
950423106 3:12910271-12910293 GCCAAGCCTGCAGCTTCTATAGG - Intronic
950437046 3:12986374-12986396 GCAGAGCCTGCAGCTTCCTTGGG + Intronic
950739730 3:15040657-15040679 CAAGAGCCTGCTTCTCCTTTTGG + Intronic
955339596 3:58115263-58115285 CCAAATTCTCCATATTCTTTAGG + Intronic
955813041 3:62811419-62811441 CCAATGCATGCATTTTCTTGAGG - Intronic
956413736 3:69005365-69005387 CCAAAGACTGCATCTGCTGAAGG + Intronic
958189420 3:90165708-90165730 CCAAAGACCCCACCTTCTTTGGG + Intergenic
958411727 3:93825317-93825339 CCAAAGACCCCACCTTCTTTGGG + Intergenic
961613918 3:128163893-128163915 CCAAAGCGAGCATATGCTTTGGG + Intronic
963935908 3:151053052-151053074 CCCAAGTCTGCAACCTCTTTAGG + Intergenic
964549517 3:157871202-157871224 CAGAAGCTTGTATCTTCTTTTGG - Intergenic
967512478 3:190327725-190327747 CCAAAGACTGCATCCTCATCAGG + Intronic
967730423 3:192901916-192901938 GGAAAGCCTGCATCTTCGTAAGG + Intronic
969917163 4:10502090-10502112 CCAAAGGCACCATCTGCTTTGGG + Intronic
970090991 4:12407725-12407747 CCATAGCCAGCATATTCTTCAGG - Intergenic
970600737 4:17639311-17639333 CCATGGCCTGCATCTCCTTCCGG + Exonic
972577963 4:40369443-40369465 TGAAAGCCTGATTCTTCTTTGGG + Intergenic
973979812 4:56298628-56298650 CCAAGTCCTGCAGCTTCTCTTGG - Intronic
974163099 4:58165784-58165806 ACAAAGCCTGCCCATTCTTTGGG + Intergenic
975018474 4:69455893-69455915 CCAGCGACTGCATTTTCTTTGGG - Intergenic
978724983 4:111959081-111959103 CCAAAGACTGTATCTTATTTTGG - Intergenic
978896618 4:113896042-113896064 CCAAAGCCTGCTTCAGCTTTGGG - Intergenic
979733355 4:124052240-124052262 CTAAAGCCTGTGACTTCTTTGGG - Intergenic
979762623 4:124425815-124425837 ACAAAGACTGCAGCTTTTTTTGG - Intergenic
980897940 4:138877549-138877571 CCAAAGGCACCATCTTCTGTGGG - Intergenic
982533949 4:156585163-156585185 CCAAAGCCTGTAAATTTTTTTGG + Intergenic
985676080 5:1232034-1232056 CCAAACCCTGCCTCTGATTTTGG - Intronic
992715815 5:79510592-79510614 TGTTAGCCTGCATCTTCTTTAGG - Intronic
996370154 5:122744662-122744684 CCAAAGGATTCATCTTGTTTTGG - Intergenic
996482506 5:123990869-123990891 CCAAACCCTGCTTTTTTTTTAGG - Intergenic
997466407 5:134090836-134090858 TTAAAGCCTTCATCTTCCTTTGG + Intergenic
997754294 5:136381319-136381341 CCAAGGCCTGTCTCTTCTTTAGG + Intronic
1001120666 5:168977392-168977414 CCATTGTCTTCATCTTCTTTGGG + Intronic
1001865914 5:175105302-175105324 CCCAAGCCTGCATCTCCTTCAGG - Intergenic
1004080165 6:12384242-12384264 CCAAGACCTGCAGCTTATTTGGG + Intergenic
1004777634 6:18865882-18865904 CCAAAACCCTCATCTTCTCTAGG - Intergenic
1006112996 6:31760015-31760037 CCAAAGGCTACATCTTCTGGGGG + Intronic
1007889879 6:45278530-45278552 CAAATGACTTCATCTTCTTTTGG + Intronic
1008410648 6:51174699-51174721 CCAGAGCCTGCAGCCTCTTCAGG - Intergenic
1011673566 6:89708581-89708603 CCAGAGCCTGCATATTCCATCGG + Exonic
1012608074 6:101182813-101182835 CCAGAGCCTGCTCCTTTTTTTGG + Intergenic
1013231585 6:108165870-108165892 ACAGCGCCTGCATTTTCTTTGGG + Intergenic
1013860118 6:114625611-114625633 CTAAAGCCTGTATTTTCCTTTGG + Intergenic
1014641681 6:123918734-123918756 ATAATGCCTGCATCCTCTTTAGG + Intronic
1015779864 6:136854029-136854051 CCCAAGCCTGCATCCTTCTTTGG + Intronic
1016290435 6:142522988-142523010 CCAAATCCTACATGTTCTTTAGG + Intergenic
1017301422 6:152863916-152863938 CCAAAGGCTTCATCTTCAATGGG + Intergenic
1018148200 6:160913032-160913054 CCAAAGCCTTCAGCTTCTGGGGG - Intergenic
1019723016 7:2584712-2584734 CCAAAGCTTCCATCTGCTTCTGG + Intronic
1019911321 7:4102091-4102113 TCAAAGCCTGAAGCTTCCTTGGG + Intronic
1021053897 7:16022860-16022882 AGATAGCCTGTATCTTCTTTAGG + Intergenic
1022596480 7:31718212-31718234 CCACAGGCTGCATCTTTTTCTGG + Intergenic
1022803593 7:33799356-33799378 CCCAAGCCTGCATCTTCGGTTGG + Intergenic
1024481149 7:49864663-49864685 CAGAGGCCTGCATCTTCTGTTGG + Intronic
1026092012 7:67308175-67308197 GGCCAGCCTGCATCTTCTTTAGG + Intergenic
1026568480 7:71509628-71509650 CTAGAGCCTGTATCTTTTTTGGG + Intronic
1029064274 7:97833025-97833047 CTAAATCCTTCAACTTCTTTTGG - Intergenic
1031878223 7:127165848-127165870 CCAAAGTTAGCAGCTTCTTTTGG - Intronic
1033291602 7:140089259-140089281 CCAAAGTCTGAATCTTATCTGGG - Exonic
1033607872 7:142940621-142940643 GCCATGCCTGCATCTCCTTTGGG - Exonic
1036756285 8:11473335-11473357 CCAAAGCCTGCCTCATGTCTCGG - Intronic
1037625278 8:20601092-20601114 CCAAAGCCAGTATCTCCATTTGG + Intergenic
1037831315 8:22191350-22191372 CCTAAGCCTGGAGCTTCTTGAGG + Intronic
1037859604 8:22395639-22395661 AGTAAGCCTGCATCCTCTTTTGG + Intronic
1040062851 8:43119146-43119168 CAAAAGCCAGCATCGTTTTTAGG + Intronic
1046189192 8:110767220-110767242 GTAAAGCAAGCATCTTCTTTTGG - Intergenic
1047197045 8:122731228-122731250 TCAAATCCAGTATCTTCTTTAGG - Intergenic
1047586300 8:126277602-126277624 CCAAAGCCTTCCTCTTCCTAGGG + Intergenic
1047986549 8:130240863-130240885 CAGCAGCCTGCATCTTCTCTGGG - Intronic
1048576274 8:135692653-135692675 CCAAAGCCAGCATTTTCATATGG - Intergenic
1051652771 9:19345956-19345978 CCAAAGACTGCATCTTCAACTGG - Exonic
1055436890 9:76300667-76300689 CTAAAGCCTGCATCTGCTAGAGG - Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057350841 9:94296784-94296806 GTAAATCCTCCATCTTCTTTGGG + Intronic
1058430145 9:104911317-104911339 CCAAAGCAAGCATGTTCTGTTGG - Intronic
1060606292 9:124917561-124917583 TCAAAGCCTCCATCATCTTACGG + Intronic
1062520296 9:136954795-136954817 CCAAGGCCTGACTCTTCTTGTGG + Intronic
1186064141 X:5743367-5743389 CCAAAGACTGCATATGCCTTGGG - Intergenic
1186498782 X:10033907-10033929 CCAAAGTCTGCATTTTCTTAAGG + Intronic
1187273716 X:17801196-17801218 CCCAAGCCACCATCTTCCTTCGG - Exonic
1189624368 X:42879899-42879921 CCCAAGACTGCATCTTGTATGGG - Intergenic
1190500247 X:51068730-51068752 CTAAAACCTGAAGCTTCTTTGGG + Intergenic
1192419928 X:71020606-71020628 CCAAAGCCATCATGTACTTTTGG + Intergenic
1194099489 X:89686119-89686141 ACTAAGCATGCAGCTTCTTTGGG - Intergenic
1196389834 X:115195821-115195843 CCAAATCCTGAATCTGATTTAGG + Intronic
1197706425 X:129637725-129637747 TCCAAGCCTGCTTATTCTTTGGG - Intergenic
1198109675 X:133491967-133491989 CAAAACCTTGCATTTTCTTTTGG - Intergenic
1200913208 Y:8549151-8549173 CCAAATCCTGCAGATCCTTTTGG - Intergenic