ID: 1079061045

View in Genome Browser
Species Human (GRCh38)
Location 11:17249125-17249147
Sequence GAATTAGGAGGTCTGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 292}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079061045_1079061054 13 Left 1079061045 11:17249125-17249147 CCCTCCAACAGACCTCCTAATTC 0: 1
1: 0
2: 0
3: 31
4: 292
Right 1079061054 11:17249161-17249183 TCTCCTTGTGAAAAATCCTGGGG 0: 1
1: 0
2: 1
3: 17
4: 203
1079061045_1079061056 26 Left 1079061045 11:17249125-17249147 CCCTCCAACAGACCTCCTAATTC 0: 1
1: 0
2: 0
3: 31
4: 292
Right 1079061056 11:17249174-17249196 AATCCTGGGGACCTCTACCCCGG 0: 1
1: 0
2: 2
3: 8
4: 90
1079061045_1079061052 11 Left 1079061045 11:17249125-17249147 CCCTCCAACAGACCTCCTAATTC 0: 1
1: 0
2: 0
3: 31
4: 292
Right 1079061052 11:17249159-17249181 GATCTCCTTGTGAAAAATCCTGG 0: 1
1: 0
2: 3
3: 23
4: 182
1079061045_1079061053 12 Left 1079061045 11:17249125-17249147 CCCTCCAACAGACCTCCTAATTC 0: 1
1: 0
2: 0
3: 31
4: 292
Right 1079061053 11:17249160-17249182 ATCTCCTTGTGAAAAATCCTGGG 0: 1
1: 3
2: 13
3: 24
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079061045 Original CRISPR GAATTAGGAGGTCTGTTGGA GGG (reversed) Intronic
900131173 1:1088021-1088043 GAATGAACAGGCCTGTTGGAGGG + Intronic
902624481 1:17668603-17668625 GCATCAGGAGGGCTGTTGGCTGG + Intronic
903887481 1:26548937-26548959 GACATAGAAGGTGTGTTGGAAGG + Intronic
904594011 1:31631816-31631838 GACTAAGGAGGTCTGTGGGCAGG - Intronic
904844267 1:33396989-33397011 GAATCAGATGGTCTGTGGGAAGG + Intronic
910215833 1:84843364-84843386 GAAAAAAGAGGTTTGTTGGAAGG - Intronic
910324452 1:85989409-85989431 GAATTAGGAGATGTAATGGATGG - Intronic
911264958 1:95732452-95732474 AAATTAGGAGCTCTGATCGAAGG - Intergenic
911812196 1:102296648-102296670 GAATTTGGGGGACTGTTGGAAGG + Intergenic
912153033 1:106882577-106882599 GACTTTGGGGGACTGTTGGAAGG - Intergenic
912938053 1:114020939-114020961 GACTTTGGGGGACTGTTGGAAGG + Intergenic
913230517 1:116737069-116737091 GAATTTGGGGATGTGTTGGAGGG + Intergenic
913384004 1:118239832-118239854 GATTTTGGGGGACTGTTGGAAGG + Intergenic
914254203 1:145947665-145947687 ACATAAGGAGGGCTGTTGGAGGG + Exonic
914987981 1:152476049-152476071 GACTTTGGGGGACTGTTGGAAGG - Intergenic
915309699 1:155000975-155000997 GAATTAGGGGGGCTATAGGAAGG - Intergenic
915818206 1:158992692-158992714 GAATTTGGGGGACTGTTGGAAGG + Intergenic
915828424 1:159102921-159102943 GACTTTGGGGGACTGTTGGAAGG + Intronic
915925680 1:160017430-160017452 GAATTATGAAGACTGATGGAAGG - Intergenic
916210283 1:162354712-162354734 GAATTAGAAGCTCAGTTAGATGG - Intronic
916296654 1:163227632-163227654 GACTTTGGGGGACTGTTGGAAGG - Intronic
917033651 1:170722305-170722327 GACTGAGGAGGCCTCTTGGATGG + Intronic
917140024 1:171826578-171826600 GACTTTGGGGGACTGTTGGAAGG - Intergenic
917461479 1:175234326-175234348 GAATTTGAAGGTCTGTTTGCAGG + Intergenic
917533060 1:175854368-175854390 TTTTTAGGAGGTCTGTTGGGGGG + Intergenic
918530251 1:185512335-185512357 GACTTTGGGGGACTGTTGGAAGG + Intergenic
920557958 1:206917964-206917986 GAATAAAGAGGTGTGTTGGCAGG - Intronic
922118145 1:222634354-222634376 GAGGGAGAAGGTCTGTTGGAGGG + Intronic
923757931 1:236810503-236810525 GAATTAAGAGGTTTGTGGCAGGG + Exonic
1064766172 10:18674540-18674562 TTATTAGGAGGTCTTTTGGGAGG + Intronic
1066154119 10:32656767-32656789 GACTTTGGGGGACTGTTGGAAGG - Intronic
1068147837 10:53093652-53093674 GACTTTGGGGGACTGTTGGAAGG + Intergenic
1068221644 10:54052669-54052691 GACTTTGGGGGACTGTTGGAAGG + Intronic
1069094933 10:64248613-64248635 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1070290877 10:75112269-75112291 GAAGGAGGAGGGCTGTTGGATGG + Intronic
1072850115 10:98881192-98881214 GAATTAGCAGGGCTTTTGGGAGG + Intronic
1074890663 10:117734532-117734554 GAATTAGCAGCTTTGTTTGACGG - Intergenic
1077897142 11:6461691-6461713 GAATTAGAAGGTGTTTTGCATGG - Intronic
1078686717 11:13538814-13538836 GACTTTGGAGGACTGTTGGAAGG + Intergenic
1078834965 11:15018184-15018206 GATTTTGGGGGACTGTTGGAAGG + Intronic
1079061045 11:17249125-17249147 GAATTAGGAGGTCTGTTGGAGGG - Intronic
1079718983 11:23787053-23787075 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1079804419 11:24911275-24911297 GACTTTGGGGGACTGTTGGAAGG + Intronic
1080045058 11:27799630-27799652 GACTTCGGAGGACTGTTGGAAGG + Intergenic
1081236649 11:40654684-40654706 GACTTTGGGGGACTGTTGGAAGG + Intronic
1082118912 11:48357235-48357257 GATTTGGGGGGACTGTTGGAAGG - Intergenic
1082255388 11:50027914-50027936 GATTTGGGGGGACTGTTGGAAGG + Intergenic
1087446975 11:98268195-98268217 GAATTTGGGGCACTGTTGGAAGG - Intergenic
1087474706 11:98621066-98621088 GACTTTGGGGGACTGTTGGATGG + Intergenic
1087499495 11:98932420-98932442 GAATTCCAAGGGCTGTTGGATGG + Intergenic
1090045689 11:123330847-123330869 AAGTTAAGAGGTCTGTGGGAGGG - Intergenic
1092068886 12:5616417-5616439 GTATTAGGAGGTGTGGTGTATGG - Intronic
1092153657 12:6268368-6268390 GAATTAAGAGGCCTGCTGCATGG - Intergenic
1092960347 12:13591156-13591178 GGAGTAGGAGGGCTGGTGGAGGG - Intronic
1093037945 12:14351145-14351167 GTATTTGGGGGACTGTTGGAAGG - Intergenic
1093629266 12:21388220-21388242 GACTTTGGGGGACTGTTGGAAGG + Intronic
1094237407 12:28184461-28184483 GAATAATGAGGACTGTTGGCTGG + Intronic
1097368210 12:58743024-58743046 GACTTTGGAGGACTGTTGGAAGG + Intronic
1097486816 12:60213353-60213375 GATTTTGGGGGACTGTTGGAAGG + Intergenic
1098203599 12:68083221-68083243 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1098713768 12:73802055-73802077 GACTTTGGAGGACTGTTGGAAGG + Intergenic
1098761959 12:74435571-74435593 GACTTTGGGGGACTGTTGGAAGG + Intergenic
1099424931 12:82511666-82511688 AAATTAGTAGGTCTGTTGTCAGG - Intergenic
1099492901 12:83307921-83307943 GAATTTGGGGGACTGTTGGAAGG + Intergenic
1099621384 12:85006157-85006179 GAATTTGGGGGACTGTTGAAGGG + Intergenic
1099859040 12:88205717-88205739 GACTTTGGAGGACTGTTGGGAGG + Intergenic
1099932745 12:89092282-89092304 GATTTTGGGGGACTGTTGGAAGG + Intergenic
1100292159 12:93226583-93226605 GAAATAGGATGTCTGCTGGATGG - Intergenic
1101192939 12:102353887-102353909 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1101194539 12:102369254-102369276 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1101558615 12:105834342-105834364 GAAGTAGGAGATGTGTTGGTGGG + Intergenic
1101692870 12:107097518-107097540 GACTTTGGGGGACTGTTGGAAGG + Intergenic
1104034156 12:125087026-125087048 GCATTAGGAGCTCTGTGGGGTGG + Intronic
1104741952 12:131184218-131184240 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1105573021 13:21622157-21622179 GGATTAGGAGATCAGTTAGAAGG + Intergenic
1105753981 13:23448165-23448187 GTATGAGGAGCTTTGTTGGAAGG + Intergenic
1106564149 13:30870860-30870882 GAGTCAGGAGTTCTGTTGGTTGG + Intergenic
1106864539 13:33948985-33949007 GACTTTGGGGGACTGTTGGAAGG + Intronic
1106996826 13:35494189-35494211 GAATTTGGAGGTTTGATTGAAGG + Intronic
1108072094 13:46638657-46638679 AAATTAGCAAGTCTGTTAGAGGG + Intronic
1110844244 13:80175733-80175755 GAATTAGGAGGTGGGGTGGTTGG - Intergenic
1111239771 13:85458372-85458394 GAATTTGAGGGACTGTTGGAAGG + Intergenic
1112079515 13:95953826-95953848 GAATAAAGAGGTCAGTTTGAAGG + Intronic
1112824959 13:103381723-103381745 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1115175870 14:30560790-30560812 GAATCAGTAGGTCTGGAGGATGG + Intronic
1115340846 14:32291687-32291709 GACTTTGGGGGACTGTTGGAAGG + Intergenic
1115975376 14:38991143-38991165 GATTTGGGAAGTCTGCTGGAGGG - Intergenic
1117255396 14:53971961-53971983 AAATTAAGAGGTCTGCTGCAGGG - Intergenic
1119517625 14:75260710-75260732 GAATTAGAAGGGATGTTTGATGG - Intronic
1119934106 14:78574778-78574800 GACTTTGGAGGACTGTGGGAAGG + Intronic
1119963205 14:78882755-78882777 GAATTTGGGGGACTGTTGAAAGG + Intronic
1124507903 15:30294663-30294685 GAAAGAGCAGGTTTGTTGGAGGG + Intergenic
1124735652 15:32243994-32244016 GAAAGAGCAGGTTTGTTGGAGGG - Intergenic
1125231422 15:37461695-37461717 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1125394381 15:39231113-39231135 GCATTTGGAGGTCTGTTGGCAGG - Intergenic
1128633474 15:69287870-69287892 GAATCAGGAGCTCTGTGGGTGGG + Intergenic
1129166561 15:73781593-73781615 GGATGGGGAGGTGTGTTGGAAGG - Intergenic
1130409224 15:83630868-83630890 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1130791566 15:87160983-87161005 GACTTTGGGGGACTGTTGGAAGG + Intergenic
1133404363 16:5511019-5511041 AAATGAGGAGGTCCTTTGGAAGG + Intergenic
1133479920 16:6160220-6160242 GAAGTAGGAGGTCTGATTTATGG + Intronic
1134544754 16:15099269-15099291 GAATTAGCAGGTGTGGTGGCAGG + Intronic
1137397109 16:48123980-48124002 CAATGAGGAGGTCTATTGAATGG - Intronic
1137952035 16:52792595-52792617 GACTTTGGAGGACTGTTGAAAGG + Intergenic
1138362923 16:56447860-56447882 GAATGAGGAGGACTGTAGAAGGG - Exonic
1138553500 16:57759511-57759533 GAAATGGAAGGTCTGTGGGAAGG - Intronic
1140412664 16:74750569-74750591 GAAGTAGGAGGTATGAGGGAGGG - Intronic
1141123336 16:81380951-81380973 GCATTTGGGGGTATGTTGGATGG + Exonic
1142908762 17:3069093-3069115 GAATAAGGAGGTCTGAGGAAAGG + Intergenic
1142925805 17:3235152-3235174 GAATAAGGAGGTCTGAGGAAAGG - Intergenic
1143597890 17:7926239-7926261 AAAATAAGAGGTCTGTTGGAAGG + Intronic
1143935616 17:10481376-10481398 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1144285372 17:13769407-13769429 GAGTTAAGACTTCTGTTGGAAGG - Intergenic
1147939633 17:44037154-44037176 GAATTAGGAAGACTGTTCCATGG - Intronic
1147962214 17:44174722-44174744 GAAAGATGAAGTCTGTTGGAAGG - Intronic
1150519260 17:65849210-65849232 TAATTAGTAGATATGTTGGATGG - Intronic
1150998740 17:70349637-70349659 GATTTAGTAGGTCTGTGGTAAGG + Intergenic
1151148111 17:72060233-72060255 GAATTAAGATGTATATTGGAAGG - Intergenic
1151311982 17:73298757-73298779 GAATGAGGAGGTGTACTGGAGGG - Intronic
1155544658 18:26903023-26903045 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1155716588 18:28951945-28951967 GAATTTGGGGGACTGTAGGAAGG - Intergenic
1158124172 18:54083425-54083447 GACTTTGGGGGTCTGTTGGAAGG + Intergenic
1158422860 18:57311718-57311740 GACTTAGGAGGACTGTAGGCAGG + Intergenic
1160119564 18:76117565-76117587 GAAATGGGAGCGCTGTTGGAGGG + Intergenic
1160627084 18:80218172-80218194 GACTTTGGGGGACTGTTGGAAGG - Intronic
1164637442 19:29801823-29801845 GTGTTAGGAGGCCTGTGGGAGGG - Intergenic
925061877 2:897726-897748 GAATTAGGAGGACTGTTGTGAGG + Intergenic
925180517 2:1814246-1814268 GAGTTGGGAGGTCAGTTGGATGG - Intronic
925237893 2:2295053-2295075 GAATTAGGAGAGATGCTGGATGG + Intronic
925368593 2:3327719-3327741 AAAGTAGCAGGTATGTTGGATGG - Intronic
925472594 2:4178921-4178943 GAATGAGGAGTTCTGTTTAATGG + Intergenic
926456368 2:13072977-13072999 GAGTTAAGAATTCTGTTGGAAGG - Intergenic
927400652 2:22706698-22706720 GACTTTGGGGGACTGTTGGAAGG - Intergenic
927578326 2:24219210-24219232 GAATTCAGAGTCCTGTTGGATGG - Intronic
928296084 2:30085233-30085255 GAATTATGAGGTTTTCTGGAGGG - Intergenic
929382407 2:41368377-41368399 GACTTTGGGGGACTGTTGGAAGG - Intergenic
930713133 2:54568012-54568034 GACTTAGGAGGTCTGTGGGGAGG - Intronic
932976147 2:76602243-76602265 GCATTCGGAGGTCTGGAGGAGGG + Intergenic
933006800 2:77005109-77005131 GACTTTGGGGGACTGTTGGAAGG + Intronic
936753814 2:115679135-115679157 GACTTTGGAGGATTGTTGGAAGG + Intronic
937142333 2:119612816-119612838 GGCTTTGGAGGACTGTTGGAAGG - Intronic
937806396 2:126150588-126150610 GACTTTGGGGGACTGTTGGAAGG - Intergenic
942380622 2:175386693-175386715 GACTTTGGGGGACTGTTGGAAGG + Intergenic
946499403 2:220230222-220230244 GATTTAGGAGCTCTGATTGAGGG - Intergenic
947871006 2:233438010-233438032 GAATGTGGAGGTCAGATGGATGG + Intronic
948016649 2:234696672-234696694 GACTTTGGAGGACTATTGGAAGG - Intergenic
1169709965 20:8550200-8550222 GACTTTGGGGGACTGTTGGAAGG + Intronic
1172397313 20:34617684-34617706 GACTTTGGGGGACTGTTGGAAGG + Intronic
1172402595 20:34662541-34662563 AAATTAGGTGGTCTGGTGGCAGG - Intronic
1173758872 20:45542441-45542463 GAATTAGGAGGGGTGGAGGAAGG - Intronic
1176877657 21:14149487-14149509 GACTTTGGGGGACTGTTGGAAGG - Intronic
1176883863 21:14230432-14230454 GACTTTGGGGGACTGTTGGAAGG + Intergenic
1178021387 21:28412353-28412375 GAATCAGGATGTCTGTTTAACGG - Intergenic
1178410635 21:32360912-32360934 GAATCAGGAAGGCTGGTGGACGG - Intronic
1180956692 22:19744442-19744464 GAATGGGGAGGGCTGGTGGAGGG - Intergenic
1182270104 22:29148029-29148051 GAATGAGGAGGTGTCTGGGATGG + Intronic
951969770 3:28430528-28430550 GACTTTGGAGGACTGTTGGAAGG + Intronic
952130782 3:30359847-30359869 AAATCAGGAGGTCTGTTGAAGGG - Intergenic
953681083 3:45038697-45038719 GAATGTGTAGGTCTGTTGCATGG + Intergenic
954520569 3:51221948-51221970 GAATATGGAGGTCTGCTGGGAGG - Intronic
955562538 3:60207395-60207417 GCCTTTCGAGGTCTGTTGGAAGG - Intronic
955814258 3:62825419-62825441 GAGTTAGTAGGTCTGATGTAAGG - Intronic
956192007 3:66616880-66616902 AAATTAAGAGTTCTGTTGAAGGG - Intergenic
956324856 3:68040697-68040719 GAATTAGTAGGTCTGGCAGAAGG - Intronic
958151638 3:89700392-89700414 GAGTTTGGGGGACTGTTGGAAGG - Intergenic
958463356 3:94426989-94427011 GACTTTGGGGGACTGTTGGAAGG + Intergenic
958836336 3:99148955-99148977 GACTTTGGGGGACTGTTGGAAGG + Intergenic
959742461 3:109736811-109736833 GACTTTGGGGGACTGTTGGAAGG - Intergenic
960176757 3:114526432-114526454 GTATTTTGAGGTCTTTTGGACGG + Intronic
960478217 3:118157675-118157697 GACTTTGGGGGACTGTTGGAAGG - Intergenic
961503714 3:127356181-127356203 GACTTTGGGGGACTGTTGGAAGG - Intergenic
963156448 3:142102626-142102648 GAATTAGTAGGTATTTTGTAGGG - Intronic
963226010 3:142862211-142862233 GAAGTTGGAGTTCTGTTTGAAGG - Intronic
963297187 3:143558794-143558816 GACTTTGGGGGACTGTTGGAAGG + Intronic
963517166 3:146323226-146323248 GACTTTGGGGGACTGTTGGAAGG + Intergenic
965002543 3:162973613-162973635 AATTCAGGAGCTCTGTTGGAGGG + Intergenic
965065313 3:163840624-163840646 GATTTTGGGGGACTGTTGGAAGG - Intergenic
966320248 3:178694415-178694437 GACTTTGGAGGACTGTTGGAAGG - Intronic
967406304 3:189119421-189119443 GACTTTGGGGGACTGTTGGAGGG + Intronic
968239406 3:197063031-197063053 TAATTAGTAGGTTTGTTGGGTGG - Intronic
969121817 4:4916490-4916512 GACTTTGGGGGACTGTTGGAAGG - Intergenic
969968360 4:11020606-11020628 GAATTACTAGGTCTGGAGGAAGG + Intergenic
970351649 4:15207436-15207458 GATTTTGGGGGACTGTTGGAAGG + Intergenic
970535484 4:17026255-17026277 GAATTAGGAGTTCTGGTGAGAGG - Intergenic
970678158 4:18476695-18476717 GACTTTGGGGGACTGTTGGAAGG - Intergenic
971440521 4:26679814-26679836 AACTTTGGAGGACTGTTGGAAGG + Intronic
971845875 4:31917039-31917061 GAATTTGGGGGACAGTTGGAAGG + Intergenic
972017279 4:34262861-34262883 GACTTTGGGGGACTGTTGGAAGG - Intergenic
972663366 4:41140470-41140492 GAATTAGGAATTCTGTTGGGTGG - Intronic
973865804 4:55111581-55111603 AAATAAGGAGGTCAGTTGGGAGG - Intronic
974843497 4:67323980-67324002 GACTTTGGGGGACTGTTGGAAGG + Intergenic
975061556 4:70009036-70009058 GAATTTCGAGGCCTGTAGGAAGG + Intergenic
976002833 4:80392292-80392314 GACTTTGGGGGACTGTTGGAAGG + Intronic
976726845 4:88223217-88223239 GACTTTGGGGGACTGTTGGAAGG + Intronic
977702406 4:100035516-100035538 GACTTTGGGGGACTGTTGGAAGG - Intergenic
978991351 4:115085379-115085401 GACTTTGGAGGACTGTTGGAAGG + Intronic
979137603 4:117128681-117128703 GACTTTGGAAGACTGTTGGAAGG + Intergenic
979734474 4:124065415-124065437 GAGATAGGAAGTCTGGTGGAAGG + Intergenic
979948086 4:126859737-126859759 GACTTTGGGGGACTGTTGGAAGG - Intergenic
980233092 4:130069226-130069248 GAATTAGAAGATATGTTGGGGGG + Intergenic
982609189 4:157551902-157551924 GACTTTGGGGGACTGTTGGAAGG + Intergenic
982678482 4:158402768-158402790 GACTTTGGGGGACTGTTGGAAGG - Intronic
982781096 4:159492279-159492301 GAACTAGGATATCTGATGGAAGG + Intergenic
983394004 4:167169660-167169682 GAATTTAGGGGACTGTTGGAAGG + Intronic
985474229 5:69222-69244 GACTTTGGAGGACTGTTGGAAGG + Intergenic
986363013 5:7000160-7000182 GAATTAGGAGCTCTTTCAGACGG + Intergenic
986818409 5:11437927-11437949 GAAGTACGAGGTCTGGCGGAGGG + Intronic
986946803 5:13030825-13030847 AAATTATGAGGTATGTTAGATGG - Intergenic
987261963 5:16213311-16213333 GACTTTGGGGGGCTGTTGGAAGG - Intergenic
987680878 5:21134180-21134202 GACTTTGGGGGACTGTTGGAAGG + Intergenic
988379316 5:30480431-30480453 GACTTTGGGGGACTGTTGGAAGG - Intergenic
988858452 5:35252287-35252309 GACTTTGGAGGACTGTTGGAAGG - Intergenic
989541030 5:42619082-42619104 GAATTGGGAGGTCTTGGGGATGG - Intronic
989726754 5:44596718-44596740 GACTTTGGGGGACTGTTGGAAGG - Intergenic
989821218 5:45797344-45797366 GTATTAGAAGGGCTGTTGGAGGG - Intergenic
991256705 5:64622175-64622197 CAATTAGGAGGGCTGTGGAAGGG - Intergenic
992375560 5:76184865-76184887 GACTTTGGGGGACTGTTGGAAGG - Intronic
993002060 5:82391099-82391121 GAATTAAGATTTCTGTAGGAGGG + Intergenic
993208740 5:84921001-84921023 GAATTAGGGCATCTGGTGGAAGG + Intergenic
993590520 5:89790028-89790050 GACTTTGGGGGTCTGTTGGAAGG - Intergenic
993771525 5:91933684-91933706 GAAATGGCAGGTCTGTTGGATGG + Intergenic
995429203 5:112055456-112055478 GACTTTGGGGGACTGTTGGAAGG + Intergenic
995608199 5:113880728-113880750 GACTTTGGGGGACTGTTGGAAGG + Intergenic
996951609 5:129133378-129133400 GATTTAGGAGGTCTGTGGCTGGG + Intergenic
997547670 5:134722794-134722816 GATTTAGGAGGTCTGGGGCAGGG - Intronic
997789445 5:136743803-136743825 GACTTTGGAGGGCTGTTGGGAGG + Intergenic
997819713 5:137053991-137054013 GAATTCCAAGGTCTTTTGGAAGG + Intronic
998902461 5:146870684-146870706 GAAGGATGGGGTCTGTTGGACGG - Intronic
1000427951 5:161115200-161115222 GACTTAGGAGATCTGAGGGAGGG + Intergenic
1000581136 5:163036271-163036293 GACTTTGGAGGACTGTTAGAAGG + Intergenic
1001099743 5:168804383-168804405 GAAATAGGAGGAATGATGGAAGG + Intronic
1001855128 5:175004182-175004204 GACTTAGGGGGACTGTTGGAAGG + Intergenic
1002313099 5:178326621-178326643 GAAAAAGGAGGTCTGAGGGAGGG - Intronic
1003467033 6:6390783-6390805 GGATTTGGAGGGCTGTTGGGTGG - Intergenic
1006177618 6:32131963-32131985 GATTTAGGAAGTCTGTTGTGGGG + Intergenic
1006951968 6:37830193-37830215 TAATTTGGAGGTGAGTTGGAAGG + Intronic
1008337391 6:50324034-50324056 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1009804838 6:68590068-68590090 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1010055229 6:71556969-71556991 GAATTTGGGGGACTGTTGAAAGG + Intergenic
1010514965 6:76761753-76761775 GACTTTGGAGGACTGTTGGAAGG - Intergenic
1010869643 6:81021600-81021622 TAATTAGGAGGTCTGGGAGATGG + Intergenic
1011358921 6:86501272-86501294 GAATTCCGAGGGCTGTTTGATGG + Intergenic
1011784313 6:90826918-90826940 GACTTTGGAGGACTGTTGGAAGG + Intergenic
1012771041 6:103435986-103436008 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1013213571 6:108007715-108007737 GAATTTGGGGAACTGTTGGAAGG - Intergenic
1013928705 6:115503461-115503483 GATTTTGGTGGACTGTTGGAAGG + Intergenic
1014470096 6:121802509-121802531 GATTTTGGGGGACTGTTGGAAGG + Intergenic
1014495108 6:122111715-122111737 GTATTAGGAGTTCTCTGGGAAGG + Intergenic
1014576733 6:123082693-123082715 GATTTAGGGGATCTGGTGGAAGG - Intergenic
1015963841 6:138677827-138677849 GATTTAGTAGGTCTGTGGTAGGG + Intronic
1016296082 6:142574795-142574817 GACTTTGGGGGACTGTTGGAAGG + Intergenic
1020345174 7:7154585-7154607 GACTTTGGGGGACTGTTGGAAGG + Intergenic
1020542149 7:9471177-9471199 CAATTTGGGGGTCTGTAGGATGG - Intergenic
1021653467 7:22853600-22853622 AAATAAGCAGGTCTGTTGGCTGG - Intergenic
1022690094 7:32641165-32641187 GAATTTGGAGGCCTGATGGGAGG - Intergenic
1023278417 7:38545266-38545288 GTATTAGCAGATCTGATGGAGGG - Intronic
1023624890 7:42106171-42106193 GCATGAGGATGCCTGTTGGACGG - Intronic
1024721088 7:52138420-52138442 GACTTTGGGGGGCTGTTGGAAGG - Intergenic
1024912263 7:54458835-54458857 GACTTTGGGGGACTGTTGGAAGG + Intergenic
1026278782 7:68903416-68903438 GACTTTGGGGGACTGTTGGAAGG + Intergenic
1027369684 7:77494846-77494868 GACTTTGGAGGACTGTTGGGAGG + Intergenic
1027506464 7:79021749-79021771 GATTTTGGGGGACTGTTGGAAGG + Intronic
1027917646 7:84346555-84346577 GAATAAGGAGGTCTGAGGAAAGG + Intronic
1030986092 7:116244188-116244210 GACTTTGGGGGACTGTTGGAAGG - Intronic
1031056621 7:116998562-116998584 GAATGAGGAGTTCTGTTGTAAGG + Intronic
1031238772 7:119211570-119211592 GACTTTGGGGGACTGTTGGAAGG + Intergenic
1031433788 7:121707825-121707847 TAAATAGAAGGTCTGTTAGAAGG - Intergenic
1034920893 7:155080771-155080793 GAATGAGGCTTTCTGTTGGATGG + Intronic
1035671951 8:1424880-1424902 GAATGAGGAGGGCTGTTTAATGG + Intergenic
1036722633 8:11191150-11191172 GAGTTATCAGGTCTGTTGAATGG - Intronic
1037206115 8:16321511-16321533 GACTTTGGGGGACTGTTGGAAGG + Intronic
1037264045 8:17038123-17038145 GACTTTGGGGGACTGTTGGAAGG + Intronic
1037839254 8:22232310-22232332 CAAGTAGGGGGTGTGTTGGAGGG - Exonic
1037948126 8:23002086-23002108 GAATGAGGAGGCCTAATGGAGGG - Intronic
1041493209 8:58457840-58457862 GAATTAGGGGATCTGTTTGCAGG - Intergenic
1042025614 8:64420517-64420539 TAAGGAGGAGGTCTGTTGGTTGG - Intergenic
1042071525 8:64940789-64940811 GATTTTGGGGGACTGTTGGAAGG - Intergenic
1042868078 8:73372950-73372972 GACTTTGGAGGACTGTTGGAAGG + Intergenic
1043370435 8:79584459-79584481 GACTTTGGGGGACTGTTGGAAGG + Intergenic
1044224310 8:89702155-89702177 GAATTAGGAGTTTTGTTTAAAGG - Intergenic
1044324728 8:90847009-90847031 GACTTTGGGGGACTGTTGGAAGG - Intronic
1046026171 8:108726878-108726900 GAATTAGGGGGGCTGGTGCAGGG + Intronic
1046232401 8:111374345-111374367 GACTTTGGGGGACTGTTGGAGGG + Intergenic
1046597271 8:116274872-116274894 GAATCAGGAGGTCTCAGGGAGGG + Intergenic
1047060348 8:121218706-121218728 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1048367581 8:133752088-133752110 GAATTGGGAACTCTGTTGGTGGG - Intergenic
1048562175 8:135552221-135552243 GAATTAGGGGGTGTGGTGGGGGG - Intronic
1048694660 8:137012576-137012598 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1050594377 9:7191599-7191621 GAATAAGGAGGTCTAGAGGATGG + Intergenic
1052579931 9:30342132-30342154 GAAATAGGAGCACTGTTGGTGGG + Intergenic
1054751939 9:68916211-68916233 GTATTAAGAAGTCTGTTGTAGGG + Intronic
1054868214 9:70024917-70024939 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1055170843 9:73255688-73255710 GACTTTGGGGGACTGTTGGAAGG + Intergenic
1058245721 9:102623114-102623136 TAATTTGTAGGTCTGTTTGATGG + Intergenic
1059501482 9:114757609-114757631 GATTTTGCAGGACTGTTGGAAGG - Intergenic
1060743246 9:126113323-126113345 GAGTCAGGAGCTCTGTGGGATGG + Intergenic
1060951726 9:127608321-127608343 GACTCAGGAGGTCCGGTGGAGGG + Intergenic
1186472653 X:9833501-9833523 TAATTAGGAGGTCCGATGCAGGG - Intronic
1186679204 X:11854382-11854404 GACTTTGGAAGACTGTTGGAAGG - Intergenic
1187615669 X:20991123-20991145 GACTTTGGAGGACTGTTGGAAGG - Intergenic
1188567986 X:31548263-31548285 GATTTAGCAGGTCTGTGGCAAGG - Intronic
1188876802 X:35440720-35440742 GCATTTCGAGGTCTCTTGGAGGG - Intergenic
1191697571 X:64005533-64005555 GATTTTGGGGGACTGTTGGAAGG - Intergenic
1192335765 X:70217948-70217970 GACTTTGGGGGACTGTTGGAAGG + Intergenic
1192856433 X:75017574-75017596 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1193090703 X:77491123-77491145 GATTTAGTAGGTCTGGTGTAAGG - Intergenic
1193213559 X:78836723-78836745 GAATTAAGAGGTTGGGTGGAGGG - Intergenic
1193506140 X:82347441-82347463 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1193621583 X:83758724-83758746 GAATAAAGAAGACTGTTGGAGGG + Intergenic
1194756413 X:97744023-97744045 GACTTTGGGGGACTGTTGGAAGG + Intergenic
1194893372 X:99407402-99407424 GACTTTGCAGGACTGTTGGAAGG + Intergenic
1194929508 X:99868598-99868620 GACTTTGGGGGACTGTTGGAAGG + Intergenic
1195545346 X:106106842-106106864 GACTTTGGAGGACTGTTGGGAGG + Intergenic
1196930312 X:120675467-120675489 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1197088571 X:122509634-122509656 GACTTTGGGGGACTGTTGGAAGG - Intergenic
1197223362 X:123933728-123933750 GATTTTGGGGGACTGTTGGAAGG + Intergenic
1197536266 X:127692020-127692042 GACTTTGGGGGACTGTTGGAAGG + Intergenic
1197582003 X:128294946-128294968 GACTTTGGAGGGCTATTGGAGGG + Intergenic
1198679480 X:139166047-139166069 GACTCTGGAGGACTGTTGGAAGG + Intronic
1199154920 X:144536205-144536227 GATGTTGGGGGTCTGTTGGAAGG - Intergenic
1199908650 X:152261317-152261339 GAATTTGGGGAACTGTTGGAAGG - Intronic
1199999421 X:153050133-153050155 GACTTTGGGGGACTGTTGGAAGG + Intergenic
1200286934 X:154831901-154831923 CAATTAGGAAGTTTGTAGGAGGG - Intronic
1201573828 Y:15440928-15440950 AAATAAGGAGGTTTTTTGGAAGG + Intergenic