ID: 1079055921

View in Genome Browser
Species Human (GRCh38)
Location 11:17207060-17207082
Sequence ATTGAGGAGGGAAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 900
Summary {0: 1, 1: 1, 2: 6, 3: 92, 4: 800}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079055921 Original CRISPR ATTGAGGAGGGAAATGAGGA AGG (reversed) Intronic
900088142 1:908488-908510 GGTGAAGAGGGAAAGGAGGAAGG + Intergenic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900869437 1:5291449-5291471 AGTAAAGAGGAAAATGAGGAAGG + Intergenic
901645227 1:10713466-10713488 AGTCAGGAGGGATGTGAGGAGGG + Intronic
901774986 1:11554370-11554392 TCTGGGGAGTGAAATGAGGAAGG - Intergenic
902422185 1:16289623-16289645 ATAGTGGAGGGAAGTGAGAATGG - Intronic
902677405 1:18018351-18018373 ATTGAGGAAGGGAGTGAGGAAGG - Intergenic
902769472 1:18637268-18637290 AATTATGAGGGCAATGAGGAAGG - Intronic
902796965 1:18806357-18806379 ATTGGGGAGGGAATTGGGGAGGG - Intergenic
904019398 1:27450846-27450868 ATTGAGGAAAGAAATGAAGAAGG - Intronic
904277504 1:29393961-29393983 ATTAAGGAAGGAAGGGAGGAAGG - Intergenic
904891136 1:33780471-33780493 ATAGAGGAAGGAGATGGGGAGGG - Intronic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
905325980 1:37152272-37152294 AGAGAGGAGGGAAGGGAGGAAGG - Intergenic
905645719 1:39623878-39623900 AATGAGGCTGGAAATGAGGTTGG + Intergenic
906520451 1:46464108-46464130 AGGGAGGAGGGAGAAGAGGAGGG - Intergenic
906607327 1:47181409-47181431 ATCGGGGAGGGAAAGGAGGCTGG - Intergenic
907476955 1:54712270-54712292 ATTGATTAGGGTAAGGAGGAGGG + Intronic
907684007 1:56591987-56592009 ATTCAGGTGAAAAATGAGGAAGG + Intronic
907866307 1:58402628-58402650 GAAGAGGAGGGAAAGGAGGAGGG + Intronic
907935600 1:59039303-59039325 ATTCAGTGGGGAGATGAGGAGGG - Intergenic
908087307 1:60649737-60649759 ATTGTGGTGGTAATTGAGGAGGG + Intergenic
908411534 1:63870732-63870754 ACTGAGGATGGAAATGTTGAGGG + Intronic
908518218 1:64915104-64915126 ATTGTGAAGGTAAATGAGGCAGG + Intronic
908675212 1:66595911-66595933 TTTGAGGAGGGGGAGGAGGAAGG + Intronic
908750695 1:67420154-67420176 GTTGAAGAGGTAAAAGAGGAGGG - Exonic
909503221 1:76358598-76358620 GTGGAGGAGGCAAATGTGGATGG - Intronic
909725833 1:78833810-78833832 TTTGAGGAGGGAAAGAAGGCGGG - Intergenic
909809681 1:79917194-79917216 AATGATGAGAGAAATGATGATGG + Intergenic
910380327 1:86620379-86620401 ATGCAGGAGGGAAGTGAAGACGG - Intergenic
910667617 1:89741741-89741763 GTTGAGGTGGGGAATGGGGAAGG + Intronic
911043069 1:93607299-93607321 AATGAGCATGGAAACGAGGAGGG + Intronic
911274486 1:95844391-95844413 ATTGAATAGGTAAATGAGAAGGG + Intergenic
911620379 1:100060516-100060538 AGTGAGGTGAGAGATGAGGATGG - Intronic
911670988 1:100607405-100607427 AGTCAGGAGAAAAATGAGGAGGG - Intergenic
912822161 1:112876695-112876717 ATTGAGGAGGGAGGTTGGGAAGG + Intergenic
912891393 1:113535892-113535914 ATTGAGGCAGGAAATCAGGTTGG - Intronic
913092017 1:115482677-115482699 AGTGAAGAGGTATATGAGGAGGG + Intergenic
913676358 1:121144628-121144650 TTTGATGAGAGAAATGAGCAGGG - Intergenic
914028253 1:143932578-143932600 TTTGATGAGAGAAATGAGCAGGG - Intergenic
914879742 1:151538177-151538199 ACAGAGGAGGGAGAGGAGGAAGG - Exonic
915310119 1:155002382-155002404 AAGAAGGAGGGAAAGGAGGAGGG + Intergenic
915364267 1:155305462-155305484 CTTCCGGAGGGAAATGAGCATGG + Intergenic
915718112 1:157963399-157963421 ATTTAGGAGGGAGAGGTGGACGG + Intergenic
915720857 1:157984528-157984550 ACTGAACAGGGAAATGAGGGAGG + Intergenic
915885436 1:159716558-159716580 ATTGAGGAGGGAACAGGAGATGG - Intergenic
916036883 1:160930070-160930092 ATTGAGGAAGGATCTGAAGAAGG - Intergenic
916253144 1:162758116-162758138 ATTCAGTAGAGAAATAAGGAAGG + Intronic
916320840 1:163502069-163502091 GTTGAAGAGTGAAAAGAGGAGGG - Intergenic
916473083 1:165142739-165142761 ATGAAGGAGAGAAAGGAGGAAGG - Intergenic
916567180 1:165991093-165991115 AATGAGGAGGAGAATGAAGAAGG + Intergenic
916584448 1:166138221-166138243 TTTGATGAGGGGAGTGAGGAGGG - Intronic
916924869 1:169507555-169507577 ATTGAGGAGGAGGATGGGGAAGG + Intergenic
917060853 1:171037215-171037237 AATGAGGAAGAAAAGGAGGAAGG + Intronic
917741250 1:177963995-177964017 AGTAAGGAGGGAAAAAAGGAAGG + Intronic
917789343 1:178489448-178489470 AGAGAGGTGGGGAATGAGGAAGG + Intergenic
917839403 1:178965226-178965248 TTTGTGGAGGGAAAGAAGGAAGG - Intergenic
917903144 1:179563798-179563820 CTTGGGGAGGAAAATGGGGAGGG + Intronic
918063767 1:181085600-181085622 AGTGATGAGGGCAATGATGAAGG + Intergenic
918300499 1:183199485-183199507 ATTGAGGGAGGGAATGAGGGAGG - Intronic
918582203 1:186144638-186144660 ATGGAGGAAGGAAATGCGAAGGG + Exonic
918867838 1:189926215-189926237 CTTGAGGGGGGAACAGAGGAGGG + Intergenic
919622324 1:199876758-199876780 ATCGAGAAGGAAAATGAGCAAGG + Intergenic
919973730 1:202597561-202597583 AGTGAGGCAGGAAATGAGGCTGG + Intronic
920117544 1:203631098-203631120 GTTGAGGAGGGAAACCAGGCAGG + Intronic
920293929 1:204944353-204944375 ACTGAGGAGGCAGAGGAGGAAGG - Exonic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920463723 1:206163469-206163491 TTTGATGAGAGAAATGAGCAGGG - Intergenic
920577194 1:207070258-207070280 ACTGTGGAGGGAAATGGGGCAGG - Exonic
920954713 1:210607859-210607881 CTTGGGGAGGAAAATGAGCAGGG - Intronic
921312323 1:213856484-213856506 ATAGAGGAGGGAAGGAAGGAAGG - Intergenic
921613439 1:217238586-217238608 AATGAGGCGGGAAATGAGGCAGG - Intergenic
921774319 1:219079555-219079577 ATTAAGGAGGGAAAGGAAGAGGG - Intergenic
921887521 1:220321621-220321643 ATGGAGGAGGAAGAGGAGGAAGG + Intergenic
922432157 1:225565850-225565872 ACTAAGGAGGGAAAAGAAGAGGG + Intronic
922595482 1:226809779-226809801 AGTGAGCTGGGAACTGAGGAAGG + Intergenic
922600181 1:226845222-226845244 AGTCAGGAGGGAAGTCAGGAAGG + Intergenic
923073428 1:230587424-230587446 TTTGGGGAGGAAAGTGAGGAGGG + Intergenic
923127761 1:231047317-231047339 AAAGAGGAGGGAAAGGAGGAAGG - Intergenic
924015431 1:239716065-239716087 ATTCTGGAGGAAAATGTGGAGGG + Intronic
924481176 1:244435656-244435678 ATGGAGGAGGAAGAGGAGGATGG - Intronic
924628755 1:245717119-245717141 AGGGAGGAGAGAAAAGAGGAGGG + Intergenic
924904921 1:248442015-248442037 ATTGAGCATGGGAGTGAGGATGG - Exonic
1063025911 10:2178735-2178757 AAAGAGGAAGGAAAGGAGGAAGG - Intergenic
1063534199 10:6866984-6867006 AGTGAGGAAGGAAGGGAGGAAGG - Intergenic
1064158201 10:12921202-12921224 ATTAAGGAGGCAATTGAGGAAGG + Intronic
1065503242 10:26402216-26402238 ATTGAGGGAGGACAGGAGGAAGG - Intergenic
1065933491 10:30499989-30500011 AAGAAGGAGGGAAAGGAGGAAGG + Intergenic
1066529028 10:36316119-36316141 ATTGAGGAGAATAAGGAGGAGGG - Intergenic
1067276347 10:44838486-44838508 ATGGTGGAGGGAAATGAAAAGGG - Intergenic
1067424513 10:46195028-46195050 TTTAAGTAGGGAAATAAGGAAGG - Intergenic
1067434998 10:46270414-46270436 ACTCAGAGGGGAAATGAGGAAGG + Intergenic
1067814163 10:49459376-49459398 AATGAAAAGGGAAAGGAGGAGGG + Intronic
1067934755 10:50600252-50600274 AAAGAGGAGGGAAAAGAGAAGGG + Intronic
1068156718 10:53208079-53208101 GTTGAGGAAAGAAAGGAGGAGGG + Intergenic
1068193614 10:53686932-53686954 TTTGGGGAAGGAAATGAGCAAGG - Intergenic
1068882196 10:62061947-62061969 AGGAAGGAAGGAAATGAGGAAGG - Intronic
1068932107 10:62602076-62602098 ATTGAAGAGGGAATAGAGGGTGG + Intronic
1069202466 10:65638135-65638157 GTTGAGGAGAGAAAAGGGGATGG - Intergenic
1070658252 10:78285938-78285960 AATGAGGAGGGAAGGGAGGAAGG - Intergenic
1070860934 10:79660441-79660463 TTTAAGTAGGGAAATAAGGAAGG - Intergenic
1070876328 10:79815143-79815165 TTTAAGTAGGGAAATAAGGAAGG + Intergenic
1070891026 10:79942342-79942364 TCTGAGAAGGGAAAGGAGGAAGG - Intronic
1071643258 10:87337317-87337339 TTTAAGTAGGGAAATAAGGAAGG + Intergenic
1073047111 10:100646088-100646110 AGTGGGGAGGGAATGGAGGAGGG + Intergenic
1073476242 10:103755980-103756002 AGGGAGGAGGCAAATGTGGAGGG - Intronic
1073967467 10:109007812-109007834 TTTTAAGAGGGAAATGTGGAAGG + Intergenic
1074081264 10:110169836-110169858 AGGGAGAAGGGAGATGAGGAGGG - Intergenic
1074100036 10:110347695-110347717 AGTGAAGAGGGAAAGGATGATGG - Intergenic
1074108817 10:110408427-110408449 ACTGAGGAGGGGAAGGGGGAGGG - Intergenic
1074372684 10:112913157-112913179 AGTGGGGCGGGAAATGAAGATGG + Intergenic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075387272 10:122064295-122064317 ATGGAGGAGGGAAGTGTGCATGG - Intronic
1075559516 10:123458429-123458451 AGAGAGGAGGGAAAGAAGGAAGG - Intergenic
1076248093 10:128963185-128963207 TATGAGGAGGGAAATGATGGGGG + Intergenic
1076378221 10:130006717-130006739 AGGGAGGAGGGAAAGGAGGGAGG + Intergenic
1076856021 10:133115988-133116010 AATGGGGAGGGAAAAGAGGGAGG - Intronic
1077375065 11:2201959-2201981 ATGGGGGAGGGAGAGGAGGAAGG - Intergenic
1077499211 11:2901743-2901765 TCTGGGGAGGGAAGTGAGGAGGG + Intronic
1077544277 11:3162403-3162425 CTTGAGGTGGGAGATGGGGAGGG - Intronic
1077811525 11:5642588-5642610 ATTGAGGACAGAAGAGAGGAGGG + Intronic
1078139063 11:8678815-8678837 AGTGAGGAGAGAAAGGAAGAGGG + Intergenic
1079055921 11:17207060-17207082 ATTGAGGAGGGAAATGAGGAAGG - Intronic
1079339398 11:19599543-19599565 TTTGAGGAGAGAAGTGTGGAAGG + Intronic
1079373007 11:19868096-19868118 ATTGTGGAGGGGAATGAGTGGGG + Intronic
1080667110 11:34345542-34345564 TTTGAGGAGACAAATGATGATGG - Intronic
1080874150 11:36261368-36261390 ATAGAGGAGGGAAAGAAAGAAGG - Intergenic
1081027744 11:38036596-38036618 ATTGAAGATGGTAATGTGGAAGG - Intergenic
1081114795 11:39187203-39187225 TTTGAGAAGGGTAGTGAGGAGGG - Intergenic
1081512340 11:43788666-43788688 TTTGAGGAAGGAAATGACGGTGG - Intronic
1081584522 11:44375384-44375406 ATTTATAAGGGAAATGAGAAAGG + Intergenic
1081604262 11:44517564-44517586 ATGGAGGAGGGAGAGGAGGAAGG + Intergenic
1082121470 11:48384264-48384286 ATCAAGGAGGGAAAAGAGTAGGG - Intergenic
1083181531 11:60988915-60988937 CTGGAGGAGGGGAGTGAGGAGGG - Intronic
1083221801 11:61257622-61257644 AGTGAGAAGGGAAAAGATGATGG - Intergenic
1083316572 11:61818242-61818264 ATTGAGGTTCGAAATGGGGAAGG + Intronic
1083462719 11:62825216-62825238 ATCCAAGAGGGAAATGAAGAAGG - Intronic
1083663745 11:64263890-64263912 ACTGAGTAGGGAACTGAGTAGGG + Intronic
1083788413 11:64968122-64968144 AGAGAGGAGGGAGATGAAGATGG + Intronic
1083881957 11:65553287-65553309 GGTGAGGAGGGAACTGGGGAGGG + Intronic
1083884638 11:65566424-65566446 AGAAAGGAGGGAAAGGAGGAGGG - Intergenic
1084711044 11:70843933-70843955 ACTGAGGAGGAAGATGAAGATGG - Intronic
1084948693 11:72652920-72652942 CTTGAGGAGGCAAGAGAGGAGGG - Intronic
1085232721 11:74986984-74987006 AATGAGGTGGGAAAGTAGGAAGG + Intergenic
1085428147 11:76423102-76423124 ATTGAGGTGGGAAAAGATGGAGG + Intergenic
1085472045 11:76764646-76764668 ATTTAGCAGAGAAATGATGAAGG - Intergenic
1086937594 11:92762069-92762091 ATTGTGGATGGGAATGATGACGG + Exonic
1087847447 11:102989480-102989502 ATTGAGGAGAGAAATGGGACAGG - Intergenic
1087922374 11:103881158-103881180 GATGAGGAGTGAAATGAGAATGG - Intergenic
1088076725 11:105858638-105858660 AGGGAGGAGGGAAATGGGGATGG - Intronic
1088454985 11:110024066-110024088 AGTGGGGAGGGAAGTGGGGAGGG + Intergenic
1088454990 11:110024078-110024100 AGTGGGGAGGGAAGTGGGGAGGG + Intergenic
1089054860 11:115577285-115577307 ATTGGGGAAGGAGATGAGGCTGG + Intergenic
1089111845 11:116063423-116063445 ATTGAGGTGGGATAGAAGGACGG + Intergenic
1089473521 11:118739875-118739897 ATGGAGCAGGGAAAAGAGCAAGG + Intergenic
1089506917 11:118969532-118969554 AGGGAGGAGGGAAGGGAGGAGGG + Intergenic
1089809630 11:121121110-121121132 ATAGATGAGGAAATTGAGGATGG - Intronic
1090264722 11:125346792-125346814 AGGGAGGAAGGAAAGGAGGATGG + Intronic
1090412095 11:126516293-126516315 GAAGAAGAGGGAAATGAGGAGGG + Intronic
1090475095 11:127013094-127013116 AGTGAGGAAGGAAAGGAAGAGGG + Intergenic
1090907976 11:131094228-131094250 AGGAAGGAGGGAACTGAGGAAGG - Intergenic
1090951890 11:131480923-131480945 ATTGAGGAGGGAATTGGGTGGGG + Intronic
1091568199 12:1662735-1662757 AGGGAGGCGGGAAGTGAGGAGGG - Intergenic
1091884280 12:4004528-4004550 TTTGAGGAGAGAAAGGAAGAGGG - Intergenic
1092254301 12:6917801-6917823 ATTGAGGGAGGTAAAGAGGAAGG + Intronic
1092496131 12:8996998-8997020 GGTGAGGAGGGAAAGGATGAAGG + Intronic
1092762243 12:11820664-11820686 ATGAAGGAGGGAAAGGATGATGG + Intronic
1092950156 12:13495235-13495257 AAAGATGAGGGAACTGAGGAAGG + Intergenic
1093241794 12:16685973-16685995 ATTGAGGAAGGGAAGGAGGAGGG - Intergenic
1094026106 12:25960661-25960683 CTTGAGGAAAAAAATGAGGAAGG - Intronic
1094471789 12:30808551-30808573 ATTGAAGAGAGAGTTGAGGAAGG + Intergenic
1095163807 12:38948071-38948093 AGTGAGGGGGGAAGTGAGGATGG + Intergenic
1095312453 12:40716271-40716293 AGAGAGGAAGGAAAGGAGGAGGG - Intronic
1097157109 12:57020522-57020544 ATTGAAGATGGCAAAGAGGAAGG - Intronic
1097161071 12:57047139-57047161 CTAGAGAAGGGAAAGGAGGAAGG + Intronic
1097244235 12:57597767-57597789 AGAGAGGAGGGGAATCAGGAGGG + Intronic
1097247044 12:57612413-57612435 ATAGAGGAGGCCAGTGAGGAGGG - Intronic
1097825642 12:64172441-64172463 AGGGAGGAAGGAAAAGAGGAGGG + Intergenic
1097827956 12:64193908-64193930 ATTGAGGAAGGAAATAAAGTGGG + Exonic
1097926531 12:65134235-65134257 AGGGAGGAAGGAAAGGAGGAAGG + Intergenic
1098270363 12:68764037-68764059 GTTAAGGAGGGAAAAGAGGGAGG - Intronic
1098392443 12:69983824-69983846 ATTGAGGTAGGTAATTAGGATGG - Intergenic
1098429275 12:70402068-70402090 TTTGAGCAAGGAAATGAGGTTGG - Intronic
1098947870 12:76608405-76608427 ATTCAGGAGGCAGATGAGGGAGG - Intergenic
1099868074 12:88309531-88309553 AAGGAGGAGGGAAAGAAGGAAGG - Intergenic
1099945196 12:89235880-89235902 ATGGAGGAAGGAGAGGAGGAGGG - Intergenic
1100116595 12:91313024-91313046 ATTGCTGAGGCAAATGATGAAGG + Intergenic
1100250370 12:92815365-92815387 AAGGGGGAGGGGAATGAGGAGGG - Intronic
1100702310 12:97161482-97161504 GGTGAGGAGGGGAGTGAGGAGGG + Intergenic
1100955396 12:99902581-99902603 ATGGAAGAGGGAAAGAAGGAAGG + Intronic
1100957200 12:99922060-99922082 ATAGAGGAGGAAACTGAGCAGGG - Intronic
1101219946 12:102628200-102628222 ATAGAGGAGTGAAATGCAGAGGG - Intergenic
1101279430 12:103237296-103237318 ATTGAGGATGGAAATGAAGAGGG + Intergenic
1101376426 12:104175256-104175278 ATTGAGGAGGGAGGTGATGGAGG + Intergenic
1101797437 12:107988454-107988476 AAGGAGGAGGGAAAGAAGGAGGG + Intergenic
1101909886 12:108853514-108853536 ATCGAGGACAGAAATGAGGCAGG + Intronic
1102133084 12:110548864-110548886 TTTGAGGAGGCAAAAGAGGAGGG - Intronic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1102232355 12:111272307-111272329 ATGGAGGAGGGAGAGGAGGAGGG - Intronic
1102240002 12:111319303-111319325 AAAGGGAAGGGAAATGAGGAAGG + Intronic
1102517210 12:113457716-113457738 ATGGAGGAGGAAAGGGAGGAGGG + Intergenic
1102732135 12:115121038-115121060 AGTGAGGAAGGAAAAGAGGGAGG - Intergenic
1102732142 12:115121066-115121088 AGAAAGGAGGGAAAGGAGGAAGG - Intergenic
1102754138 12:115323192-115323214 ATGGAGGAAGGAAAGAAGGAAGG + Intergenic
1102919029 12:116778069-116778091 AGGGAGGAAGGAAATTAGGAAGG - Intronic
1103164669 12:118760240-118760262 CTTGAGGTGGGAAATCAAGAGGG + Intergenic
1103449897 12:121021295-121021317 ATTGATGAGGAAACTGAGCAGGG + Intronic
1103772638 12:123339942-123339964 TTTGAGGTGGGATATTAGGAAGG - Intronic
1104273591 12:127304966-127304988 ACTGGGGAGGGAGATGAGGAGGG + Intergenic
1104463316 12:128971715-128971737 ATGGAGGGGGGAAGGGAGGAGGG - Intronic
1104714397 12:131006692-131006714 GAGGATGAGGGAAATGAGGAGGG + Intronic
1104759220 12:131287091-131287113 AGGAAGGAGGGAAATGTGGAGGG - Intergenic
1105279258 13:18953768-18953790 GTTGAGGATGGAGATGAGAAAGG - Intergenic
1105819453 13:24066691-24066713 AGTGAGGAGGGGAATGAAGGTGG - Intronic
1106243048 13:27925338-27925360 GAAGAGGAGGGAAAAGAGGAGGG - Exonic
1106307729 13:28528223-28528245 ATAGAGCGGGGAAATGGGGAGGG + Intergenic
1106316149 13:28595798-28595820 ATTGAGGTGGGAAAGTTGGAGGG + Intergenic
1106359999 13:29022284-29022306 AGTGAGGAGGAGCATGAGGATGG + Intronic
1106360042 13:29022638-29022660 AATGAGGAGGAAAGTGTGGAAGG + Intronic
1106808240 13:33333421-33333443 AGGGAGGAGGGAAATGGAGAAGG - Intronic
1107454854 13:40545783-40545805 ATTGAGGGAGGAAGAGAGGAAGG + Intergenic
1107521006 13:41181382-41181404 GTTGACTAGGGAGATGAGGAGGG + Intergenic
1107797083 13:44063879-44063901 ATTCAGGTGAGAAATGATGATGG + Intergenic
1107822370 13:44297285-44297307 AGAGAGGAGGGAAATGGGGAAGG + Intergenic
1107995759 13:45859308-45859330 ATACAGGAGGGAAAGGAAGAGGG + Intergenic
1108071570 13:46634367-46634389 ATCCAGGTGAGAAATGAGGAAGG - Intronic
1108362760 13:49682747-49682769 AATGAGGAGGAAAAGAAGGAAGG - Intronic
1108870156 13:54974845-54974867 ATTGAAGATGGCAAAGAGGAAGG + Intergenic
1109518074 13:63470118-63470140 AATAAGGAAGGAAATAAGGAAGG - Intergenic
1109897348 13:68711070-68711092 ATTCAGGTGGGAAAGGAGGGTGG - Intergenic
1110403388 13:75120589-75120611 ATGGAAGAAGGAAATGAAGAAGG + Intergenic
1110478993 13:75951717-75951739 ATTCAGGTGGGAGATGATGATGG - Intergenic
1110733875 13:78911927-78911949 ATTGTGGTGGGAGATGAGGTCGG - Intergenic
1110792215 13:79599079-79599101 ATAGATGAGGCAAATGAGAAAGG + Intergenic
1110800505 13:79688539-79688561 AGCATGGAGGGAAATGAGGATGG + Intergenic
1111022540 13:82471770-82471792 ATTCAGGAAGGAAATAAAGAAGG - Intergenic
1111390161 13:87583418-87583440 ATTGAGGAGGAAAATCAGCATGG + Intergenic
1111700871 13:91686279-91686301 AATGAGGAGGGAAATGAGGGAGG + Intronic
1112126966 13:96478932-96478954 ACTGAGAAGGGAAACCAGGAGGG + Intronic
1112724028 13:102281427-102281449 TGTGAGGAGGGAGATGAGGTGGG - Intronic
1112764176 13:102723177-102723199 AATGAGGGGGGATATGAGTAGGG + Intergenic
1112788991 13:102982808-102982830 AAGGAGGAGGAAGATGAGGAGGG + Intergenic
1112962438 13:105143228-105143250 AATGTGGAGGTAAAGGAGGAAGG + Intergenic
1113487830 13:110667989-110668011 GTTGATGGGGGAAATGAGGCTGG + Intronic
1113573180 13:111373217-111373239 TTTGAGGATGGTAATGAGGAGGG - Intergenic
1113574932 13:111388648-111388670 AGGGAGGAGGGAAGCGAGGAGGG - Intergenic
1113677267 13:112215344-112215366 AGTGGGGAGGGAGATGGGGAGGG + Intergenic
1114516747 14:23305168-23305190 ATAGAGGAGAGAATTGAGTATGG + Intronic
1115184967 14:30676672-30676694 ATTGAGGAGGGAAAGAGTGATGG + Intronic
1115192424 14:30759954-30759976 ATTGAAGAGGGAAGCCAGGATGG - Intergenic
1115419791 14:33181247-33181269 TTTGTGGAAGGAAAAGAGGAAGG + Intronic
1115427261 14:33274434-33274456 AAAGGGGAGGGAAATTAGGATGG - Intronic
1115952990 14:38742469-38742491 GTTGAGGAGGAAAAGCAGGAAGG + Intergenic
1116054397 14:39845179-39845201 ATTAATGAGGGAAATTAGGAAGG + Intergenic
1116550277 14:46228797-46228819 CTTGAGATAGGAAATGAGGAAGG - Intergenic
1116660490 14:47704464-47704486 ATTCAGGGGAGAAAAGAGGATGG + Intergenic
1117422640 14:55562101-55562123 ATTGAGTAGGCTAAGGAGGAAGG + Intronic
1117585401 14:57197489-57197511 ATTAAGGAAGGAAAGAAGGAAGG - Intergenic
1117712598 14:58547582-58547604 AGTGAGGGTGGAAAGGAGGAAGG + Intronic
1118474913 14:66107700-66107722 ATTGCTGAGGCAAATGAGGAGGG + Intergenic
1118735304 14:68696793-68696815 ATTGAGGAAGGTACTGGGGAAGG + Intronic
1118969032 14:70616356-70616378 ACTGGGGAGAGAAATGAGGAAGG + Intergenic
1119081320 14:71697010-71697032 AATGGGGATGGAGATGAGGATGG + Intronic
1119201478 14:72756027-72756049 ATGGAGGTGGGGAAGGAGGATGG + Intronic
1119368122 14:74113051-74113073 ATAGACAAGGGAAATGAGTATGG + Intronic
1119690958 14:76672159-76672181 AATTAGGTGGGAAATGGGGAAGG + Intergenic
1119692453 14:76686688-76686710 ATCTAGGAGGGAAATGGGGCTGG + Intergenic
1119896057 14:78220784-78220806 ATTGAGAAGGGAAGTAGGGAAGG + Intergenic
1120272521 14:82331685-82331707 AATAAGGTGGGAAAGGAGGATGG - Intergenic
1120483920 14:85086396-85086418 AGGGAGGAAGGAAATGAGGGAGG - Intergenic
1120635348 14:86943992-86944014 AGGGAGGAGGGAAGGGAGGAGGG - Intergenic
1120635362 14:86944032-86944054 AGGGAGGAGGGAAGGGAGGAGGG - Intergenic
1121144207 14:91569434-91569456 AAGGAGGAGGAAAAAGAGGAAGG - Intergenic
1121538632 14:94708455-94708477 TTTAAGGAGAGAAATGAGGATGG + Intergenic
1121665704 14:95670612-95670634 TGTGAGGAGGGAAATCAGGATGG + Intergenic
1121764071 14:96470259-96470281 GATGAGGAGGGAGAGGAGGAGGG + Intronic
1121916727 14:97842361-97842383 AGGGAGGAGGGAAAGAAGGAAGG + Intergenic
1121916758 14:97842469-97842491 AGGGAGGAGGGAAAGAAGGAAGG + Intergenic
1121919087 14:97863930-97863952 ACTGAGGAGGAGAATCAGGATGG + Intergenic
1123820987 15:24030482-24030504 TTTCAGGGGGGAAATGAGGCAGG - Intergenic
1124581748 15:30961858-30961880 ATTAGGGACGGAGATGAGGAAGG - Intronic
1124797061 15:32792069-32792091 ACTAAGGAGGGAGATGAAGAAGG + Intronic
1126393912 15:48191500-48191522 AAGGAGGTGGGAGATGAGGAGGG - Intergenic
1126558273 15:50015249-50015271 AATGAAGAGGGAAATTGGGATGG + Intronic
1126730726 15:51679884-51679906 ATTGAGGAGATAAATGAGTCAGG + Intergenic
1127260700 15:57324309-57324331 GATGGGGAGGGACATGAGGAGGG - Intergenic
1127260712 15:57324343-57324365 GATGGGGAGGGACATGAGGAGGG - Intergenic
1127260724 15:57324377-57324399 GATGGGGAGGGACATGAGGAGGG - Intergenic
1127278285 15:57466989-57467011 ATGGATGAGGGAGAAGAGGAGGG + Intronic
1127289743 15:57559730-57559752 ATTGGGGAAGGTAGTGAGGATGG + Intergenic
1127341391 15:58048524-58048546 ATTGAGAAGGGAAGTATGGATGG + Intronic
1127763947 15:62166391-62166413 ATGTAGGAAGGAAATGAGGAGGG - Intergenic
1129421275 15:75428881-75428903 ATTGAGGAGGCTGAGGAGGAGGG - Intronic
1129695368 15:77737936-77737958 ATTCAGGAGGGAGCTGAGGCTGG - Intronic
1129798183 15:78393860-78393882 ATTGAGGAAGGAAAGAAGGAAGG + Intergenic
1129880974 15:79005813-79005835 AAAGAGAAAGGAAATGAGGAGGG - Intronic
1129882982 15:79019191-79019213 TCTGAGGAGGGAAAAGAGCACGG + Intronic
1129978594 15:79845928-79845950 AATGGGAGGGGAAATGAGGAGGG - Intronic
1130735031 15:86538915-86538937 AAGGAGGAAGGAGATGAGGAAGG + Intronic
1130959867 15:88652484-88652506 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1130959872 15:88652496-88652518 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1131289053 15:91089211-91089233 AGTGGGAATGGAAATGAGGAGGG + Intergenic
1131290789 15:91105234-91105256 GTTGAGCAGGGAAAGGAAGATGG + Intronic
1131649879 15:94387144-94387166 AGGGAGGAAGGAAAGGAGGAAGG - Intronic
1131795454 15:96011275-96011297 GTTCAGGAGGGCAATGAGGCGGG + Intergenic
1131962884 15:97807891-97807913 ATAGAGGAGGAAACTGAGGCCGG - Intergenic
1132016713 15:98324357-98324379 CATGTGGAGGGAAGTGAGGAAGG - Intergenic
1132337860 15:101060208-101060230 ATTAAGGAAGGAAAGGAGGCAGG + Intronic
1132772117 16:1569473-1569495 AGGGAGGAGGGAAAGAAGGAAGG - Intronic
1133431628 16:5742203-5742225 AGGGAGGAAGGAAAGGAGGAAGG - Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1134294536 16:12933908-12933930 AGTATGGAGGAAAATGAGGAAGG + Intronic
1134452020 16:14369433-14369455 AGTGAGGAAGGAGCTGAGGATGG + Intergenic
1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG + Intergenic
1135250738 16:20899818-20899840 GGTGGGGAGGGAAATGAGGGCGG + Intronic
1135634163 16:24059944-24059966 GTTGAGGAGGGAATTGAAGGAGG + Intronic
1135730887 16:24894306-24894328 CTTGGGGTGGGAAAGGAGGAGGG - Intronic
1135944364 16:26852908-26852930 ACTGAGGTGGGATCTGAGGAGGG - Intergenic
1136139823 16:28281461-28281483 AGTCAGGATGGAAATGGGGACGG + Intergenic
1136594779 16:31240392-31240414 ATTGAGGTGGGTGATGAGGGTGG + Intergenic
1137750753 16:50859610-50859632 CTTGATGAGGGAGATGAGGAAGG - Intergenic
1137896734 16:52220598-52220620 TTTGAGGATAGAAATGAGAACGG - Intergenic
1138013312 16:53404852-53404874 ATTAAGAAGAGAAATGAGGCCGG - Intergenic
1139487308 16:67265128-67265150 ATTGAGGATGGGAGGGAGGAGGG + Intronic
1140317339 16:73911898-73911920 AGTGAGGAGGGAAATGGTGATGG + Intergenic
1140847752 16:78906398-78906420 GTTGGGGAGGGAAAGTAGGAAGG - Intronic
1140967694 16:79983099-79983121 AGGGAGGAAGGAAAAGAGGAAGG - Intergenic
1141305672 16:82861563-82861585 ATTGAGGAGGAAGATGAAAAAGG - Intronic
1141503649 16:84461239-84461261 ATCTAGGTGGGAAATGAGGCAGG + Intronic
1141527098 16:84618418-84618440 AAGGAGGAGGGAGAGGAGGAAGG - Intergenic
1141774566 16:86114229-86114251 GTGGAAGAGGGAAAAGAGGAAGG + Intergenic
1142251462 16:88993815-88993837 AAGGAGGAGGGAAGAGAGGAGGG - Intergenic
1142615988 17:1135503-1135525 ATTGAGGATGGGAATGAGAGAGG + Intronic
1142958241 17:3535438-3535460 AAGGAGGAAGGAAGTGAGGAGGG - Intronic
1143267312 17:5649338-5649360 ATAGAGGGGGGCTATGAGGAAGG - Intergenic
1143491510 17:7287841-7287863 ATTGTGGAGGTACTTGAGGATGG + Exonic
1143957980 17:10689159-10689181 ATTGGGGAGGGAAAAAGGGAGGG + Intronic
1144142168 17:12360286-12360308 AGGGAGCAGGGGAATGAGGAGGG - Intergenic
1144585144 17:16483170-16483192 ACTGGGGAGGGTAATGAGGCTGG - Intronic
1145741854 17:27281429-27281451 ACAGGGGAGGGAAAGGAGGAAGG - Intergenic
1145969963 17:28950862-28950884 CTGGAGGAAGGAGATGAGGAGGG + Intronic
1146234151 17:31142569-31142591 AATGAGGCCGGAAATGAGGCCGG + Intronic
1146255924 17:31391617-31391639 AGTGGGGAGGGGAAGGAGGAGGG - Exonic
1146673883 17:34759805-34759827 TTTCTGGAGGGCAATGAGGAAGG - Intergenic
1147350769 17:39841302-39841324 AATGAAGAGGGGAATGAAGAGGG + Intronic
1147977673 17:44257380-44257402 GAAGATGAGGGAAATGAGGAAGG + Exonic
1148398015 17:47325376-47325398 TGTGAGGAGGGAAATCAGGTAGG - Intronic
1148743190 17:49904391-49904413 ACTGGGGAGGGAAGGGAGGACGG - Intergenic
1148765431 17:50036024-50036046 GTTGGGGATGGAGATGAGGAAGG - Intergenic
1148948016 17:51282616-51282638 GTTGGGGAGGGAAAAGAGGTGGG + Intronic
1149028472 17:52057311-52057333 GAGGAGGAGGGAAAAGAGGAAGG - Intronic
1149333592 17:55611018-55611040 AAAGAGGAAGGAAAGGAGGAAGG - Intergenic
1149729555 17:58931437-58931459 AGGGAGGAAGGAAAGGAGGAAGG + Intronic
1149826510 17:59833826-59833848 GTTGTTTAGGGAAATGAGGAAGG - Intronic
1150483304 17:65527281-65527303 ATTGAGGAGAGTGATGAGGTTGG - Intergenic
1150851356 17:68706811-68706833 ATGGAGGAGGGAAAGAAAGAAGG - Intergenic
1151577535 17:74960215-74960237 GTTGAGGAGGGAGGTGAAGAGGG + Exonic
1151814635 17:76465684-76465706 AATGAGAAGGAAAATAAGGAGGG - Intronic
1152107118 17:78337005-78337027 ATTGGGGAGAGAAAGGAGGAAGG + Intergenic
1152107234 17:78337768-78337790 AGTGAGAAGGGAAAGGAGAAGGG - Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152370161 17:79882677-79882699 ATTGAGGAGGAGGAGGAGGAGGG - Intergenic
1152519911 17:80849403-80849425 ATTGAGGCTGGAAAGCAGGAAGG - Intronic
1152730386 17:81967074-81967096 AGTGAGCAGGGAAGTGAGGCGGG + Intergenic
1153577226 18:6534636-6534658 ATGGGAGAGGGAAATGAGGGTGG - Intronic
1154005373 18:10523178-10523200 ATTGAGGTGGGAGTTGAGCAAGG - Intergenic
1156148989 18:34222317-34222339 GTGGAAGAGGGAAGTGAGGAAGG + Intronic
1156221961 18:35061807-35061829 TTTGAGGAGGGAGATCAGGATGG - Intronic
1156826338 18:41434443-41434465 GTGGGGGAGGGAAAGGAGGAAGG + Intergenic
1157285556 18:46374949-46374971 ATTTAGGAGGGAAGCCAGGAGGG - Intronic
1157430414 18:47619906-47619928 ATTCAGCAGGGGAATGAGGATGG + Intergenic
1157488649 18:48107299-48107321 AGTGAGGAGGGATGGGAGGAGGG + Intronic
1157612719 18:48968449-48968471 AGGGAGGGAGGAAATGAGGAAGG + Intergenic
1157612756 18:48968635-48968657 ATTGAGGTAGGAAAGAAGGAAGG - Intergenic
1157617056 18:48993191-48993213 GTGGAGGAGGGAAAAGATGAGGG - Intergenic
1157925338 18:51758965-51758987 GTTGAGGATGGACATCAGGAGGG - Intergenic
1158057720 18:53301755-53301777 ATTGGAGAAGAAAATGAGGATGG - Intronic
1158406592 18:57165452-57165474 ATGGAGGAGGGAGGTGAGGTGGG - Intergenic
1158888499 18:61851371-61851393 ATTGAAGAGGGGAGGGAGGACGG + Intronic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159160328 18:64636470-64636492 ACTGAGGAGGGACAGGAGAAAGG + Intergenic
1161415676 19:4145274-4145296 GGGGAGGAGGGAAAGGAGGAGGG + Intergenic
1161741674 19:6024716-6024738 AGTGAGGACGGGAGTGAGGACGG + Intronic
1161935436 19:7368948-7368970 AGAAGGGAGGGAAATGAGGACGG + Intronic
1162188320 19:8924093-8924115 ATTTTGGAGGGAAATTAGGAAGG + Intronic
1162322554 19:9978754-9978776 ATGGTGGAGGGAACTGGGGAAGG - Intronic
1162336279 19:10062412-10062434 CTTGAGGAGGGAGATCAGCAGGG - Intergenic
1162790242 19:13058998-13059020 TGAGAGGAGGCAAATGAGGATGG - Intronic
1163149040 19:15400327-15400349 GATGAGGAGGGAAAAGAGGATGG - Exonic
1163409113 19:17142300-17142322 CTAGGGGAGGGAAATGGGGAGGG + Intronic
1163668415 19:18613681-18613703 TCTGAGGAGGGAGATGGGGAGGG - Intronic
1164586730 19:29480448-29480470 GATCAGGAGGGAAAGGAGGAGGG + Intergenic
1166246648 19:41532275-41532297 AATGAGGAAGGACAGGAGGAAGG - Intergenic
1166329497 19:42069938-42069960 AGGGAGGAGGGAGAGGAGGATGG + Intronic
1166879577 19:45919586-45919608 ATTGAGGTGGGAAGCCAGGAAGG + Intergenic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1167195207 19:48023502-48023524 AAAGAGGAAGGAAATAAGGAAGG + Intronic
1167413714 19:49359999-49360021 AGTGAGGAAGGCAGTGAGGAGGG - Exonic
1167429152 19:49444358-49444380 AGGGAGGAAGGAAAGGAGGAAGG - Intergenic
1167483863 19:49748692-49748714 ATCCAGGAGGGAAAGGGGGATGG + Intronic
1167663560 19:50810645-50810667 GTTGCGGATGGTAATGAGGATGG + Intergenic
1167682285 19:50931173-50931195 ATTGAGGAAGGAAAGGAGGGAGG - Intergenic
1167688505 19:50970836-50970858 AGAGTGGAGAGAAATGAGGAGGG + Intergenic
1167691871 19:50990209-50990231 ATTGGGGATGGAAATGAGAATGG - Intergenic
1167695829 19:51015256-51015278 ATTGAGGATAGGGATGAGGAGGG + Intronic
1167851079 19:52202642-52202664 AGTGAGGAGGTAACTGAGAAGGG + Intronic
1168251598 19:55145381-55145403 AGGGAGGAGGGAAAGGGGGAGGG + Intronic
925021882 2:576245-576267 ATTCAGGATAGAAATGAGGACGG - Intergenic
925175771 2:1782612-1782634 ATTCAGATGGGACATGAGGAGGG + Intergenic
925299438 2:2800161-2800183 ATGGAGGAAGGGAAAGAGGAAGG + Intergenic
925566076 2:5256022-5256044 ATGGAGGATGGAAAGGAGCAAGG - Intergenic
925699355 2:6618074-6618096 AGTGGGAAGGGAAATGAGTAAGG + Intergenic
926612342 2:14958941-14958963 ATTGCAGTGGGAAAGGAGGAAGG + Intergenic
926993808 2:18711614-18711636 TTTGATGAGAGAAATGAGCAGGG + Intergenic
927083590 2:19653617-19653639 ATGGAGGAGGGCAGAGAGGATGG + Intergenic
927429277 2:23013179-23013201 GTTGAGGAGGGAAAGGAGACAGG + Intergenic
927996052 2:27487293-27487315 ATTGATTATGGAAATCAGGAAGG - Intronic
928211612 2:29327972-29327994 ATGGAGGAGGGAGAGGATGAGGG + Intronic
928269293 2:29841974-29841996 ATGGAGGAAGGAAAGGAGAAGGG - Intronic
928326205 2:30321662-30321684 ATTGAGGAGGGAAAGAAGCGGGG - Intronic
928450512 2:31374274-31374296 ATTGAGGAGGGCAAGGAAGGAGG - Intronic
928792392 2:34973316-34973338 TTTGAGCAGGAAAATGAGTAAGG - Intergenic
928812826 2:35249537-35249559 ATTGTAGAGAGAAATGAAGAAGG - Intergenic
928855409 2:35797039-35797061 AAAGAGGAGGGAAATGCAGAAGG + Intergenic
929029133 2:37634678-37634700 ATTTAGGAGGCAAAAGAAGAGGG + Intergenic
929318698 2:40513614-40513636 ATTCAGGAGGGATAAAAGGAGGG + Intronic
929897277 2:45973137-45973159 ATAGCGGAGGGAAATGCTGAAGG + Intronic
930395617 2:50820176-50820198 ATACAGGAGAGAAATCAGGATGG - Intronic
930539999 2:52693480-52693502 AGGGAGGAGGGAAAGGAGGAAGG + Intergenic
932002434 2:67897011-67897033 ACTGAGCAGGGAAATTGGGACGG - Intergenic
932989946 2:76774608-76774630 AAGGAGGAGGAACATGAGGAAGG + Intronic
933075977 2:77927167-77927189 TCTGAGGAGAGAGATGAGGATGG + Intergenic
934765528 2:96878162-96878184 GTTGAGGAGGAAAAGGAGGATGG + Intronic
935081121 2:99795657-99795679 AGGTGGGAGGGAAATGAGGAGGG - Intronic
935151671 2:100442497-100442519 ACTGAGCTGGGAAATGAGGCTGG - Intergenic
935308361 2:101759557-101759579 AGAGAGGAGGGGAATGGGGAGGG - Intronic
935391151 2:102553952-102553974 ATACAGGAGGGAAATGAGTGTGG + Intergenic
935509302 2:103951350-103951372 AGTGATGAGGAAAATGAGGGGGG - Intergenic
936055195 2:109257344-109257366 ATTGAGGAGGGAATGAAAGAAGG + Intronic
937550156 2:123077971-123077993 ATTGAGTAGGCAAAGGAGAAGGG + Intergenic
937552133 2:123107551-123107573 ATGGGGGAGGGAAAAGTGGAAGG - Intergenic
937741900 2:125364494-125364516 ACTGGGGAGGGAAATGGTGATGG - Intergenic
938794968 2:134710339-134710361 TTTGAGTTTGGAAATGAGGAGGG - Intronic
939165966 2:138641735-138641757 ATTGAGCAGGGAGAGGAGGTGGG - Intergenic
939416203 2:141900919-141900941 ATTGAGGTGAGAAAAGAGAAGGG + Intronic
939672802 2:145034312-145034334 AATGTGGAGTGAAATGAGAAGGG + Intergenic
939761731 2:146190902-146190924 AAAGAGGAGGGAAAGAAGGAAGG + Intergenic
940610589 2:155986194-155986216 ACTGAGGAGGGAAAGCAGCAGGG + Intergenic
941023098 2:160430946-160430968 CTGGAGGAGGGAAAGGGGGATGG - Intronic
941658377 2:168169089-168169111 ATGGATGAGGGGAATGATGAAGG - Intronic
941775087 2:169384682-169384704 ATTGAGGAGCCAAATGAGTAAGG - Intergenic
942123411 2:172800919-172800941 AATGAGGAGGGAAATGGGGTTGG + Intronic
942165731 2:173238998-173239020 ATGGAGGATGCAAATGTGGATGG - Intronic
942217610 2:173737806-173737828 AGGAAGGAGGGAAATAAGGAAGG + Intergenic
942217648 2:173738020-173738042 AGGAAGGAGGGAAATAAGGAAGG + Intergenic
942665036 2:178308472-178308494 ATTTAGGAGAGAAATGGGGCTGG - Intronic
944053022 2:195492827-195492849 ATTGAGGAGGGAAAGAAAGAAGG + Intergenic
945187222 2:207151386-207151408 ATTGAGGAGGGCAGGGGGGAGGG + Intronic
945988449 2:216372542-216372564 ATTTAGGAAGGGAAGGAGGAGGG + Intergenic
946139232 2:217674353-217674375 ATTGAGGAAGGAAAGTAGGAAGG + Intronic
946553018 2:220823641-220823663 AGGGAGGAAGGAAAGGAGGAAGG - Intergenic
946553044 2:220823718-220823740 AGGGAGGAAGGAAAGGAGGAAGG - Intergenic
947037751 2:225878832-225878854 AGTGAGGAAGGAAGGGAGGAAGG - Intergenic
947455750 2:230252423-230252445 ATGCAAGAGGGAAATGAGGGAGG + Intronic
947762608 2:232614383-232614405 CTTGAGGAGGCAGAGGAGGAAGG - Intronic
947946047 2:234103207-234103229 ATTTAAGAGGGAAGTGTGGATGG - Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948282424 2:236757611-236757633 TTTGAGGAGGGAGATGAGCTGGG - Intergenic
948529763 2:238597014-238597036 ATTTTGGAGGGAAAAAAGGAAGG - Intergenic
1168873079 20:1147516-1147538 ATTGAGGAGGAGAAAGGGGATGG - Intronic
1168899315 20:1348099-1348121 AGTAGGGAGGGAAATGTGGATGG - Intronic
1169473018 20:5904508-5904530 ATGGATGAGGGAAATGGGCAAGG + Intergenic
1169549816 20:6691146-6691168 AGTGAACAGGGAAGTGAGGAAGG + Intergenic
1169585984 20:7086048-7086070 ATGGAGGAGGAAAAGAAGGAAGG - Intergenic
1170405621 20:16032748-16032770 AGGGAGGAGGGAAGAGAGGAAGG + Intronic
1170797156 20:19558059-19558081 ATGGGGGAGGGAAATGAGGATGG + Intronic
1170824884 20:19784891-19784913 AGAGAGGAGGGAAACTAGGAAGG + Intergenic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1171163967 20:22954673-22954695 AATGAGGAGGGAAGAGAGGAAGG + Intergenic
1171383758 20:24753154-24753176 ATGGTGGAGGGAAAAGAGGTAGG - Intergenic
1171997112 20:31740064-31740086 GTTGAGAAAGGAAATGAGAAAGG - Intronic
1172614469 20:36274392-36274414 AGAGATGAGGGAAATGGGGAGGG - Intergenic
1173174427 20:40753743-40753765 AGTGAGGAGAGAAATGGAGATGG + Intergenic
1173267756 20:41501123-41501145 ATTTAGGAAGGAAATGAGGTAGG - Intronic
1173284718 20:41659814-41659836 ATGGAGGTGAGAGATGAGGATGG - Intergenic
1173317803 20:41960829-41960851 ACTGATGAGGAAACTGAGGAAGG + Intergenic
1173397167 20:42690371-42690393 ATTGAGGAAAGAAATGATGGAGG + Intronic
1173435707 20:43030558-43030580 AGTGAGGATGGAACTTAGGATGG + Intronic
1173607428 20:44341551-44341573 ATTGTGGTGGAAAGTGAGGAGGG + Intronic
1173609873 20:44359242-44359264 AGTGAGGAGGGCAGAGAGGAAGG - Intronic
1173790431 20:45824494-45824516 ATCGAGGAGGTGGATGAGGACGG - Exonic
1173824493 20:46038908-46038930 CCTGAGGAGGCAAATGATGAGGG + Intronic
1174098278 20:48106895-48106917 ATTGAGCAGGGGAGTGAGAAGGG - Intergenic
1174586148 20:51609791-51609813 ATTGAGGAGAGCAAGGTGGAAGG - Intronic
1175121903 20:56722284-56722306 CTGCAGGAGGGAAAAGAGGAAGG + Intergenic
1175135215 20:56818365-56818387 AGGGAGGAGGGAAGGGAGGAAGG + Intergenic
1175150323 20:56928511-56928533 ATTGAGGTGGGAGGTGGGGAAGG - Intergenic
1175279819 20:57795494-57795516 ATGGAGGAGGGAAATGAATGTGG - Intergenic
1175287694 20:57848717-57848739 AGGGAGAAAGGAAATGAGGAAGG - Intergenic
1175382672 20:58574629-58574651 ATGGAGGAAGGGAATGAGGGAGG - Intergenic
1175491714 20:59384471-59384493 AGTGGGGAGGGAGATGAGTAAGG + Intergenic
1175556625 20:59864908-59864930 ATTCTGGGGGGAAATGTGGATGG - Intronic
1177115126 21:17075821-17075843 TTGGAGAAGGGAAATGAGCATGG + Intergenic
1177146903 21:17416603-17416625 ACTGGGAAGGGAAAGGAGGAAGG + Intergenic
1177436056 21:21053764-21053786 ATTTAGGAGGGGAATTAAGATGG - Intronic
1177685049 21:24424987-24425009 TTTGTGGAAGAAAATGAGGAAGG - Intergenic
1178205475 21:30459403-30459425 ATTGAGGAGGAAAATAGGAATGG - Intergenic
1178595700 21:33950460-33950482 CAAGAAGAGGGAAATGAGGAGGG + Intergenic
1178848150 21:36190869-36190891 ATGGAGGATGGAGATGAGAAAGG + Intronic
1179302309 21:40123742-40123764 ATGGAGGAGGGAAAGAAGGGAGG + Intronic
1179410992 21:41163082-41163104 CTTGAGGAGCAAAATGAGGCAGG + Intergenic
1179487799 21:41722119-41722141 GTTGAGGAGGAAAAGGAGGAGGG - Intergenic
1179615387 21:42580097-42580119 AGGGGGGAGGGAAAAGAGGAGGG - Intronic
1179652178 21:42818632-42818654 TTTTAGGAGGTAAATAAGGAAGG + Intergenic
1180059091 21:45375504-45375526 ATGGAGGAGGGGGAGGAGGAGGG + Intergenic
1181368300 22:22397044-22397066 ACTGAGGAGGGTGAGGAGGAGGG - Intergenic
1182083220 22:27543652-27543674 AAGGAGGAGGGAAGGGAGGAGGG - Intergenic
1182126049 22:27816669-27816691 AGGAAGGAGGGAAAGGAGGAAGG - Intergenic
1182853041 22:33492884-33492906 AGGGAGGAGGGAAATGCGGGCGG + Intronic
1183306148 22:37084229-37084251 ATTGAGGAGGGAAGAGAGGGAGG + Intronic
1183324502 22:37184043-37184065 TTTGGGGAGGGCAATGAGGAGGG + Intronic
1183796296 22:40121206-40121228 AGGGAGGAGGGAAAGGAGGAAGG - Intronic
1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG + Intronic
1184073809 22:42163455-42163477 CTTCAGTAGGGAAATTAGGAAGG + Intronic
1184297703 22:43535744-43535766 GTTGTTGAGGCAAATGAGGAAGG + Intronic
1184498953 22:44860453-44860475 ACTTAGGAGGGAAAGGTGGAGGG - Intronic
1184639265 22:45860459-45860481 AGGGAGGATGGAAAGGAGGAGGG - Intergenic
1185054387 22:48570673-48570695 ATAGAGGAATGAAAAGAGGAAGG - Intronic
1185184102 22:49382272-49382294 AGTTAGGAGGGAAGTGGGGAAGG + Intergenic
949198237 3:1339224-1339246 ATTGAGGAGGGCATTGAGTGGGG - Intronic
949388242 3:3529747-3529769 TTTGAGTAGTGAAATGAGGGAGG + Intergenic
949515104 3:4800482-4800504 CTTGGGGAGGGCAATGACGATGG - Exonic
949862108 3:8515365-8515387 ATGGAGGAGGGCACTGAGGAAGG - Intronic
950912953 3:16614056-16614078 ACTGAGGAGGAAAATAAAGAGGG - Intronic
951150107 3:19278479-19278501 AGGAAGGAGGGAAATGAGGAAGG + Intronic
951980335 3:28559109-28559131 ATTGAATAGGGAAAGGAGAAGGG - Intergenic
952046488 3:29327486-29327508 AAGGAGGAGGAAAAGGAGGAAGG - Intronic
953225302 3:41013498-41013520 ATAGAGTGGGGAAATGAGGCAGG + Intergenic
953295770 3:41714519-41714541 AATGAGGAGGGAAATACAGAGGG - Intronic
953518911 3:43622436-43622458 ATGGAAGAGGGAAATGTGAAGGG - Intronic
953846946 3:46435136-46435158 AATGAAGAGAGAAATGAAGAAGG - Intergenic
954586164 3:51738487-51738509 ATACAGCAGGGAAATGACGAGGG + Intergenic
954973798 3:54674368-54674390 AGTGAGAAGGGGAAGGAGGATGG + Intronic
954973807 3:54674445-54674467 ATTGAGCAGGGAAAAGTAGAAGG + Intronic
955093939 3:55778352-55778374 ACAGAGGAAGGAAAGGAGGAGGG + Intronic
955201858 3:56858801-56858823 AGGGTGGAGGGAAATGAGGTTGG + Intronic
955563159 3:60215013-60215035 CTTGAGGAGGGAGATGAGGAGGG + Intronic
955631878 3:60983282-60983304 AGAGAAGAAGGAAATGAGGAAGG + Intronic
955660449 3:61293449-61293471 ATTGAGGCTGGAGAGGAGGATGG + Intergenic
955820085 3:62887535-62887557 ATTGAGGCGGGAAATAAGAAAGG - Intergenic
956660196 3:71589899-71589921 TATGAGAAGGGAAATGAGGCAGG + Intergenic
956857900 3:73294096-73294118 ATAGATGAGGAAAATGTGGATGG + Intergenic
957361440 3:79164524-79164546 ATAAAGCAGGCAAATGAGGATGG - Intronic
957405217 3:79766974-79766996 TTTGAGGGAGGAAATGAGGGAGG - Intronic
957515066 3:81239734-81239756 ATTGAGGAAGGAAAGGCTGAGGG - Intergenic
957839892 3:85654327-85654349 ATTGAGTAGGGAAGAGGGGATGG + Intronic
958116688 3:89229011-89229033 AGTGAAAAGGGAAGTGAGGAAGG - Intronic
958123020 3:89317651-89317673 TTTGGGGCAGGAAATGAGGAAGG - Intronic
958196527 3:90247971-90247993 ATTGAGGAGGGTAAACAGGAAGG + Intergenic
958419717 3:93916608-93916630 ATTGAGGAGGGTAAACAGGAAGG + Intronic
958441271 3:94158911-94158933 CTTGAGAAGGGTAATGAGAAAGG - Intergenic
958477005 3:94597305-94597327 TCAGAGGAGAGAAATGAGGAAGG - Intergenic
958867658 3:99519684-99519706 AAAGAGGAGGAAAAGGAGGAGGG + Intergenic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959521425 3:107326747-107326769 CTTGAGGCGGCAGATGAGGAGGG + Intergenic
959716528 3:109439479-109439501 TTTGAGGTAGGAGATGAGGAAGG + Intergenic
959758678 3:109930148-109930170 ATTAAGGAAGGAAGGGAGGATGG - Intergenic
959963906 3:112332870-112332892 ACTGAGAAAGGAAATGAGGTGGG - Intronic
960418706 3:117416425-117416447 AGTGAGGATGCAAATGAGGAGGG - Intergenic
960441569 3:117694953-117694975 ATTGAGGACTGAAATAACGAGGG - Intergenic
960537471 3:118829090-118829112 CTTGAGGAGGGAGATGAGGCTGG + Intergenic
961042130 3:123684926-123684948 ATAGAGGAGGGAGAAGAAGAAGG + Intronic
962559549 3:136591329-136591351 AGTAAGGAGGGAAAGAAGGAAGG + Intronic
962962876 3:140327507-140327529 TTTGAGGAGAGATATGAGGAAGG - Intronic
963127265 3:141827451-141827473 ATAGAGAAGGGACATGAGCAGGG + Intergenic
963180274 3:142348069-142348091 GTGGAGGTGGGAAATGAGTAGGG + Intronic
963418718 3:145031554-145031576 ACAGAGGAGGGAGAGGAGGAGGG + Intergenic
963429552 3:145181222-145181244 AGTGAGGGGGGAAATGAGGTAGG - Intergenic
964028308 3:152105045-152105067 AATGAGAATGGAAAAGAGGAAGG - Intergenic
965743506 3:171901275-171901297 AATGAGGTTGGAAATGTGGATGG + Intronic
966588203 3:181650960-181650982 ATAGAGGGAGGAAAGGAGGAAGG + Intergenic
966592358 3:181696572-181696594 ATTGAGGAAGAAAAAGAGAAAGG - Intergenic
966754143 3:183352722-183352744 ATCCAGAAGGGAAGTGAGGAGGG - Intronic
967068662 3:185942966-185942988 TTTGAGGAGTGATATGAGCAGGG + Intergenic
967303977 3:188042994-188043016 ATTTGGGAGGGAGATGATGAGGG - Intergenic
967364344 3:188669099-188669121 ATTGAGAAGGGAAGTGAGTGGGG + Intronic
967842655 3:194019246-194019268 CTGGAGGAGGGACTTGAGGAAGG - Intergenic
968337409 3:197925351-197925373 TGTGAGGTGGGATATGAGGATGG + Intronic
968952019 4:3700249-3700271 AGTGGGGAGGGTAAGGAGGAGGG + Intergenic
969032135 4:4223989-4224011 ATGGAGGAAGGAAGAGAGGAAGG + Intronic
969118752 4:4891249-4891271 ATTAAGTAGTGAAATGAGAAGGG + Intergenic
969185336 4:5470246-5470268 ATTGATGAGGGAAATGCAGTTGG + Intronic
969373730 4:6749805-6749827 AATGAGAAGGGAAAGGAGAAAGG - Intergenic
969924911 4:10576486-10576508 TTTTAGGAGGGAAGTGAAGATGG + Intronic
969954804 4:10877995-10878017 AAGGAGGAGGAAAAGGAGGAAGG - Intergenic
970344826 4:15143408-15143430 GTTGATGAGGGAGATTAGGAGGG - Intergenic
970377254 4:15471440-15471462 AATGAGGAGGGAAAAGAGCTTGG - Intronic
970565241 4:17325684-17325706 ATTGAGGAGGGCTCTGAGGCTGG - Intergenic
970690338 4:18612637-18612659 AGGGAGGAAGGAAAGGAGGAAGG + Intergenic
970738998 4:19210668-19210690 TGGGAGGTGGGAAATGAGGATGG + Intergenic
970768080 4:19575609-19575631 ATTGAAAAGGGAAAAGGGGAAGG + Intergenic
970805106 4:20021850-20021872 ATACAAGAGGGAACTGAGGAAGG - Intergenic
971642505 4:29153849-29153871 ATGGAGGAAGGCAAAGAGGAAGG + Intergenic
972005265 4:34094525-34094547 ATTTTTGAGGGAAATGAGGGTGG + Intergenic
972450630 4:39194770-39194792 CTTGCGGAGGGACATGGGGAGGG - Intronic
972646820 4:40976146-40976168 ATAGAGGAGAGAAATAATGAAGG - Intronic
972834519 4:42853540-42853562 ATACAGGAGGGAAGAGAGGAAGG + Intergenic
972868112 4:43259506-43259528 AAAGAGGAGAGAAATGAGGATGG - Intergenic
973120470 4:46515567-46515589 ACTGAGGAGGCAAATGTGGGAGG - Intergenic
973185718 4:47325522-47325544 AATGAGGAAGATAATGAGGAAGG - Intronic
973189682 4:47372886-47372908 AGTGAGGAGGGAGAAGAGGAAGG - Intronic
973966670 4:56170088-56170110 ATGGAGGAGGAAGAGGAGGAAGG - Intergenic
975494470 4:75022791-75022813 ATTTGGCAGGGAAATGAGAATGG + Intronic
975616442 4:76251919-76251941 ATTGAGGAGGGAAGGCAGGCTGG - Intronic
975664070 4:76716755-76716777 ATTCCCCAGGGAAATGAGGAAGG - Intronic
975723287 4:77268744-77268766 ATGGAGGAGGGAGGTGAGCAGGG + Intronic
975760921 4:77618867-77618889 ATTGAAGAGGGCAGTGAGGGCGG + Intergenic
975812192 4:78181241-78181263 GTTGAAGAGGTAAAAGAGGAGGG - Intronic
975967969 4:79998714-79998736 ATAGAGGATGGATATGAGGAAGG + Intronic
975997070 4:80328134-80328156 AGAGAACAGGGAAATGAGGAAGG + Intronic
977176230 4:93823321-93823343 AAAATGGAGGGAAATGAGGAGGG - Intergenic
977371745 4:96145699-96145721 ATAGAGGAAGGAAATGAGTCTGG - Intergenic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977842562 4:101726257-101726279 ATTTAGGAGGGAAATGGAGGGGG - Intronic
978014904 4:103731530-103731552 AATGAGAAGGGAAATGAGAAGGG + Intergenic
978168765 4:105643316-105643338 ATTAAGGAAGAAAAAGAGGAAGG - Intronic
978278662 4:106982917-106982939 ATTGGGGAGGGAAAGAAAGAAGG + Intronic
978448974 4:108808259-108808281 ATAGTGGAGGAAAATTAGGAGGG + Intergenic
979348546 4:119619004-119619026 ATTGAAAAGAGAAAAGAGGATGG - Intronic
980111217 4:128639040-128639062 GTTGAGAAGGGAATTCAGGAAGG + Intergenic
981220231 4:142223436-142223458 ATGGAGGAGGGAAAAGTGTATGG - Intronic
981490460 4:145334058-145334080 ATTATGGATGTAAATGAGGAAGG + Intergenic
981637967 4:146902159-146902181 TCAGAGGAGGGAAAAGAGGAAGG - Intronic
981743174 4:148024374-148024396 AGTGAGGAAGGGGATGAGGATGG + Intronic
981918100 4:150056896-150056918 AAAGAGGAGGAAAATGTGGAGGG - Intergenic
982787741 4:159556146-159556168 ATGGAGGAAGGAAAGAAGGAAGG - Intergenic
982787749 4:159556182-159556204 ATGAAGGAGGGAAAGAAGGAAGG - Intergenic
982987434 4:162228618-162228640 ACTTAGGACGGTAATGAGGATGG + Intergenic
983118821 4:163854137-163854159 ATTGAAAAGGGATAAGAGGAAGG - Exonic
983202451 4:164875757-164875779 ACTGGGGCGGGAAATGGGGAGGG + Intergenic
983459776 4:168013969-168013991 ATTGTGTAGGGAAATGACAAGGG + Intergenic
983527824 4:168778128-168778150 ATTCAGGAAAGAAAAGAGGAAGG - Intronic
985197126 4:187443398-187443420 AGTCAGGAGGGAAAAGGGGAGGG + Intergenic
985208642 4:187568425-187568447 ATGGAGGGAGGGAATGAGGAAGG - Intergenic
985829565 5:2218266-2218288 AAAGAGGAGGGAAAGGAGGTAGG + Intergenic
985950780 5:3220113-3220135 ATGGAGGAGGGAGAGGAGCAGGG - Intergenic
985993701 5:3584625-3584647 AGTGAGGAGGGACAGGAGTAAGG + Intergenic
985993721 5:3584698-3584720 AGTGAGGAGGGATGGGAGGAAGG + Intergenic
985993814 5:3585076-3585098 AGGGAGGAGGGACAAGAGGAAGG + Intergenic
985993823 5:3585103-3585125 AGGGAGGAGGGACAGGAGGAAGG + Intergenic
986022973 5:3821998-3822020 ATGGAGGAGGGCATTGTGGAGGG + Intergenic
986347992 5:6852390-6852412 GTTGAGGAGGGAAAGTAGCATGG - Intergenic
987191279 5:15480877-15480899 GTTGAGGAGGAGGATGAGGATGG + Intergenic
988821174 5:34887382-34887404 AATGATGAGTGAAATGAGCAGGG + Intronic
988883350 5:35529495-35529517 AATGAGAAGGGAAAAGTGGAAGG - Intergenic
989201658 5:38770099-38770121 TTTGAGGAGGGTAATGAAGTTGG + Intergenic
989527017 5:42465461-42465483 GTTGAAGAGGTAAAAGAGGAGGG - Intronic
989554598 5:42778599-42778621 ATAGAGGAGGCAAAAGAGAAAGG - Intronic
990327313 5:54691186-54691208 ATTCAGTAGGGGCATGAGGATGG + Intergenic
990636294 5:57731682-57731704 AGTGAGGCAGGAAATGAGGATGG + Intergenic
992222538 5:74586996-74587018 ATTGAGGAGGGGAGGGAAGATGG + Intergenic
992848961 5:80784679-80784701 AATGTGGAGGGAAGTGGGGATGG - Intronic
993015372 5:82529828-82529850 AATCACAAGGGAAATGAGGAAGG - Intergenic
993095024 5:83471654-83471676 AAGGAGGAGGGAGAGGAGGAGGG - Exonic
993415733 5:87627778-87627800 AATGAGGAGGGAAGAAAGGAAGG + Intergenic
993847710 5:92966336-92966358 GTTGAGGAGGGATTTCAGGATGG - Intergenic
993949297 5:94154108-94154130 TTTTAGGTGGGAAATGAAGAAGG - Intronic
994306681 5:98213795-98213817 ATTGACGATGGAAATGAGTTTGG + Intergenic
995167993 5:109069590-109069612 ATTGAGGTGGGAAATGACTGTGG + Intronic
995667477 5:114559386-114559408 AATGAGAAGGGGCATGAGGAGGG + Intergenic
996489884 5:124081509-124081531 AGTCAGGTGGGAAAGGAGGAAGG - Intergenic
998207740 5:140171089-140171111 CTTGAAGTGGGAAATGAGAATGG - Intergenic
998236222 5:140401057-140401079 ATTTGGGAGGGAATAGAGGACGG - Intergenic
998394727 5:141811468-141811490 AATGAAAAGGGGAATGAGGAAGG - Intergenic
998484086 5:142486597-142486619 GAGGAGGAGGGAAAGGAGGAAGG - Intergenic
999030388 5:148284122-148284144 ATTGATGAAGGAAGAGAGGAAGG - Intronic
999436373 5:151566650-151566672 ATTGCAGATGGCAATGAGGAGGG - Exonic
1000044736 5:157512892-157512914 ACTTAGGAGGGAATTGAGGTAGG - Intronic
1000147586 5:158468344-158468366 AGGGAGGAAGGAAATGAGGGAGG - Intergenic
1000203847 5:159038264-159038286 ACAGTGGAGGGAAATGAGGGGGG + Intronic
1000469827 5:161627553-161627575 ATGGAGGAAGGGAATGAGGACGG - Intronic
1000503133 5:162077915-162077937 ATTGGGGGAGGAAAGGAGGAGGG + Intronic
1000997680 5:167974875-167974897 TCTGTGGAGGGAAGTGAGGAAGG - Intronic
1001029245 5:168250021-168250043 AATGAGCAAGGAAATCAGGATGG + Intronic
1001272946 5:170329384-170329406 ATTTGGGATAGAAATGAGGAAGG - Intergenic
1002159412 5:177306354-177306376 ATGGGGGAGGGAAATTAGGTTGG + Intronic
1003071465 6:2948449-2948471 TTTGTGGAGGTCAATGAGGAAGG - Exonic
1003330983 6:5128632-5128654 TATGAGGAGGGAAAAGAGGAGGG - Intronic
1003597476 6:7487238-7487260 ATTGAGGAAGGAGATGAGGAGGG - Intergenic
1003872783 6:10415125-10415147 AAGGAGGAGGGAGAGGAGGAGGG + Exonic
1004131175 6:12921531-12921553 AGGGAGGAGGGAAAGGAGGAAGG + Intronic
1004131214 6:12921660-12921682 AGGGAGGAGGGAAAGGAAGAAGG + Intronic
1004181801 6:13386958-13386980 ATGGAGGCTGGTAATGAGGATGG - Intronic
1004239593 6:13907984-13908006 AGGGAGGAAGGGAATGAGGAAGG - Intergenic
1004456474 6:15796347-15796369 AGAGTGGCGGGAAATGAGGATGG + Intergenic
1004751297 6:18565444-18565466 ATGGAGGAAGAAAAGGAGGAAGG - Intergenic
1005510280 6:26506346-26506368 ATGAAGGAGGTAAATAAGGAAGG - Intronic
1006027103 6:31154169-31154191 ATTGTGGAGGGCAGTGAGGAAGG - Intronic
1006135759 6:31895844-31895866 ATAGAGGAGGGAAGTGACAAGGG - Intronic
1006578714 6:35064280-35064302 ATGGAAGATGGAAATGAGGCTGG + Intronic
1007352087 6:41281289-41281311 GCTGAGGAGGGAAATGAGCATGG + Intronic
1007436508 6:41816517-41816539 ATTGAGAAGAGAGCTGAGGATGG - Intronic
1007789635 6:44301653-44301675 AGTGGTGAGGGAAGTGAGGAAGG - Intronic
1007870249 6:45027338-45027360 AATGAGGAAGTAAATGAGGAAGG - Intronic
1008296075 6:49779289-49779311 AATGGGGAGGGAAAGGAAGATGG - Intergenic
1009029456 6:58038882-58038904 ATCCAGGAGAGAAATGAGGGAGG - Intergenic
1009056785 6:58345908-58345930 ACTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009280501 6:61744605-61744627 ATTGAGGAGGGAAGGGCAGATGG + Intronic
1009616559 6:66015756-66015778 ATTGGGGTGGGAAGTGGGGATGG - Intergenic
1011140641 6:84151806-84151828 ATTGTTGAAGAAAATGAGGAAGG + Intronic
1012216164 6:96587222-96587244 TTTGATGAGAGAAATGAGCAGGG - Intronic
1012252763 6:96997165-96997187 ATTGAGCAAGCAAATGAGGAAGG + Intronic
1012734156 6:102917936-102917958 AGGGAGGAGGGAAAGGAAGAAGG - Intergenic
1013313980 6:108923914-108923936 AAGGAGGAGGGGAATGAGGAGGG - Intronic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1014232094 6:118915266-118915288 ATTTGGGAGGGAGGTGAGGATGG - Intronic
1014288633 6:119532690-119532712 ATTGAGCAGAGAAAAAAGGATGG + Intergenic
1015030947 6:128595207-128595229 AGTGAGTGGGGAAATGAAGACGG + Intergenic
1015471282 6:133609672-133609694 ATTTCTGAGGGAAATAAGGAAGG - Intergenic
1015885198 6:137910674-137910696 TGGGAGGAGGGAAAGGAGGAAGG + Intergenic
1015890201 6:137962956-137962978 ACGGAGGATGGAAAGGAGGATGG + Intergenic
1015903305 6:138089900-138089922 ATTGAGGAGGGGAAGAAGGCTGG + Exonic
1016084385 6:139894818-139894840 ATTGGGGAGGGGAATGGTGAGGG + Intergenic
1016871667 6:148824022-148824044 ATAGAGGAAGGAAATGAGAGTGG + Intronic
1017541206 6:155404892-155404914 AATGAGGAGGGAGATGTGGAAGG - Intronic
1017763494 6:157589118-157589140 ATGGAGGAAGGAAAAGAGAAAGG + Intronic
1018568681 6:165184479-165184501 ATTGCGGGGTGAAAGGAGGAGGG - Intergenic
1018650965 6:165990946-165990968 ATTGAAGAAGAAAGTGAGGAAGG - Intergenic
1018665510 6:166132893-166132915 AGGGAGGAAGGAAAGGAGGAGGG + Intergenic
1019776132 7:2913060-2913082 GGGGAGGAGGGAAGTGAGGAGGG + Intronic
1020731145 7:11882473-11882495 AGGAAGGAGGGAAAGGAGGAGGG - Intergenic
1021694131 7:23259861-23259883 TCTGAGGAGGGAAAATAGGATGG - Intronic
1022244030 7:28540391-28540413 ATTGAGGAGGGCAGGGTGGAAGG + Intronic
1022287876 7:28972828-28972850 ATTGATGAGAGAAAGGAGAAAGG - Intergenic
1022450925 7:30514016-30514038 ATCCAGGAGTGAGATGAGGATGG - Intronic
1022499822 7:30875709-30875731 AATGAGGAGGGAAGTGGGGAAGG + Intronic
1023136882 7:37061510-37061532 ATTGTGGACGGAAAAAAGGACGG - Intronic
1023338293 7:39192921-39192943 ATGGAGGAAGGAAGAGAGGAAGG + Intronic
1023441219 7:40186717-40186739 AGTGAGCAGGGAAGTGAGCAAGG + Intronic
1023522281 7:41060495-41060517 ATTGAGGAGGGAGGTGAGGAAGG - Intergenic
1024214373 7:47234801-47234823 AGTGAGGAGGGCTATGAGAATGG - Intergenic
1024455134 7:49597262-49597284 ATTGAAGAAGGAAATGAGAGAGG + Intergenic
1024471190 7:49769989-49770011 ATTGAGGAGGGAAAGGGAAAAGG - Intergenic
1024957002 7:54932989-54933011 GTGAAGGAGGGAAGTGAGGATGG + Intergenic
1025031578 7:55561279-55561301 TGTGAGGAAGGAGATGAGGAAGG - Intronic
1025116017 7:56258922-56258944 AATGAGGAAGGAAGTGAGGGAGG - Intergenic
1026191913 7:68136509-68136531 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026191921 7:68136528-68136550 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026361006 7:69600299-69600321 ATTGGGGAGGGAGAGGAGGAAGG - Intronic
1026666564 7:72345510-72345532 AGGGAGGAAGGAAATGAGGAAGG + Intronic
1027630881 7:80604128-80604150 CTAGAGGAGGGGAATGAGGTTGG + Intronic
1027711139 7:81602759-81602781 ATTTAGGAGGAAGAAGAGGAGGG + Intergenic
1028146275 7:87323373-87323395 CTTGAGGAGGGAAATAAGACAGG - Intergenic
1028563257 7:92198827-92198849 AGGGAGGAAGGAAATGAGAAAGG + Intergenic
1030528822 7:110686720-110686742 CTTGATGAGGGCAGTGAGGATGG - Intronic
1030564879 7:111141305-111141327 ATTGGGAGGGGAAATGTGGAGGG - Intronic
1030679451 7:112419382-112419404 GGTGGGGAGGAAAATGAGGATGG + Intergenic
1031837491 7:126695875-126695897 ATTCAGGAAAGAAATGAGGAGGG + Intronic
1032007917 7:128318864-128318886 ATTGAAGAAGGAAAGGAGGAAGG + Intronic
1032287070 7:130546978-130547000 ATCAAGGAGGAAAATGATGATGG + Intronic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1033045143 7:137955199-137955221 ATTGAAGATGGAAATGGGCAAGG - Intronic
1033150843 7:138913886-138913908 TTTAAGGAAGGAAATGAAGAGGG + Intronic
1033166468 7:139042786-139042808 AGGGAGGAGGGAAATGGAGAGGG - Intergenic
1033727074 7:144130009-144130031 CCTGAGGAGGGCACTGAGGAAGG + Exonic
1033819336 7:145115209-145115231 ATTAAGGAGGGGAAAGATGATGG - Intergenic
1033941523 7:146660915-146660937 AGTGAGGCGGGGAATGTGGAAGG + Intronic
1034817297 7:154183591-154183613 ATGGAGGAAGGAAAGGAGGAGGG - Intronic
1034874817 7:154715923-154715945 ATTAAGATGGGAAATGAAGAAGG - Intronic
1035153873 7:156896572-156896594 AGGGAGGTGGGAAAAGAGGAGGG + Intergenic
1035483958 7:159207986-159208008 GACCAGGAGGGAAATGAGGATGG + Intergenic
1035484205 7:159209777-159209799 GTCCAGGAGGGAAATGAGGGTGG + Intergenic
1035673070 8:1434854-1434876 ATGGAGGAGGGAGGGGAGGAAGG - Intergenic
1035713764 8:1738460-1738482 ACGGAGGAGGGAAATGGGCAGGG + Intergenic
1035743593 8:1946177-1946199 ATGGAGGAAAGAAATGAGGAGGG + Intronic
1036098223 8:5748887-5748909 AATGATGAAGGAAAGGAGGAGGG + Intergenic
1036122232 8:6031066-6031088 ATTGAGCAGGTTAATGGGGATGG - Intergenic
1036561482 8:9903477-9903499 CCTGAGGAAGGAAAGGAGGAAGG + Intergenic
1036970424 8:13348868-13348890 CTTGAGGAGGGCAGTGGGGATGG + Intronic
1037045712 8:14300373-14300395 AGGGAGGAAGGGAATGAGGAAGG + Intronic
1037338885 8:17820712-17820734 ATTGAGTAAGGGAATGAAGACGG - Intergenic
1037480617 8:19302072-19302094 AATGAGGAAGGAAAGAAGGAAGG + Intergenic
1037480652 8:19302218-19302240 AATGAGGAAGGAAAGAAGGAAGG + Intergenic
1037508548 8:19557476-19557498 TTTGAGGTGGGAAATGAGGCTGG - Intronic
1037843548 8:22262869-22262891 ATTGAAGAGGCAAATGGGGCCGG - Intergenic
1038001594 8:23396388-23396410 AGGGAGGAAGGAAATGAGGAGGG + Intronic
1038348890 8:26758427-26758449 TTTGAGAGGGGAAATGAAGATGG + Intronic
1038415557 8:27392539-27392561 ATAGGGGAGGAAAATGAGGCTGG + Intronic
1038978060 8:32723721-32723743 ATTGTGGAAGGAGGTGAGGAAGG + Intronic
1039149130 8:34483692-34483714 GTTGAAAAGGGAAATAAGGAAGG - Intergenic
1039184468 8:34901180-34901202 TTTGAGGTGGGAAAGGAGCAGGG - Intergenic
1039781315 8:40788998-40789020 AGGGAGGAAGGAAAAGAGGAAGG + Intronic
1039968553 8:42301731-42301753 AGTGAGGAGGGACAAGAGGTTGG - Intronic
1039972534 8:42332501-42332523 ATTGGGGAGGGAAAGGATGTTGG + Intronic
1040564274 8:48552149-48552171 AAGGAGGAGCGAAAGGAGGAGGG - Intergenic
1040675909 8:49749727-49749749 AGGGAGGAGGGAAAAAAGGAAGG + Intergenic
1041321492 8:56618546-56618568 AGGGAAGAAGGAAATGAGGAAGG - Intergenic
1041588878 8:59552620-59552642 TTGGGGGAGGGACATGAGGAGGG - Intergenic
1041883554 8:62781261-62781283 ACTGATGAAAGAAATGAGGAGGG + Intronic
1042060956 8:64817090-64817112 ATTCAGAAAGGAAATGAGAAAGG + Intergenic
1042194445 8:66220549-66220571 ATTGATGAGGAAAATAAGGAGGG + Intergenic
1043172083 8:76978404-76978426 AAAGAGGTGGGAAATGAGGTAGG - Intergenic
1043342131 8:79252839-79252861 ATTGAGGAAGGAAGGAAGGAAGG + Intergenic
1043693017 8:83180826-83180848 ACTGAGGAGGGCAGAGAGGAAGG - Intergenic
1043753625 8:83972728-83972750 ATTGAGGAGTGAAGAGTGGAGGG - Intergenic
1044352334 8:91181376-91181398 AATTAGGAGGGGAATGAGGAAGG - Intronic
1044474166 8:92606614-92606636 AGTGAGGTGGAAAATGATGAGGG + Intergenic
1044516595 8:93146112-93146134 TTTGAGGAAGGAAATAAGAAAGG + Intronic
1044811148 8:96063539-96063561 AATGAAGAGGGGAATGAGGTAGG - Intergenic
1045003488 8:97898062-97898084 ACTGAAGAAGGGAATGAGGAAGG - Intronic
1045051835 8:98334548-98334570 ATTCAGGTGAGAAATGATGAGGG - Intergenic
1045194179 8:99913371-99913393 GTTGTGGAGGGAAATGATTAAGG - Intergenic
1045285688 8:100789337-100789359 ATTGAGGAGGGAGATGAAATTGG + Intergenic
1045412017 8:101929365-101929387 AGGGAGGAGGGAAGGGAGGAGGG + Intronic
1045605037 8:103763472-103763494 AGGGAGGAAGGAAATAAGGAAGG + Intronic
1045784996 8:105910566-105910588 TTTGAGGAGGAAAGTGAGAAGGG - Intergenic
1046258734 8:111737466-111737488 ACTGAGAAGTGAGATGAGGAGGG + Intergenic
1046666952 8:117014789-117014811 ATATAGCAGGGAACTGAGGAAGG - Intronic
1047469166 8:125150818-125150840 ATGGATGAGGGAACTGAGGCTGG + Intronic
1047576557 8:126162065-126162087 ATTGATAAGGGAAATGAAGATGG - Intergenic
1047832282 8:128647840-128647862 AGAGAGGAAGGAAAGGAGGAAGG - Intergenic
1048590299 8:135815149-135815171 AATGAGAAGGGAAAAGAGAAGGG + Intergenic
1049423267 8:142526113-142526135 ATAGGGGAGGGAGATCAGGAAGG + Intronic
1050218444 9:3357583-3357605 GCTGGGAAGGGAAATGAGGAAGG + Intronic
1050407616 9:5326871-5326893 ATTGATAACAGAAATGAGGAAGG + Intergenic
1050715304 9:8517816-8517838 GTTGAGGAGGGAAATAGGGCAGG - Intronic
1051238155 9:15023637-15023659 CTTGAGTAGGGAAAGGAGGATGG - Intergenic
1051552956 9:18350485-18350507 ATTGAGAAGGGAAAGGAGCAAGG + Intergenic
1051657585 9:19397776-19397798 ATTGAAGAAGGAAATGAAGAGGG - Intergenic
1051833122 9:21303430-21303452 ATGGAGGGGGGAAATAAGGTTGG - Intergenic
1052141092 9:24984929-24984951 ATGGAGAAGGGAAAGGAGAAAGG + Intergenic
1052262677 9:26536039-26536061 ACTGGAGAGGGAAATGAGAATGG + Intergenic
1052568655 9:30191324-30191346 ACTGAGGTGGTAAATGGGGAAGG - Intergenic
1053000357 9:34574324-34574346 AGAGAGGAGGGAAAAGAGAAGGG - Intronic
1053182261 9:35982880-35982902 ATTGAGGAGGGAAATAAGAGGGG - Intergenic
1053859497 9:42372614-42372636 AATGAGGTGTGAAAGGAGGATGG - Intergenic
1054251690 9:62723580-62723602 AATGAGGTGTGAAAGGAGGATGG + Intergenic
1054565802 9:66758097-66758119 AATGAGGTGTGAAAGGAGGATGG + Intergenic
1054743578 9:68832585-68832607 ATTAAGGAAGGAAAAGAAGATGG + Intronic
1054743803 9:68834267-68834289 AATGGGGATGGAAAAGAGGAAGG - Intronic
1055195769 9:73591665-73591687 ATTTAGGAGAGAGATGATGATGG - Intergenic
1055375778 9:75647399-75647421 AGAGGGAAGGGAAATGAGGAAGG - Intergenic
1055382375 9:75722860-75722882 ATAGAGTAGGGAAATGAGACAGG - Intergenic
1055654111 9:78436572-78436594 ATTGAGGAAGGAAGGAAGGAAGG + Intergenic
1056182850 9:84102390-84102412 AGTGAGGAGGGAAAGAAGGAGGG + Intergenic
1056964364 9:91153627-91153649 AATGAGTAGGGAAAGGTGGAGGG + Intergenic
1056974510 9:91239171-91239193 CTTGAGAAGGGAAAAGATGAAGG - Intronic
1058163521 9:101595105-101595127 AGAGAGGAGGGAAAGAAGGAGGG + Intronic
1058940770 9:109810802-109810824 CTTGAGTTGGGAAATGAGGAAGG + Intronic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1059625660 9:116062247-116062269 ATTGTGGAGGGAAGGAAGGAGGG - Intergenic
1059647132 9:116278944-116278966 ATTGAGATAGGCAATGAGGAAGG - Intronic
1059665267 9:116440338-116440360 AATGAGGTGGGAGATGAGCAAGG + Intronic
1060926456 9:127458831-127458853 TTTGAGAAGGAAAATGAGGCGGG + Intronic
1062050506 9:134444402-134444424 AAGGAGGAGGGGAAGGAGGAGGG - Intergenic
1062444388 9:136587589-136587611 AGAGAGGAGGGAACTGAGGCTGG - Intergenic
1185499100 X:584169-584191 AAGGAGGAGGGAGAGGAGGAGGG + Intergenic
1185499126 X:584269-584291 AAGGAGGAGGGAGAGGAGGAGGG + Intergenic
1185499154 X:584369-584391 AAGGAGGAGGGAGAGGAGGAGGG + Intergenic
1185598698 X:1324503-1324525 AAGGAGGAGGGAAAGAAGGAAGG + Intergenic
1185766915 X:2732958-2732980 AGGGAGGAAGGAAATGAGGGAGG - Intronic
1185937874 X:4279541-4279563 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1186364010 X:8872887-8872909 AAGGAAGAGGGAAAGGAGGAGGG - Intergenic
1186643943 X:11486552-11486574 AGGAAGGAGGGAAAGGAGGAAGG - Intronic
1186729265 X:12391210-12391232 ATTGAAGATTGAAATGGGGAAGG + Intronic
1186934767 X:14436333-14436355 ATTGGGGAGGGAAGGGAGGATGG - Intergenic
1187126802 X:16461935-16461957 ATGGAGGAAGGAAACTAGGAAGG + Intergenic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1188037421 X:25334198-25334220 ATTAAGGAGGGAGATTATGAGGG + Intergenic
1190738412 X:53270949-53270971 TTTTAGAAGGGAAATGAGGGAGG - Intronic
1190936207 X:55001058-55001080 CTTGGGGTGGGAAATGAGGTGGG - Intronic
1190981839 X:55463336-55463358 AGCAAGGAGAGAAATGAGGAGGG + Intergenic
1190986859 X:55509844-55509866 AGCAAGGAGAGAAATGAGGAGGG - Intergenic
1191978060 X:66895541-66895563 AGTGATGGGGGAAATGGGGAGGG + Intergenic
1192160713 X:68784671-68784693 GTTGAAGAGGTAAAAGAGGAGGG + Intergenic
1193679822 X:84504530-84504552 AGTGAGAGGGGAAAAGAGGAAGG - Intergenic
1193975273 X:88110749-88110771 GTTGGGGAGGGAAAGGGGGAGGG - Intergenic
1195227133 X:102808478-102808500 ATTTAAGAGGAAAAAGAGGATGG - Intergenic
1195290176 X:103424528-103424550 ATTGAAGAGGGAAAGAAAGACGG - Intergenic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1196283456 X:113851651-113851673 AGTGAAGAAGGAAGTGAGGATGG + Intergenic
1197211203 X:123829689-123829711 ATGGAGGAGAGAAATTGGGATGG - Intergenic
1197507523 X:127325493-127325515 ATAGAGGAAGGAAAGGAGGGAGG + Intergenic
1198218778 X:134580883-134580905 TTTGACGAGGGAAATGTGTATGG + Intronic
1198242066 X:134796719-134796741 AGAGAGGAGGGAGAAGAGGAGGG + Intronic
1198309744 X:135419206-135419228 ATTAAGGAGGGAGAGCAGGATGG + Intergenic
1198574741 X:137997904-137997926 ACTGAAGAGGTAAAAGAGGAAGG - Intergenic
1198932886 X:141879463-141879485 AGTGAGGAGGAAAAGGTGGAGGG + Intronic
1199089580 X:143675989-143676011 AAGGAGGAGGGAAAGGAGGGAGG - Intergenic
1199451394 X:147981945-147981967 TTTGTGGCGGGAAGTGAGGAAGG - Intronic
1199489713 X:148384844-148384866 ATTGATGAGAAAACTGAGGATGG - Intergenic
1199736618 X:150692357-150692379 AGTGAGGAGGGCTAGGAGGAAGG - Intergenic
1199750816 X:150815971-150815993 CTTAAGGAGGGCAGTGAGGAAGG - Intronic
1199896900 X:152135454-152135476 GAGGAGGAGGGAAAAGAGGATGG + Exonic
1199976752 X:152898722-152898744 CTTGGGGAGGGCCATGAGGATGG + Intergenic
1200809476 Y:7467942-7467964 ATTGAGGAGGTTGAGGAGGAAGG + Intergenic
1201458971 Y:14201501-14201523 ATGGAGGGAGGAAATAAGGAAGG + Intergenic
1201721396 Y:17101688-17101710 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1201741245 Y:17326292-17326314 AGGGAGGAGGGAAGTAAGGAAGG + Intergenic
1202101127 Y:21309184-21309206 AAGGAGGAAGGAAAGGAGGAAGG + Intergenic