ID: 1079064243

View in Genome Browser
Species Human (GRCh38)
Location 11:17276215-17276237
Sequence CAGTTAAACCACAGTGACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079064243 Original CRISPR CAGTTAAACCACAGTGACCG AGG Intronic
904921415 1:34011093-34011115 TAGTCAAAACACAGTGACCAAGG - Intronic
905527586 1:38650731-38650753 AAGTCAAACCACAGTTACCAGGG + Intergenic
907860004 1:58343640-58343662 AAGTTAAACCACATTGCCAGCGG + Intronic
916451348 1:164923458-164923480 CAGTTAATCCACAATAACTGGGG + Intergenic
919369667 1:196707522-196707544 CACTTAAAACACAGTGAAAGAGG + Intronic
1063526303 10:6789656-6789678 CAGTGAACCCACAGTGCCCCAGG - Intergenic
1075799914 10:125147210-125147232 TACATAAACCACAGTGAACGTGG - Intronic
1079064243 11:17276215-17276237 CAGTTAAACCACAGTGACCGAGG + Intronic
1081671550 11:44945421-44945443 CAGTTAAAGAACAGTTACCTTGG - Intronic
1082649780 11:55775551-55775573 TATTAAAACCACAGTGACTGAGG + Intergenic
1085614935 11:77990133-77990155 CACTTAAACCAAAGAGACGGAGG + Intronic
1086279779 11:85171987-85172009 CAGCTGAACCACAGGGACAGTGG - Intronic
1086720278 11:90112041-90112063 AGGTTAAACCACAGAGACCCAGG - Intergenic
1087007009 11:93480737-93480759 CATTTACACCTAAGTGACCGAGG + Intronic
1095698491 12:45166329-45166351 TATTTAAACCTCAGTGACCTTGG + Intergenic
1112689712 13:101878148-101878170 TAGGTAACCCACAGTGACCCAGG - Intronic
1113789762 13:113022108-113022130 CACTGGAACCACAGAGACCGGGG - Intronic
1113803461 13:113098450-113098472 CAGTTAAAAAAAAGTGACAGTGG - Intronic
1122454732 14:101841622-101841644 CACCAACACCACAGTGACCGTGG - Intronic
1124130176 15:26976727-26976749 CAGTTAAACTACAGACAACGTGG - Intronic
1125334430 15:38613636-38613658 CAGTCAAATCACAGAGACAGTGG + Intergenic
1132045325 15:98558491-98558513 CAATCAAACCACAGTGACTGTGG + Intergenic
1133250042 16:4474735-4474757 CAGTTAGACCAAAATGAGCGAGG + Exonic
1134161499 16:11893764-11893786 CACTTCAACCACAGAGACCTGGG + Intronic
1137784748 16:51129116-51129138 CAGTTAATACACAGTGACTAAGG + Intergenic
1140049975 16:71471952-71471974 CAGATGAACCTCAGTGACGGTGG + Intronic
1140631163 16:76854284-76854306 CAGTTGAGCCACACTGTCCGTGG + Intergenic
1141357094 16:83357440-83357462 CAGTTAAACCACATCAAACGTGG - Intronic
1145964457 17:28906954-28906976 CTGTTAAACTACAGTGAGCATGG - Exonic
1152889542 17:82872752-82872774 CAGTGAAACCAGAATGACGGTGG - Intronic
1155117892 18:22787635-22787657 CAGTGAAAGCAGAGTGAGCGGGG + Intergenic
1155729342 18:29133160-29133182 AAGTTAAACCATTGTGACCCGGG - Intergenic
1164772076 19:30816948-30816970 CTCATAAACCAAAGTGACCGAGG + Intergenic
1165277831 19:34770348-34770370 CAGTGAATCCACAGTGACAAGGG + Intronic
1167475374 19:49697526-49697548 CAGGTACACCACAATGACAGAGG - Intronic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
930847019 2:55917342-55917364 CAGTTAAATCACAGTCTCTGAGG - Intronic
934306822 2:91832092-91832114 AGGTTAAACCACAGGGACCCAGG + Intergenic
934326434 2:92020650-92020672 AGGTTAAACCACAGGGACCCAGG - Intergenic
934464798 2:94251267-94251289 AGGTTAAACCACAGGGACCCAGG - Intergenic
936916697 2:117647133-117647155 CCATAAAACCACAGTGACCTAGG + Intergenic
940617831 2:156072920-156072942 AATTTAAGCCACAGTGACCTTGG + Intergenic
940891879 2:159043113-159043135 CAGTAAAAGCAGAGTGACCGGGG - Intronic
1176595835 21:8694438-8694460 AGGTTAAACCACAGGGACCCAGG - Intergenic
1178393020 21:32214859-32214881 CAGTTAAACCAGAGGCTCCGGGG - Intergenic
1180278695 22:10671551-10671573 GGGTTAAACCACAGGGACCCAGG - Intergenic
1180585950 22:16890414-16890436 AGGTTAAACCACAGGGACCCAGG - Intergenic
1181032861 22:20156695-20156717 CAGTTCAGCCCCAGTGACCCTGG - Intergenic
1181678914 22:24477582-24477604 CAGTTTGTCCACAGTGACCTTGG + Intergenic
1183337414 22:37257956-37257978 CAGTTAAGCCAAAGTGCCAGTGG - Intergenic
949639545 3:6019861-6019883 GAGTTAAAACACAGTCACCCAGG + Intergenic
950788138 3:15452549-15452571 CTGTGTAACCACAGTGAGCGTGG + Intronic
955425785 3:58788333-58788355 CATTTAAACCACGGTTACCGGGG + Intronic
956125772 3:66009424-66009446 CACTTGAACCCCAGAGACCGAGG + Intronic
957175087 3:76797953-76797975 CATTTAAACCACAGAGTCCTCGG - Intronic
960406169 3:117262464-117262486 CAGTTGAAACACAGTGAACGTGG - Intergenic
966328777 3:178788102-178788124 GAGTTAAACCACATTCACCATGG + Intronic
968219953 3:196929645-196929667 CAGAAAAACGACAGTGACTGTGG + Exonic
970159233 4:13172363-13172385 CAGGCAAACCACAGTGACTCCGG + Intergenic
973889215 4:55352595-55352617 CATTCAAAACACACTGACCGAGG - Intronic
976678953 4:87733929-87733951 CATTTCATCCACAGTGACCCAGG - Intergenic
979742433 4:124168031-124168053 CAGCTAATCCACAGAGACCATGG - Intergenic
984353114 4:178621362-178621384 CAGCTAAACCATAGTCACCCTGG + Intergenic
986757511 5:10851951-10851973 CTGTAAAACCACAGGGACCTGGG - Intergenic
987751976 5:22051545-22051567 CAGTTAAAGAACAGTGACCTTGG + Intronic
991460242 5:66850573-66850595 CAGTCAAACCACAGTCAGCCTGG + Intronic
995235544 5:109825768-109825790 CAGTCAAACCTCAGTGGCCCGGG - Intronic
996459358 5:123724277-123724299 AAGGTAAACCTCAGTGACCTTGG + Intergenic
997253468 5:132409591-132409613 CAGGTAAACCAAAGTGACTCTGG + Intergenic
997353822 5:133249517-133249539 CAGTGTGACCACAGTGACCGTGG - Exonic
1011547257 6:88494727-88494749 CAGTTAAAGCAGATTGACCAAGG + Intergenic
1014135998 6:117890672-117890694 CAGTTACCCCACAGTCACCATGG - Intergenic
1015294320 6:131573221-131573243 CAGTCAACCCTCAGTGACAGAGG - Exonic
1016648081 6:146433771-146433793 CAGTTAAATCACACTGAGCTAGG + Intronic
1023813677 7:43931780-43931802 CAGTTGAACCAGAGAGACGGAGG - Intronic
1029686275 7:102150229-102150251 CACTTCAACCTCTGTGACCGGGG + Intronic
1034559980 7:151873601-151873623 CAGTTATTCCACAGTGGCTGAGG - Intronic
1035141795 7:156769768-156769790 CAGCTAAAGAACAGTGAGCGTGG + Intronic
1037060904 8:14508096-14508118 CAGTTCAAATACAGTGACCAGGG - Intronic
1037513086 8:19603355-19603377 CAGTAAACCCACAGTGAACTGGG - Intronic
1047311971 8:123699571-123699593 CTGTTAAACCACATTGTCAGAGG - Intronic
1049496727 8:142939106-142939128 CAGGTCAGCCACAGTGACCAAGG + Intergenic
1049644443 8:143729753-143729775 CTGTTAAACCATAGCGACTGAGG - Intronic
1051177976 9:14380272-14380294 CAGTTCAACCACAATCACTGAGG + Intronic
1053694882 9:40628026-40628048 AGGTTAAACCACAGGGACCCAGG - Intergenic
1053941867 9:43258406-43258428 AGGTTAAACCACAGGGACCCAGG - Intergenic
1054269959 9:63012093-63012115 AGGTTAAACCACAGGGACCCAGG + Intergenic
1054306126 9:63427250-63427272 AGGTTAAACCACAGGGACCCAGG - Intergenic
1054404868 9:64751229-64751251 AGGTTAAACCACAGGGACCCAGG - Intergenic
1054438492 9:65236721-65236743 AGGTTAAACCACAGGGACCCAGG - Intergenic
1054491912 9:65785227-65785249 AGGTTAAACCACAGGGACCCAGG + Intergenic
1055664529 9:78540065-78540087 GAGGTAAACCACAGTCACCGAGG + Intergenic
1056702628 9:88923811-88923833 CAGTGAAGCCACAGTGCCGGAGG - Intergenic
1059258300 9:112951143-112951165 AAGTTAATCAACAGTGACTGTGG + Intergenic
1061120530 9:128639532-128639554 CAGTGAAACCAGAGAGACTGGGG + Intronic
1202777327 9_KI270717v1_random:1632-1654 AGGTTAAACCACAGGGACCCAGG - Intergenic
1188403750 X:29781084-29781106 CAGGTAAAGAACAGTGACAGAGG - Intronic
1192733409 X:73824572-73824594 TAGTTAAACCACAGTGAGAAGGG - Intergenic
1194814290 X:98423879-98423901 CAGTTAAACTACAGACACCCAGG + Intergenic
1195718068 X:107837629-107837651 CAGATAAACCTCAGTGAAGGAGG + Intronic
1199863734 X:151824610-151824632 CAGTTCATCCAGAGTGACGGGGG + Intergenic
1199983142 X:152932109-152932131 CAGTAAAAGCACAGTGAGTGTGG - Intronic
1201192680 Y:11459979-11460001 AGGTTAAACCACAGAGACCCAGG - Intergenic