ID: 1079062112

View in Genome Browser
Species Human (GRCh38)
Location 11:17258172-17258194
Sequence CAGTTTGAGCTGAGGTATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079062110_1079062112 -6 Left 1079062110 11:17258155-17258177 CCTTCTAAGAAAAGGAACAGTTT 0: 1
1: 0
2: 3
3: 32
4: 376
Right 1079062112 11:17258172-17258194 CAGTTTGAGCTGAGGTATGCAGG 0: 1
1: 0
2: 1
3: 14
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079062112 Original CRISPR CAGTTTGAGCTGAGGTATGC AGG Intronic
900084844 1:887088-887110 CACCTTGAGTTGAGGTATCCAGG - Intergenic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
903147014 1:21380527-21380549 CATTTTGAGCTGAATTATGGTGG - Intergenic
906832356 1:49046683-49046705 CAGTTTTAGATGAGTTTTGCAGG - Intronic
907352623 1:53845336-53845358 CAGATTAAGCAGAGGTATGAAGG - Intergenic
909500454 1:76329497-76329519 CAGTTTGAGCTAAGGCATGAAGG - Intronic
911596271 1:99801739-99801761 CAGCTTGAACTGAGGGATGGAGG - Intergenic
914805449 1:150987999-150988021 CAGTTTGGGCTGAGGAAGGTGGG + Intronic
916000408 1:160609752-160609774 TAGTGTGAGGAGAGGTATGCAGG + Exonic
916100460 1:161389721-161389743 GAGTATGAGGTGAGGTATGCAGG + Intergenic
919656651 1:200203196-200203218 AAGTTTGAGCTGAGGTCTTGTGG - Intergenic
920863087 1:209727190-209727212 CAGTTGGAGCTGAGTTGTGCTGG - Intronic
923183238 1:231543708-231543730 CAGTTTTAACTAATGTATGCTGG - Intronic
923404426 1:233646005-233646027 CAATTTGGGCTGAGGTTTTCAGG + Intronic
923493511 1:234505321-234505343 CAAGTTAAGATGAGGTATGCTGG + Intergenic
923758837 1:236820370-236820392 CAGATTGGTCTGAGGCATGCAGG + Intronic
1064145823 10:12825708-12825730 CAGTGTCAGCTGAGGGATTCTGG - Intronic
1064851772 10:19716232-19716254 CAATTTGAGCTGAAGTTTGGTGG - Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1074860314 10:117505016-117505038 AATTTTGAGCTGAGGGCTGCTGG - Intergenic
1076932923 10:133545843-133545865 CATCTTCAGCTGAGGTATCCAGG + Intronic
1077881103 11:6351058-6351080 CAGTTTGAGGTTGTGTATGCAGG - Intergenic
1078458483 11:11494467-11494489 GAGTTTGAGCTGAGCTTTGCAGG - Intronic
1078579070 11:12524976-12524998 TGCTTTGAGCTGAGGTCTGCAGG + Intronic
1079062112 11:17258172-17258194 CAGTTTGAGCTGAGGTATGCAGG + Intronic
1079739042 11:24035092-24035114 CACTTTCAGCTGAGGTATCCAGG - Intergenic
1080783210 11:35449948-35449970 CACTTTCAGCTGAGGTATCTAGG - Intronic
1081273481 11:41117224-41117246 CAATTTGAGCTGAGCTCAGCTGG - Intronic
1081523736 11:43908437-43908459 CAGCTGGAGGTGAGGTATGGCGG + Intronic
1081864718 11:46353227-46353249 CAGTGTGAGCTGGGGGATCCTGG - Intronic
1084541134 11:69787880-69787902 AAGGTTGAGCTGAGGTCTGATGG - Intergenic
1085641327 11:78194983-78195005 GACTTTCAGCTGAGGTCTGCAGG + Intronic
1087718432 11:101635855-101635877 CACCTTCAGCTGAGGTATCCAGG + Intronic
1088766903 11:112990632-112990654 CAGGTAGAGCTGAGGTCTGTAGG + Intronic
1089039343 11:115431742-115431764 AAGATTGAGCTGAGATATGAAGG - Intronic
1091635535 12:2194008-2194030 CAGTTGGAGCTGAGGTATCCTGG - Intronic
1092214426 12:6671019-6671041 CAGCTTGAGCTGAGTGATGCAGG - Intronic
1094039814 12:26110912-26110934 CAATTTGAGCTGAGTTTTGAAGG + Intergenic
1100098112 12:91068499-91068521 CAGTTTAAACTGAGGTTTCCTGG + Intergenic
1102392943 12:112564068-112564090 GAGTTTGGGCTGAGGAAGGCAGG - Intergenic
1107944819 13:45408402-45408424 CAGTTTGTGCTGTGGTGTACTGG + Intronic
1110821933 13:79926458-79926480 CACCTTCAGCTGAGGTATCCAGG - Intergenic
1114296732 14:21336245-21336267 CAATTTCAGCTGAGGTGTGGTGG + Intronic
1115779279 14:36751336-36751358 CTGTTTGAGCTGAAGAATGTAGG + Intronic
1117750949 14:58923682-58923704 CAACTTCAGCTGAGGTATCCAGG + Intergenic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1118945236 14:70379455-70379477 CAGTTTGAGCACAGGTATAAAGG - Intronic
1119960553 14:78851004-78851026 CTTTTTGAGCTGAATTATGCAGG + Intronic
1120623379 14:86792942-86792964 CAATTTGAGATGAGGTTTGTGGG - Intergenic
1124368248 15:29088994-29089016 CTGTTTAAGCTGAGGTCTGGAGG - Intronic
1130336224 15:82959238-82959260 CAGTCTGGGCTGAGGTGTGGAGG + Intronic
1130744055 15:86631558-86631580 TAGTTTGAGTTGAGGCCTGCTGG + Intronic
1130801012 15:87263208-87263230 CAGTTTGACCAGGGGTATGGTGG - Intergenic
1133343204 16:5052368-5052390 CACTTTGAGCTCAGGAATTCTGG + Intronic
1140258456 16:73357007-73357029 CAATTGGAGCTGAGCTCTGCTGG - Intergenic
1142861822 17:2766874-2766896 CAGTTTGAGCTGAGCTCTAAAGG - Intergenic
1143100607 17:4502748-4502770 CAGCTTGAGCAGAGGCATGAAGG - Intronic
1143275348 17:5705887-5705909 CAGTTTGGGCTGAGGAAGGTGGG + Intergenic
1144391891 17:14801251-14801273 CAGTTTGAGCTGGGCTCAGCAGG - Intergenic
1147145426 17:38481978-38482000 CAGAGTGAGCTGGGGTATCCAGG - Intronic
1147196050 17:38767407-38767429 CATTTTGAGCTGTGGTTTGGTGG - Exonic
1151317451 17:73332004-73332026 CAGTAGGAGCAGACGTATGCTGG - Intergenic
1155997193 18:32342570-32342592 CACTGTGAGCTGAGGTGTGTAGG - Intronic
1156614762 18:38770229-38770251 CAGTTTGTGCTAAGAAATGCGGG - Intergenic
1157082455 18:44540576-44540598 CATTTTGACCTGACATATGCAGG - Intergenic
1161764170 19:6197388-6197410 CAGGAGGAGCTGAGGTATGTGGG - Intronic
1162281109 19:9698669-9698691 CAGCTGGAGGTGAGATATGCTGG + Intronic
1167034982 19:46989765-46989787 CTGTTAGAGCTGAGGTTTGAAGG + Intronic
925545322 2:5009538-5009560 ATGTTTGAGGTGAGGGATGCGGG - Intergenic
926041997 2:9680895-9680917 CAGATGGAGCTGAGGCCTGCAGG - Intergenic
927995111 2:27479519-27479541 AAGTTTGAGTTGACGTATGTGGG - Exonic
930229261 2:48827082-48827104 CATTTTGAGCTGTGCTGTGCTGG - Intergenic
930455837 2:51606148-51606170 CATCTTCAGCTGAGGTATCCAGG - Intergenic
931419580 2:62114018-62114040 CAGTTTGAAATGAGGGATTCAGG + Intronic
931493900 2:62781628-62781650 CAGCTTGAGCAGAGGTCTGGAGG + Intronic
931600948 2:64001972-64001994 CACTGTGGGCTGAGGTGTGCCGG - Intronic
931662482 2:64579317-64579339 CAGTTTGTGCTGATATTTGCAGG + Intronic
931957270 2:67441339-67441361 GAGTTTGAACAGAGGTCTGCAGG - Intergenic
936750526 2:115635546-115635568 CAGACTGAACTGAGGTATCCAGG - Intronic
937139890 2:119590857-119590879 CAGTTTGTGCTGGGGTTTGGGGG - Intronic
938489954 2:131756157-131756179 AAGTTTCAGCTGAGGTTTGAGGG + Intronic
939852756 2:147319988-147320010 CATCTTCAGCTGAGGTATCCAGG - Intergenic
941260667 2:163292733-163292755 CAGTTTGAGCTGAGTCAGGAGGG + Intergenic
942368707 2:175257385-175257407 CTGTTTGAGGTGAGGTGTGGAGG - Intergenic
944035425 2:195289940-195289962 CACCTTCAGCTGAGGTATCCAGG + Intergenic
944439493 2:199727621-199727643 CAGCTTCAGCTGAGGTATCCAGG - Intergenic
945451525 2:210000952-210000974 CAGCTTGTGGGGAGGTATGCAGG - Intergenic
1169833650 20:9853533-9853555 CATTTTGAGGCGAGGTATGGTGG + Intergenic
1169870968 20:10247896-10247918 CAGTTTGGGCTGAGTTCAGCTGG + Intronic
1173584464 20:44171707-44171729 ATGTTTGAGCTGAGATATGCAGG - Intronic
1173590717 20:44222639-44222661 CAGTTTGACCTGAGATTTGGAGG - Intergenic
1173849297 20:46207757-46207779 CAGCTTGTGCAGAGGTATACAGG - Intronic
1174620189 20:51868255-51868277 GAGTTTGAGCAGAGGTTTGTGGG - Intergenic
1175012723 20:55756144-55756166 CAGTTTGAACTGAAGTTTGTTGG + Intergenic
1176706704 21:10123540-10123562 AAGTTTCAGCTGAGGTTTGAGGG + Intergenic
1184586730 22:45452924-45452946 CAGTTCTAGCTGAGGGATGGTGG - Intergenic
1184860525 22:47171062-47171084 CAGGATGAGCTGAGCTGTGCAGG - Intronic
950524506 3:13516203-13516225 CAGTTTGAGCTGAGGAAACTGGG - Intergenic
950657853 3:14448341-14448363 CAGTTTGGGCTGAGCTTGGCTGG + Intronic
952527733 3:34229917-34229939 CATTTTGGGCTGAGCTCTGCTGG + Intergenic
953877967 3:46677060-46677082 GAGATGGAGCTGAGGTAGGCAGG + Intronic
954959558 3:54552102-54552124 CATTTGGACTTGAGGTATGCTGG - Intronic
956204682 3:66742951-66742973 CAGATTCAGCAGAGCTATGCTGG + Intergenic
957904685 3:86540821-86540843 GAGTTTGAGATGAGGGGTGCAGG + Intergenic
962665367 3:137648927-137648949 CAGTTTGAGCAAAGGTACACAGG - Intergenic
962864904 3:139440333-139440355 CAGTCTGTCCTGAGGTATGGTGG + Intergenic
965809872 3:172580105-172580127 CAGTTTGAGATGAGATTTGGTGG - Intergenic
966248066 3:177830972-177830994 GAGTTTGAGGTGAGGGATGGCGG + Intergenic
967807416 3:193728145-193728167 CAGTGTGGGCAAAGGTATGCGGG + Intergenic
971468534 4:26992589-26992611 AAGTTTTAGCTGAGATATGAAGG + Intronic
971621990 4:28866953-28866975 CAACTTGAGGTGAGATATGCTGG - Intergenic
973284938 4:48404120-48404142 CACCTTGAACTGAGGTATCCAGG - Intronic
976366044 4:84233297-84233319 GAGTTTGAGCTGAGACATGAAGG - Intergenic
977100573 4:92808138-92808160 GGGTGTAAGCTGAGGTATGCGGG + Intronic
982047284 4:151461376-151461398 AAGTGTGAGGTGAGGTATGGTGG + Intronic
983957493 4:173715461-173715483 CACCTTCAGCTGAGGTATCCAGG + Intergenic
984768196 4:183415586-183415608 CAGTTTTAGCTGAGGTGTCCAGG - Intergenic
995112748 5:108445750-108445772 TATTTGGAGCTGAGTTATGCAGG + Intergenic
995950542 5:117707312-117707334 CATTTTGAACTGAAGTCTGCTGG - Intergenic
999938488 5:156515436-156515458 CACCTTCAGCTGAGGTATCCAGG + Intronic
1001425821 5:171621744-171621766 CAGTAAGAGGTGAGGTATGATGG - Intergenic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1002141320 5:177141624-177141646 CTGTTTGAGAAGTGGTATGCAGG - Intronic
1002689711 5:181042256-181042278 CAGCTGGAGCTGAGCTCTGCCGG - Intronic
1003183590 6:3811901-3811923 CAGGTTTAGATGAGGCATGCAGG - Intergenic
1003791764 6:9553944-9553966 CAGTTCAAGATGAGATATGCGGG + Intergenic
1004723280 6:18287867-18287889 CAGTTTCAGTAGAGATATGCAGG + Intergenic
1004984041 6:21059651-21059673 CACCTTCAGCTGAGGTATCCAGG - Intronic
1007497811 6:42273075-42273097 TAGTTTGAGCTGAGATCTGAAGG - Intronic
1008389171 6:50929501-50929523 CAGTAGGAGGTGAGGTCTGCGGG + Intergenic
1011748726 6:90434071-90434093 CAAAGTGGGCTGAGGTATGCAGG + Intergenic
1013572723 6:111445860-111445882 CAGTTTAAGCAAAGGTATGGGGG + Intronic
1013920558 6:115397134-115397156 CACCTTCAGCTGAGGTATCCAGG - Intergenic
1014347072 6:120285213-120285235 CATTGTAAGCTGAGGTATGCTGG - Intergenic
1015587258 6:134789164-134789186 CACTTTCAACTGAGGTATCCAGG + Intergenic
1017057470 6:150451056-150451078 TATTTTGAACTGAGGCATGCTGG - Intergenic
1017503526 6:155046892-155046914 CAGTGTGAGATGAGAGATGCAGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019650283 7:2153497-2153519 CATTTTAAGCTGAGGTAAGGTGG - Intronic
1023761005 7:43465302-43465324 CAATTTGAGCTGAGCTCAGCTGG + Intronic
1028909754 7:96194906-96194928 GAGTTTCAGCTGAGGCAGGCTGG - Intronic
1030732775 7:113009240-113009262 CACTTTCAGCTGAGGAATCCAGG - Intergenic
1031953744 7:127920560-127920582 CAGTTTGGGATGAGGTAGGGAGG + Intronic
1032408415 7:131674526-131674548 AAGTTTGGGCTGAGGCATGGAGG + Intergenic
1032502753 7:132412262-132412284 CAGATGGAGCTGAGGTCTGGAGG - Intronic
1032574558 7:133039543-133039565 CATATAGAGCTGAGTTATGCTGG - Intronic
1032899955 7:136295849-136295871 CAGTTTGGGCTGAGTTCAGCTGG + Intergenic
1033017778 7:137689515-137689537 CAGCTTGAGCTGAGTTTTTCTGG - Intronic
1035064453 7:156094995-156095017 CAGGTGGACCTGAGGTAGGCAGG + Intergenic
1037020914 8:13969050-13969072 GAGTTTGAGGTCAGGTATGGTGG + Intergenic
1038355580 8:26826092-26826114 CACTTTGAGCTGAGCTTTGAGGG - Intronic
1039548243 8:38424975-38424997 CAGGTTGTGCTGAGGTCTGGGGG - Intronic
1039637203 8:39179796-39179818 CACTTTCAACTGAGGTATCCAGG - Intronic
1040817216 8:51520751-51520773 CAGCAGGTGCTGAGGTATGCAGG - Intronic
1041188936 8:55333380-55333402 CAGTTTGAGCTGATTAATGAAGG - Intronic
1041670965 8:60491583-60491605 CACTTTGAGCTCTGCTATGCAGG - Intergenic
1042836005 8:73079606-73079628 GAGATGGAGCTGAGGTATGTGGG - Intronic
1045775506 8:105797742-105797764 CAGCCTGAGCTGAGGTATGAAGG - Intronic
1046062107 8:109151895-109151917 CAGGTCTAGCTGAGGTATGCAGG + Intergenic
1046601043 8:116317220-116317242 CATCTTCAGCTGAGGTATCCAGG + Intergenic
1048153333 8:131915740-131915762 CTGTTTGAGATGAGTTATGCAGG + Intronic
1049138374 8:140927565-140927587 CACTTTTAGCTGAGAAATGCAGG - Intronic
1049913266 9:290875-290897 GAGTTTGTGCTGAGGTTTTCTGG + Intronic
1050012419 9:1198736-1198758 AAGTTTTAGGTGAGGGATGCAGG - Intergenic
1052091242 9:24330163-24330185 CAGTTTGACTTGAGATATGAAGG - Intergenic
1054324855 9:63707889-63707911 AAGTTTCAGCTGAGGTTTGAGGG + Intergenic
1057371536 9:94479033-94479055 AAGCGTGAGCTGCGGTATGCTGG - Intergenic
1058705674 9:107636456-107636478 CACATTGGGATGAGGTATGCTGG - Intergenic
1059115472 9:111597163-111597185 CAATTTGGGCTGAGTTAAGCTGG - Intronic
1059438904 9:114291792-114291814 GAGTGTGAGCTGAGGTTTGAAGG + Intronic
1060437199 9:123604136-123604158 GAGCATGAGCTGAGGTAAGCAGG - Intronic
1186117782 X:6323220-6323242 CATTTTTAGCTGAGGCAGGCGGG + Intergenic
1186188502 X:7045029-7045051 CAGTTTGAGATGAGATTTGGGGG - Intergenic
1186222883 X:7367739-7367761 CAGTTAGAGCTGGGATAAGCTGG - Intergenic
1186602272 X:11050360-11050382 CAGTTGCTGCTGAGGGATGCGGG + Intergenic
1189129216 X:38480817-38480839 AAGTTTGAGCACAGGTATGGTGG + Intronic
1189837309 X:45039058-45039080 CAGTTTGAGATCATTTATGCTGG + Intronic
1190473646 X:50807356-50807378 CAGTGTCAGTGGAGGTATGCAGG + Intronic
1193895469 X:87110032-87110054 CACCTTCAGCTGAGGTATCCAGG + Intergenic
1195869702 X:109473093-109473115 CAGATTCAGATGAGGCATGCTGG - Intronic
1197846371 X:130808047-130808069 CAGTTTAAGCTCAGGTATCTAGG - Intronic
1199506087 X:148563022-148563044 CTGTTTGAGCCGAGGCCTGCAGG + Intronic
1201592491 Y:15630113-15630135 CAGTTAGAGCTGGGATAAGCTGG - Intergenic