ID: 1079059587

View in Genome Browser
Species Human (GRCh38)
Location 11:17236516-17236538
Sequence TGACATGGCAAGATTGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079059583_1079059587 -6 Left 1079059583 11:17236499-17236521 CCCAATTCTGTACTCAGTGACAT 0: 1
1: 0
2: 11
3: 61
4: 291
Right 1079059587 11:17236516-17236538 TGACATGGCAAGATTGGCAATGG 0: 1
1: 0
2: 0
3: 10
4: 152
1079059582_1079059587 26 Left 1079059582 11:17236467-17236489 CCTAGGTAATGGTATGCAGTAAC 0: 1
1: 0
2: 0
3: 10
4: 77
Right 1079059587 11:17236516-17236538 TGACATGGCAAGATTGGCAATGG 0: 1
1: 0
2: 0
3: 10
4: 152
1079059584_1079059587 -7 Left 1079059584 11:17236500-17236522 CCAATTCTGTACTCAGTGACATG 0: 1
1: 0
2: 3
3: 27
4: 225
Right 1079059587 11:17236516-17236538 TGACATGGCAAGATTGGCAATGG 0: 1
1: 0
2: 0
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079059587 Original CRISPR TGACATGGCAAGATTGGCAA TGG Intronic
900703673 1:4062962-4062984 AGCCATGGCAAGATTCACAAAGG - Intergenic
901601756 1:10428181-10428203 TGTCATGGCAACATTGCCAGCGG + Intergenic
901727945 1:11257029-11257051 TGCCATGGCAAGACGGCCAATGG + Exonic
910609920 1:89129661-89129683 TGCCATGGCAAAACTGGGAAGGG + Intronic
911443417 1:97960299-97960321 TCCAATGGAAAGATTGGCAAAGG + Intergenic
911808698 1:102245313-102245335 TGAGCTGGAAAGATTGGAAATGG + Intergenic
911936802 1:103986631-103986653 TCACATGGCAAAATGGGAAAAGG - Intergenic
913178864 1:116299814-116299836 GGCCATGGAAAGATTTGCAAGGG - Intergenic
914261396 1:146002227-146002249 TGTCATGGCAAGATGGGGAGAGG + Intergenic
916141597 1:161704756-161704778 TGACAAGCCAGGAATGGCAAAGG + Intergenic
917199855 1:172503002-172503024 TGAAATGGCAAGAAAAGCAAAGG - Intergenic
918148984 1:181782049-181782071 TGACATAGGAAGAATGGCATAGG + Intronic
920835775 1:209509484-209509506 AGACATGGCATGAAGGGCAAAGG + Intergenic
920962890 1:210680034-210680056 GGACATGACAAGATAGCCAAAGG - Exonic
1065766976 10:29039360-29039382 TGACATGAAAACATTGCCAAAGG + Intergenic
1068758456 10:60681355-60681377 TGAGATGGAAAAATTCGCAAGGG - Intronic
1071162298 10:82762749-82762771 TGACATGGAAAGCTTGGTACAGG - Intronic
1075810937 10:125224387-125224409 TGACAGAGCAAGACTGTCAAAGG - Intergenic
1078445353 11:11400665-11400687 TCACATGGCAAAAGGGGCAAAGG + Intronic
1079059587 11:17236516-17236538 TGACATGGCAAGATTGGCAATGG + Intronic
1080911893 11:36609262-36609284 TGAAATGAGAAGATTGACAAAGG + Intronic
1083793628 11:65001938-65001960 TGACCAGGTGAGATTGGCAAGGG + Intergenic
1085631651 11:78122785-78122807 TGACCTGGCAAGAGTTGAAAGGG - Intronic
1087102036 11:94374907-94374929 TGACATGGCCATATTGCCCAAGG + Intergenic
1087252479 11:95918734-95918756 AGACATGCCAAGAGTGACAAAGG + Intronic
1089698215 11:120228720-120228742 TCCCATGGCAAGCTTGGAAATGG + Intronic
1092529347 12:9331754-9331776 TGCCATGGCCAGAATGACAATGG + Intergenic
1092814518 12:12301255-12301277 TGACCTGTCCAGAGTGGCAAGGG + Intergenic
1092940937 12:13406245-13406267 TGCCATGGCAAGATAGGGAGAGG + Intergenic
1093006361 12:14055549-14055571 TGTCATGGTAATATTTGCAAAGG + Intergenic
1093149913 12:15608304-15608326 TGCCCTGACAAGATTTGCAAAGG + Intergenic
1094059272 12:26296324-26296346 TGACATGGAAAGATTTACATGGG - Intronic
1098581383 12:72103247-72103269 TAACATAGCTAGCTTGGCAAAGG - Intronic
1103615031 12:122146376-122146398 GCACATGGTAAGCTTGGCAAGGG + Exonic
1106080271 13:26494740-26494762 TGACATGGGAGGAGTGCCAAAGG + Intergenic
1106679751 13:31997799-31997821 TGACAATGCAACATTAGCAAAGG - Intergenic
1111330650 13:86759659-86759681 TGAAACGGCAAGACAGGCAAAGG + Intergenic
1111498471 13:89085743-89085765 TGAAAGGGCAAGATGAGCAAAGG - Intergenic
1114209417 14:20602489-20602511 TCACATGGGAAGGGTGGCAATGG + Intronic
1114632677 14:24169562-24169584 TGACAGGGGAAGAATGGCAAGGG - Intergenic
1115630247 14:35237628-35237650 TGAAAAGGCAAAATTGGAAAGGG - Intronic
1117587215 14:57221731-57221753 TGACAAGGGAAGAATGGGAAAGG + Intronic
1119443728 14:74647084-74647106 TGTCATTGCAAGATGTGCAATGG - Intergenic
1119948853 14:78723623-78723645 TGCCATGACAATATTGGCAGTGG + Intronic
1120022219 14:79543594-79543616 TGGCATGACAAGGTTGGCACAGG + Intronic
1124090852 15:26598749-26598771 TAACATGGCTAGATTGCCCAGGG + Intronic
1124855554 15:33384141-33384163 TGTAATGGCAAGATTCTCAAAGG - Intronic
1125178122 15:36849120-36849142 GGACAAGGCAGGATTGGCCAGGG + Intergenic
1126714976 15:51506077-51506099 TGAAATGGAAAAATTGACAAGGG + Intronic
1126986883 15:54321662-54321684 CGACATGACAACAGTGGCAAGGG + Intronic
1128775103 15:70314171-70314193 TGCCATGGCAAGATGAGGAAGGG - Intergenic
1130126820 15:81101109-81101131 GGTCCTGGCAAGGTTGGCAATGG + Intronic
1132291909 15:100709854-100709876 GGATATGGCAAGATTGACATAGG + Intergenic
1134278862 16:12800768-12800790 GGACATGGCAGGATGGGAAAGGG - Intronic
1139904212 16:70352238-70352260 TGATATGGAAAGTTTGCCAAGGG - Intronic
1144158028 17:12527034-12527056 TGAAATTGCAAGAATTGCAAGGG - Intergenic
1144797909 17:17904921-17904943 TCACCTGGCAGGACTGGCAAGGG - Intronic
1146075333 17:29723581-29723603 TAACATGGCAGGAATGGAAATGG + Intronic
1147367168 17:39966539-39966561 TGTCATGACCACATTGGCAAAGG - Intronic
1149979897 17:61302128-61302150 TGGCATGGCAAGAGTGGGACAGG - Intronic
1152995621 18:403783-403805 TGACCTGGCAAAATTGGCTATGG - Intronic
1154955077 18:21245487-21245509 TCATATGGCAAGATTGGGAAGGG - Intronic
1160920042 19:1515316-1515338 AGAGCTGGCAAGATTGGCAGAGG + Intergenic
1167501362 19:49850696-49850718 TGACGTGGCGAGGTGGGCAAGGG - Intergenic
930006134 2:46898657-46898679 TGCCATAGCATGATTGGCAATGG - Intergenic
930532532 2:52608360-52608382 TGACATGCCAACATTAGCATAGG + Intergenic
931702748 2:64922441-64922463 TCACCTTGCAAAATTGGCAACGG - Intergenic
931803418 2:65780416-65780438 GGACATGGCTTGATTGGCAGTGG - Intergenic
932737130 2:74262061-74262083 TGACATGGCCACATTGCCATAGG - Intronic
940411162 2:153364851-153364873 TGACATTTCAAGAATGTCAATGG - Intergenic
941250042 2:163149986-163150008 TGAGATGGCAAGATGGGCCAAGG + Intergenic
941549211 2:166893718-166893740 AAGCATGGCAAGACTGGCAATGG - Intronic
943062884 2:183057041-183057063 TGTCATGGAAAGATTGCCATAGG - Intergenic
943391828 2:187279167-187279189 TGCCAGTGCAAGAGTGGCAATGG + Intergenic
943800942 2:192056828-192056850 TCACATGGCAAAAAGGGCAAGGG - Intronic
946290982 2:218745423-218745445 TGACATGGCAAGGCTGAAAAGGG - Intronic
1170045964 20:12085426-12085448 AGACATGGCAAGATGTGAAAGGG + Intergenic
1170864639 20:20142572-20142594 GGAGATGGGAAGATGGGCAACGG - Intronic
1173010902 20:39181187-39181209 AGAGATGGCAAGAGGGGCAAGGG - Intergenic
1173745353 20:45432547-45432569 TGCAATGGCGAGATTGGCACAGG - Intergenic
1174224645 20:48987097-48987119 GGAGGTGGCAGGATTGGCAAAGG + Intronic
1177211554 21:18077648-18077670 TCACATTGCAAAATGGGCAAAGG - Intronic
1177730380 21:25021382-25021404 TGAAATGACAAGATTAGCAGTGG - Intergenic
1182478548 22:30591031-30591053 TGACATGAAAAGACTGGGAAGGG - Intronic
949094210 3:66524-66546 TGAGATGGCAATATTGAAAACGG + Intergenic
951459063 3:22929435-22929457 TGACAGGACAAGATTGCAAAGGG + Intergenic
957816241 3:85301221-85301243 TCAATTGGCAAGAATGGCAAGGG - Intronic
958920896 3:100104172-100104194 TAACTTGGCATGACTGGCAATGG - Intronic
959182723 3:103002703-103002725 TGAGATGAAAAGATTGTCAACGG + Intergenic
959682075 3:109107198-109107220 TGACATGGAAGGATTAGGAAAGG - Intronic
960345480 3:116525830-116525852 TGCTATGGCAAGAATGGAAAAGG + Intronic
962035519 3:131647472-131647494 GGACATGGCAAGATTAGAGACGG - Intronic
964937584 3:162110659-162110681 TCAGATGGGAAAATTGGCAAGGG + Intergenic
966396982 3:179514257-179514279 GGACATGGAAAGATGGGGAAAGG + Intergenic
967894283 3:194384074-194384096 AAACATGGCAGGATTGGCAGAGG + Intergenic
971376388 4:26059008-26059030 CTATGTGGCAAGATTGGCAAGGG - Intergenic
971628719 4:28960483-28960505 TGACATGGCACCATTTGTAATGG - Intergenic
973256955 4:48123403-48123425 AGACATGGGGAGATTGGAAAGGG - Intronic
976181468 4:82403584-82403606 TGAGTTGGCAAAATTGTCAAGGG - Intergenic
977634742 4:99284383-99284405 TGCCAAGGTAAGAATGGCAATGG - Exonic
979409843 4:120363468-120363490 TGAACTGGCTACATTGGCAATGG + Intergenic
979689732 4:123547549-123547571 TGAAAAGGCACGATTGGCCATGG + Intergenic
981105325 4:140874378-140874400 TGACATGGGAACATTGATAATGG - Intronic
982197472 4:152930895-152930917 GGACATAGAAAGATGGGCAAAGG - Intergenic
983128964 4:163990595-163990617 AGACATGGCATTTTTGGCAAAGG - Intronic
984546779 4:181114168-181114190 TCACATAGAAAAATTGGCAAAGG - Intergenic
987555911 5:19448229-19448251 AGACATGGCAAGGTCAGCAATGG - Intergenic
987777447 5:22386229-22386251 TCACATGGCAAGAACAGCAAGGG + Intronic
992659668 5:78945859-78945881 TGAGATGGAAAGGTTGGGAATGG - Intronic
1000725729 5:164768379-164768401 GGAAATGGAAAGATTGGTAATGG + Intergenic
1001432126 5:171670668-171670690 TGACGTGCCGAGATTGGCCAAGG - Intergenic
1001453065 5:171840914-171840936 TCACGTGCCAAGAGTGGCAAGGG - Intergenic
1004976930 6:20978393-20978415 TGAAATGGCAAGACTGTGAAAGG - Intronic
1007065033 6:38981573-38981595 TGAAATGGCAAGATTGCAAAGGG + Intronic
1007597883 6:43062820-43062842 GGACGTGGCAAGACTGGCAGGGG - Intronic
1008546643 6:52589256-52589278 TGACTTTGCCAGATTAGCAAAGG + Intergenic
1010496975 6:76545797-76545819 TCACATGGCAAAAGGGGCAAAGG - Intergenic
1014107199 6:117580121-117580143 AGACATGGGAAGACTAGCAAAGG + Intronic
1016005048 6:139080496-139080518 TGAAATGGCAAAATAGGGAAGGG + Intergenic
1022185031 7:27958961-27958983 AGTAATGGCAAGATTAGCAATGG + Intronic
1022290875 7:29001210-29001232 TGACATGGGCAGATTTGCAAAGG + Intronic
1022739253 7:33105851-33105873 TGACATGGGAACGTTGACAAAGG - Intronic
1028356513 7:89916866-89916888 TGACTAGTCAAGTTTGGCAATGG - Intergenic
1030238124 7:107289869-107289891 TGGCATAGCAAGTTTGGCACAGG - Intronic
1031356362 7:120791911-120791933 TGACATAGCAAAACTGGCATGGG + Intronic
1031875253 7:127132383-127132405 TGACTTGGAAAGCTTGGAAAAGG - Intronic
1032339012 7:131053838-131053860 TGACATGGTGAGATTTGCATTGG - Intergenic
1035416118 7:158688564-158688586 TGACACAGCAAGGATGGCAAAGG + Intronic
1037065285 8:14569030-14569052 TGACATAACAAGACTGGTAAAGG + Intronic
1043333854 8:79149740-79149762 TGACATGGCAAGAGAGGGGAGGG - Intergenic
1044413571 8:91911129-91911151 TGACACGGCAAGAATAGAAAGGG - Intergenic
1048262742 8:132959251-132959273 TGACATGGCAAAAATGTTAAAGG - Intronic
1048552048 8:135442554-135442576 TGACATTGCATGAGAGGCAAGGG - Intergenic
1050228006 9:3483721-3483743 TGCCACGGCAAGATTGGCACTGG - Intronic
1051791334 9:20806084-20806106 TGACATGGCAAGAGTGGTCCAGG - Intronic
1052224009 9:26062076-26062098 TTACAAGGCAAAATTGGGAAGGG + Intergenic
1052708847 9:32027299-32027321 TGATTTGGTAAAATTGGCAAAGG + Intergenic
1053528731 9:38856272-38856294 TGAAATGGGAAGATTGGTCAGGG - Intergenic
1053558639 9:39165114-39165136 TCACATGGCAGGAAAGGCAAGGG + Intronic
1053822765 9:41985346-41985368 TCACATGGCAGGAAAGGCAAGGG + Intronic
1054138472 9:61453827-61453849 TCACATGGCAGGAAAGGCAAGGG - Intergenic
1054200958 9:62080705-62080727 TGAAATGGGAAGATTGGTCAGGG - Intergenic
1054607810 9:67202019-67202041 TCACATGGCAGGAAAGGCAAGGG - Intergenic
1054637401 9:67507658-67507680 TGAAATGGGAAGATTGGTCAGGG + Intergenic
1055140562 9:72872443-72872465 GGAGATGGCCAGATTGACAATGG + Intergenic
1057933652 9:99218402-99218424 TGACATCCCAAGATTGGGAGAGG - Exonic
1058106431 9:100976761-100976783 TGACATGGAAACTGTGGCAAGGG - Intergenic
1060727594 9:126016565-126016587 TGACATGACAAGCCTGGCCAGGG + Intergenic
1062003209 9:134227008-134227030 TGACATGGCAAGTGGGGCAGTGG + Intergenic
1187847562 X:23556610-23556632 GGGCAAGGGAAGATTGGCAAGGG + Intergenic
1188982559 X:36740053-36740075 GGACATGGCAAGAGTTGCATGGG - Intergenic
1190023887 X:46904223-46904245 TGACATGGCAACAGTGGGGAGGG - Intergenic
1190326597 X:49210523-49210545 TCACATGGCAAGGGTGGGAAGGG - Intronic
1190503553 X:51102827-51102849 ATATATGGGAAGATTGGCAAAGG - Intergenic
1192148410 X:68697017-68697039 GGACAGGGCAGGATTGGCCATGG - Intronic
1192204501 X:69087147-69087169 TGACATGGCAAGGATAGGAATGG + Intergenic
1192601536 X:72469553-72469575 TGACAAGGCAAAAATGGCAAAGG - Intronic
1192899707 X:75483362-75483384 TGACATGGGAGGATTGGCCTAGG + Intronic
1195511756 X:105723744-105723766 TCACATGGCAACAAGGGCAAGGG + Intronic
1195902472 X:109813378-109813400 TGACCTGGCAAGTTTAGAAATGG - Intergenic
1197714401 X:129696008-129696030 GGACATGGAAAGATTGGGACAGG - Intergenic
1198115114 X:133537247-133537269 TGAAATAGCAACATTGGCAACGG - Intronic
1200536808 Y:4407927-4407949 TGAAATGGAAAGATAGGAAAAGG - Intergenic