ID: 1079063198

View in Genome Browser
Species Human (GRCh38)
Location 11:17267492-17267514
Sequence AATTAAATGCAGAAATTAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9407
Summary {0: 1, 1: 0, 2: 14, 3: 737, 4: 8655}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079063198_1079063202 -1 Left 1079063198 11:17267492-17267514 CCGGCTAATTTCTGCATTTAATT 0: 1
1: 0
2: 14
3: 737
4: 8655
Right 1079063202 11:17267514-17267536 TTATTTTTTTGGTAGAGATGGGG 0: 32
1: 1342
2: 15582
3: 129844
4: 232543
1079063198_1079063200 -3 Left 1079063198 11:17267492-17267514 CCGGCTAATTTCTGCATTTAATT 0: 1
1: 0
2: 14
3: 737
4: 8655
Right 1079063200 11:17267512-17267534 ATTTATTTTTTTGGTAGAGATGG 0: 5
1: 147
2: 3027
3: 31902
4: 267726
1079063198_1079063201 -2 Left 1079063198 11:17267492-17267514 CCGGCTAATTTCTGCATTTAATT 0: 1
1: 0
2: 14
3: 737
4: 8655
Right 1079063201 11:17267513-17267535 TTTATTTTTTTGGTAGAGATGGG 0: 32
1: 1396
2: 16543
3: 143081
4: 311561
1079063198_1079063203 0 Left 1079063198 11:17267492-17267514 CCGGCTAATTTCTGCATTTAATT 0: 1
1: 0
2: 14
3: 737
4: 8655
Right 1079063203 11:17267515-17267537 TATTTTTTTGGTAGAGATGGGGG 0: 10
1: 158
2: 932
3: 4718
4: 9059

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079063198 Original CRISPR AATTAAATGCAGAAATTAGC CGG (reversed) Intronic
Too many off-targets to display for this crispr