ID: 1079067381

View in Genome Browser
Species Human (GRCh38)
Location 11:17307290-17307312
Sequence ATAGATAAACCCAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079067381_1079067384 30 Left 1079067381 11:17307290-17307312 CCATCCTCCTTGGGTTTATCTAT 0: 1
1: 0
2: 0
3: 21
4: 245
Right 1079067384 11:17307343-17307365 GACGTTTTGCTATGTTGTCCAGG 0: 2
1: 8
2: 417
3: 5831
4: 34659

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079067381 Original CRISPR ATAGATAAACCCAAGGAGGA TGG (reversed) Intronic
901473772 1:9475225-9475247 ATTGAGCAACCCAAGGAAGAGGG + Intergenic
901910430 1:12453063-12453085 ATGTATTGACCCAAGGAGGATGG - Intronic
902827024 1:18982474-18982496 TTAGATACACCTCAGGAGGAAGG + Intergenic
905131925 1:35767887-35767909 AAATAAAAACCTAAGGAGGAGGG + Intronic
906561747 1:46763353-46763375 AAAGATAAAGCCAAGGAGGGTGG + Intronic
906604784 1:47160367-47160389 AAATATAAACCCAAGGAGAGAGG - Intergenic
909664084 1:78114440-78114462 ATAGACAAAAACAAGCAGGATGG - Intronic
910272045 1:85407019-85407041 AAACAAAAACTCAAGGAGGAAGG - Intronic
911981355 1:104571002-104571024 ATAGAAAAACAAAAGGAGAAAGG + Intergenic
912145070 1:106783529-106783551 GTAGTAAAACCCAAGGAGCAGGG + Intergenic
912444617 1:109725675-109725697 GTAGATAACCTCAAGGAGCACGG - Intronic
912640803 1:111344288-111344310 AGAGATAAACCCTAGGAATAAGG - Intergenic
912997814 1:114549253-114549275 ACCGAGAAAACCAAGGAGGAAGG - Intergenic
913699953 1:121364834-121364856 ATAGAAAACTCCAAGCAGGATGG - Intronic
914040500 1:144045276-144045298 ATAGAAAACTCCAAGCAGGATGG - Intergenic
914137587 1:144915203-144915225 ATAGAAAACTCCAAGCAGGATGG + Intronic
915483596 1:156204439-156204461 ATAGACAGGCCCAAGGAGGCAGG + Intronic
915603886 1:156938916-156938938 ATAGATGAGCCCAGGGAGGAAGG - Intronic
915929340 1:160049433-160049455 ATAGGTAAAGACAAGGAGGAAGG - Intronic
916801844 1:168223233-168223255 AGAGATGAACCCAAAGAGGAAGG + Intergenic
916875189 1:168961504-168961526 AAAGTTAAACCCAAACAGGATGG + Intergenic
917475362 1:175364910-175364932 AGAGAAAGACCCAAGGAGTAGGG - Intronic
920487368 1:206383543-206383565 ATAGAAAACTCCAAGCAGGATGG - Intronic
920710275 1:208288156-208288178 AAAGGTAAACCCCAGGAGGGAGG - Intergenic
921493326 1:215805859-215805881 TTAGATAAAGCCAAGAATGAGGG + Intronic
923091507 1:230744704-230744726 ATAGATAAGTCCCAGGTGGAAGG + Intergenic
923392156 1:233523167-233523189 ACAGATAAATCCAAGGAGACTGG - Intergenic
923406562 1:233666790-233666812 AGTGACAAACCCAAGGAGCACGG - Exonic
924860216 1:247912348-247912370 ATAAATAAACTCAATGAGGAAGG + Intergenic
924864676 1:247965711-247965733 AGACATAAAACCAAGGAGAAGGG - Exonic
1064196703 10:13249519-13249541 ATAGATATACAAAAGAAGGAAGG + Intergenic
1064591088 10:16891439-16891461 AGAGAGAAAACCAAGGAGGAAGG + Intronic
1066451640 10:35535312-35535334 GTAGATAACCTCAAGGAGCACGG + Intronic
1067264198 10:44723026-44723048 ATAGAAAATCCCAAGGAAAAGGG - Intergenic
1067976200 10:51027998-51028020 ATAGATAAACACACTGAGGCAGG + Intronic
1069702905 10:70439643-70439665 CTAAATAAACCCAAGATGGAAGG + Intronic
1069802392 10:71090177-71090199 ATTGATAAGCCCCAGGAGGATGG - Intergenic
1071359452 10:84831399-84831421 ATAGAAAAAGGCAAGGAGGGAGG - Intergenic
1071473272 10:86002794-86002816 ATAAACAAACCAATGGAGGAAGG - Intronic
1071807775 10:89142968-89142990 AAAGAGAAACCCAGGGAGGAAGG - Intergenic
1072428225 10:95348310-95348332 ATAGAAAAACACAAGGAAGTAGG + Intronic
1072873466 10:99146287-99146309 ATAGATGAAGCCAAGGGAGAAGG - Intronic
1072943573 10:99789227-99789249 ATAAATAGATCCACGGAGGAAGG + Intronic
1074716238 10:116222065-116222087 TTTCATAAACCCAAGTAGGATGG - Intronic
1077882830 11:6364323-6364345 GTAAATAAACCCAAGTGGGATGG - Intergenic
1079067381 11:17307290-17307312 ATAGATAAACCCAAGGAGGATGG - Intronic
1085286677 11:75367034-75367056 ATAGATAACCTCAAGGAGCACGG + Intergenic
1089037075 11:115405861-115405883 ATAGTTCAATCCTAGGAGGAAGG + Intronic
1089711643 11:120319130-120319152 AAAGAGAAACACAGGGAGGAAGG - Exonic
1090602139 11:128383996-128384018 ATAGATAAACCCATGCAGTTAGG + Intergenic
1091214086 11:133889657-133889679 ATTGCTGAACCCAAGGTGGATGG - Intergenic
1093075864 12:14758127-14758149 ATAGAAAAACACAAGAAGGAAGG + Intergenic
1094618075 12:32054344-32054366 GTAGATAACCTCAAGGAGCACGG - Intergenic
1097941809 12:65317043-65317065 ACAAATAAACTAAAGGAGGAAGG + Intronic
1101162477 12:101993463-101993485 ATAGCTGTACCCAAGAAGGATGG - Intronic
1102413195 12:112738134-112738156 AGAGATATACACAAGGAAGAAGG - Intronic
1103149684 12:118626228-118626250 ATGGATGAACCCATAGAGGAAGG - Intergenic
1106102005 13:26701893-26701915 ATACATAAGCCCATGAAGGAGGG - Intergenic
1106177972 13:27347498-27347520 AAAGATAGAGCCAAGGAGGGTGG + Intergenic
1106691286 13:32120109-32120131 TTAAATAAAACCAATGAGGAGGG - Intronic
1106925967 13:34613454-34613476 ACAGATGGACCCAAGGATGAGGG + Intergenic
1108846278 13:54681044-54681066 AAATATAAACCCAGGGAGTAAGG + Intergenic
1108960376 13:56220090-56220112 ATATATAAACACAAATAGGAAGG + Intergenic
1109467157 13:62750735-62750757 ACAAACAAACCCAAGGTGGAAGG + Intergenic
1112993522 13:105543719-105543741 ATAGATAAAACCAATGAGAATGG - Intergenic
1115496101 14:34006263-34006285 ATACTTAAAGCCAGGGAGGAAGG + Intronic
1115879428 14:37898715-37898737 AAAGATAAAGCAAAGAAGGAGGG + Intronic
1117689294 14:58289694-58289716 ATACATACAAACAAGGAGGAAGG + Intronic
1118856936 14:69630495-69630517 ATAATTTAAGCCAAGGAGGAAGG + Intronic
1118879692 14:69815750-69815772 ATAGATAACCTCAAGGAGCTTGG - Intergenic
1118970395 14:70631931-70631953 AGAGGTAGACTCAAGGAGGAAGG + Intergenic
1119083429 14:71718437-71718459 ATAGATAAAACCAAGGATCGGGG + Intronic
1119827907 14:77673187-77673209 ATAGGTAAACCCAAGGAAAGGGG - Exonic
1120703533 14:87724497-87724519 ACAGATAAATCCAAGGTAGAGGG + Intergenic
1121291570 14:92780016-92780038 AAAGAAAAACCCACAGAGGAGGG - Intergenic
1121564655 14:94899912-94899934 TTAGATTAACCCAGGAAGGATGG - Intergenic
1124068255 15:26366388-26366410 ACAGAAAATCCCAAGGATGATGG - Intergenic
1126184214 15:45815136-45815158 GTAGATAACCTCAAGGAGCATGG - Intergenic
1127807973 15:62538592-62538614 AAATCTAAAACCAAGGAGGAAGG - Intronic
1129139447 15:73584020-73584042 ATAGAGAAAGCTAAGGAGTAGGG + Intronic
1130303184 15:82695720-82695742 AGAGTTGAACCCAAGGAGGGTGG + Intronic
1130606925 15:85326009-85326031 ATAGTCAAACTCAAGGAGCAGGG - Intergenic
1133534329 16:6686337-6686359 ATCAATAAAGCAAAGGAGGAGGG - Intronic
1134377684 16:13693157-13693179 GTAGATAACCTCAAGGAGCATGG + Intergenic
1137034802 16:35560761-35560783 ACAGATAACCTCAAGGAGCACGG - Intergenic
1137354884 16:47751785-47751807 ATAGATAAGCTCAAGGAGTCAGG + Intergenic
1137784694 16:51128605-51128627 ATAGTCAAACCCAAAGAGGCAGG + Intergenic
1138539796 16:57680887-57680909 ATTGAAAAACCCAAGGTGCATGG + Intronic
1139469343 16:67170043-67170065 ATAGAGGAACCCCAGGAGGGTGG + Intergenic
1140088281 16:71815807-71815829 AGAGAGAAACAAAAGGAGGAGGG + Intergenic
1141587236 16:85042480-85042502 CTAGATAAACCCAAGCAGAGGGG - Intronic
1144003242 17:11074949-11074971 ATAAATAAAGCCTAAGAGGAAGG - Intergenic
1144763308 17:17719552-17719574 ATAAATAAAGCCAAGGAAGCGGG - Intronic
1145734624 17:27218918-27218940 GGAGATAAACCCAAGGATCATGG - Intergenic
1146225339 17:31061307-31061329 AGAGATGAACCCAAGGATCACGG + Intergenic
1146264028 17:31439183-31439205 AGAGACACACCCAAGGAGCATGG - Intronic
1146517342 17:33499489-33499511 ATCTATAAAGCCAAGGAGGGAGG + Intronic
1146547967 17:33755449-33755471 AAAGATAAACCAAACCAGGAAGG - Intronic
1147520037 17:41162277-41162299 TTAAAGAAACCCAAGGAAGAAGG + Intergenic
1148549292 17:48541263-48541285 TTAAAGAAACCTAAGGAGGATGG + Intronic
1150512675 17:65773786-65773808 ATAGAAAAAGCAAAGGAGGTTGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152891956 17:82887105-82887127 ACAGGTAAAACCAAGGAAGAAGG - Intronic
1157933642 18:51850545-51850567 ATACATAAACACCAGGAGGCAGG - Intergenic
1164113782 19:22196278-22196300 GTAGATAACTCCAAGGAGCATGG - Intronic
1164278664 19:23748401-23748423 GTAGATAACCTCAAGGAGCATGG - Intronic
1166594607 19:44034461-44034483 GTAGATAACCTCAAGGAGCACGG + Intergenic
1167819480 19:51913443-51913465 GTAGATAACCTCAAGGAGCATGG - Intronic
1167838038 19:52090893-52090915 GTAGATAACCTCAAGGAGCATGG - Intronic
1168679739 19:58305830-58305852 GTAGATAACCTCAAGGAGCAGGG - Intronic
925632657 2:5911260-5911282 CTAAATAATCCCAAGAAGGAGGG + Intergenic
926455158 2:13058192-13058214 ATTGATAAACAAAAGGAGGAAGG - Intergenic
926536334 2:14117878-14117900 ATACATAAACACAAGAAAGAGGG - Intergenic
927017347 2:18978980-18979002 ATAAATAAATAAAAGGAGGAGGG - Intergenic
927442364 2:23128223-23128245 GTAGAGGAAGCCAAGGAGGATGG - Intergenic
927910958 2:26899453-26899475 ATAGAAAATCACAAGGAAGAGGG - Intronic
928456695 2:31428849-31428871 ATAAATACAATCAAGGAGGACGG + Intergenic
928464027 2:31503448-31503470 ATACCAAAACCCAAGAAGGATGG - Intergenic
929171551 2:38937484-38937506 CCAGATAAACTCAAGGAGGCTGG + Exonic
929327572 2:40635712-40635734 ATAGATAAACCCAAGGGTTTTGG + Intergenic
930132020 2:47861747-47861769 ATAGATACAAACAAGGATGACGG + Intronic
931116312 2:59170464-59170486 ATAGATGTTCCCAAGGAAGAGGG - Intergenic
931859724 2:66342164-66342186 GTGGATAGACCAAAGGAGGAAGG - Intergenic
931975414 2:67638654-67638676 AAAGCTAAAAACAAGGAGGAAGG - Intergenic
932751509 2:74374403-74374425 ATAGACAAACACACGGAGGAAGG + Intronic
933168643 2:79100470-79100492 ATAGCTAAACATAAGCAGGAGGG - Intergenic
934025539 2:87999030-87999052 TTAATTAAACCCAAGGAGGTGGG + Intergenic
934148546 2:89120596-89120618 ATATATAAAATCAAGGAGGAGGG + Intergenic
935519987 2:104092868-104092890 ATAAATAAACCTAAATAGGAAGG + Intergenic
935895040 2:107726715-107726737 ATAGAAAATCCGAAGGAAGAAGG + Intergenic
936019254 2:108982296-108982318 AGAGATGAACCCAGGGAGGTGGG + Intronic
937340455 2:121087591-121087613 ATCCCTAAGCCCAAGGAGGAGGG + Intergenic
940733879 2:157427131-157427153 ATAGACACACAGAAGGAGGAAGG + Intronic
943479498 2:188400225-188400247 ATAGAGAAACACAGGGAAGAAGG - Intronic
943720085 2:191194810-191194832 ATAGATAAATGGAAGAAGGAAGG - Intergenic
944742401 2:202625207-202625229 ATCAATAAACCAAAAGAGGAAGG + Intergenic
944745248 2:202649171-202649193 AAACATAATCCAAAGGAGGATGG - Intronic
945045344 2:205776680-205776702 CAAAATGAACCCAAGGAGGATGG - Intronic
948388251 2:237595015-237595037 CAAGAAAACCCCAAGGAGGAGGG - Exonic
1171113922 20:22508288-22508310 AGAGGAAAACCCAAGGAGGCAGG - Intergenic
1172425296 20:34851762-34851784 AAAGAGGGACCCAAGGAGGAAGG - Intronic
1172786902 20:37474500-37474522 ACACAGGAACCCAAGGAGGAGGG - Intergenic
1173418491 20:42879918-42879940 TTAGAAAAAACAAAGGAGGAAGG - Intronic
1173957601 20:47046434-47046456 GTAGATACACCGAAGGATGAAGG + Intronic
1175668200 20:60878118-60878140 AGAGAAAAACCTAAGGAGGAAGG + Intergenic
1176093878 20:63330753-63330775 CCAGACAAACCCAGGGAGGAAGG - Exonic
1182704806 22:32270445-32270467 AAAGAGAATCCCAAGGGGGAGGG + Intergenic
949431868 3:3985442-3985464 ATCGATAAACTGAAGGAGCATGG - Intronic
949441727 3:4088532-4088554 ATAGACAAAATAAAGGAGGAAGG - Intronic
952194221 3:31055925-31055947 GTAGATAACCCTAAGGAGCATGG + Intergenic
954999867 3:54917729-54917751 ATAAACAAACACAAAGAGGATGG - Intronic
955614703 3:60794338-60794360 ACAGATAAATGCAAAGAGGAAGG + Intronic
955693587 3:61614006-61614028 ATATTTTAACCCAGGGAGGATGG - Intronic
956185396 3:66557526-66557548 ATATTTAAACCCAAGAAGGCAGG - Intergenic
956929521 3:74027255-74027277 ATAGATAAAGACTGGGAGGAAGG - Intergenic
959214190 3:103428623-103428645 ACAGAAAAACCTAAGTAGGATGG - Intergenic
962604791 3:137024185-137024207 ATAAATAAAAAGAAGGAGGAAGG - Intergenic
963064268 3:141251240-141251262 CTAGATAACCCCAAGGGGCAAGG - Intronic
963755421 3:149230847-149230869 TTCGATAGACCCCAGGAGGAAGG + Intergenic
964611595 3:158621457-158621479 GTAGATAACCTCAAGGAGCATGG + Intergenic
967475224 3:189908787-189908809 ATAGACAAAGGCAGGGAGGAAGG - Intergenic
969201113 4:5606825-5606847 ACAGATAAATCCTAGGAGGTAGG + Intronic
970976279 4:22046580-22046602 ATAGATAAATCCATTGATGAGGG - Intergenic
971114430 4:23628360-23628382 ATAAATCAACCCAATGGGGATGG - Intergenic
971697602 4:29926604-29926626 ACAGAAAAACCCAAAGAGGAAGG - Intergenic
972134956 4:35880737-35880759 ATAGAAAAATACAAGGACGATGG + Intergenic
974409438 4:61520601-61520623 ATATTAAAACCCAAGTAGGAAGG - Intronic
975737171 4:77392518-77392540 GTAGATAACCTCAAGGAGCATGG + Intronic
975924439 4:79432111-79432133 GAAGATAAAGCCAAGGAAGAAGG - Intergenic
977040393 4:92009510-92009532 ATAGATAAAGCTGAGGAGCAAGG + Intergenic
977122003 4:93113878-93113900 ATAAATAAAACCACGGAGGCGGG + Intronic
978192505 4:105931113-105931135 GTACAGAAACTCAAGGAGGAGGG - Intronic
979324570 4:119363767-119363789 TTAGATAGTCCCAATGAGGAAGG + Intergenic
983242409 4:165248467-165248489 TTAGATAGTCCCAATGAGGAAGG + Intronic
986055304 5:4130685-4130707 ACAGATACACTCAGGGAGGATGG - Intergenic
987332590 5:16870247-16870269 AAAGATAAAGCAAAGAAGGAGGG - Intronic
987357597 5:17078427-17078449 AAAAATAAACCTAAGGAGGCCGG + Intronic
991699685 5:69305645-69305667 GTAGATAACCTCAAGGAGCACGG - Intronic
995528122 5:113066981-113067003 AAAGAGAGACCCAAGGAGAAAGG - Intronic
996278927 5:121703760-121703782 ATAATTAAAGCCAAGGAGCAAGG - Intergenic
998416096 5:141947050-141947072 ATAGATAAACAAAAAGAGAATGG - Intronic
999729616 5:154466904-154466926 TTAGATAAACCCCAGTAGGCAGG - Intergenic
1000132832 5:158316585-158316607 ATATATAAGACCAAGGAGTAAGG + Intergenic
1000133214 5:158319905-158319927 ATAGAAAATCACAGGGAGGAGGG - Intergenic
1001329423 5:170751933-170751955 AGAGAGATACTCAAGGAGGAGGG + Intergenic
1004077758 6:12360802-12360824 ATAAATGAACATAAGGAGGAAGG + Intergenic
1004484337 6:16051689-16051711 ATAGATAAACCTAGGAAAGAAGG - Intergenic
1007194353 6:40047648-40047670 TTAAATGAACCCAAGGAGAAAGG - Intergenic
1007785888 6:44279121-44279143 ATGAATCAGCCCAAGGAGGATGG + Exonic
1008310201 6:49959215-49959237 ATAAATATAGCCAAGGAAGAAGG - Intergenic
1008336035 6:50306028-50306050 ATAGACAAACCCTAGCAGAATGG + Intergenic
1010769469 6:79812101-79812123 TTAGGTAAACCCAGGGAGGAGGG - Intergenic
1011330978 6:86206241-86206263 GTAGATAACCTCAAGGAGCATGG + Intergenic
1011713179 6:90075990-90076012 ACAGATAAACCCAAAAAGGCTGG + Intronic
1011714514 6:90090833-90090855 ATAGGAAAACCCCAGAAGGAAGG - Intronic
1015447021 6:133317944-133317966 ATGGATCAACGGAAGGAGGATGG - Intronic
1016654318 6:146500382-146500404 GTAGATAACCTCAAGGAGCACGG - Intergenic
1017577851 6:155825483-155825505 ATAGATGGACCTAAGGAGGAGGG + Intergenic
1018498654 6:164378717-164378739 ATAAATAATCCCAAAAAGGATGG - Intergenic
1021909941 7:25375478-25375500 ATAGAGAAACCCAGAGAGGCTGG - Intergenic
1022309005 7:29177621-29177643 ATAGATAAACAGATGGAAGAAGG - Intronic
1024536897 7:50443197-50443219 ATAGCTAGACCCAAGAAGGTGGG + Intergenic
1024548813 7:50543479-50543501 ATTGCTAAACCCAAGGATGGTGG + Intronic
1024798852 7:53052285-53052307 ATAGATAAAATCATGGAAGATGG - Intergenic
1024864088 7:53882868-53882890 TAAAATAAACCTAAGGAGGATGG + Intergenic
1028555536 7:92119632-92119654 AACAATAAACCCAGGGAGGAGGG + Intronic
1030078478 7:105757286-105757308 AAAGATAATCACAAGAAGGATGG + Intronic
1030370724 7:108696346-108696368 TTAGATTAGCCCAAGGAGTAAGG + Intergenic
1030488075 7:110196489-110196511 AAAGAAAAGCCCAAGGAGGGTGG + Intergenic
1030620837 7:111789543-111789565 AGAGATAAAGACAAGGGGGAAGG + Intronic
1030942417 7:115670499-115670521 ATAGTTACACAGAAGGAGGAAGG + Intergenic
1031464586 7:122092850-122092872 ATAGATAAAGCCAAGGAAGTGGG - Exonic
1033837254 7:145330462-145330484 AGAGATAAACCCAAAGATAAAGG + Intergenic
1033848030 7:145459063-145459085 GCAGATAAAACCAAGGAGAAGGG - Intergenic
1037091698 8:14927589-14927611 AAAGGAAAAACCAAGGAGGAAGG + Intronic
1037508594 8:19557805-19557827 AAACATAAACCCCATGAGGAAGG + Intronic
1038114508 8:24538212-24538234 ATGGAAAAATCCAAGGAAGAGGG + Intergenic
1038147281 8:24910251-24910273 ATAAAAAAATGCAAGGAGGATGG - Intergenic
1038883547 8:31639851-31639873 ATAAATAAATAAAAGGAGGAGGG + Intronic
1039835159 8:41250063-41250085 ACAGAGAAATGCAAGGAGGATGG + Intergenic
1041242566 8:55860789-55860811 ATACAGAAACCCAAGCGGGAGGG - Intergenic
1041880297 8:62741918-62741940 AAAAATAAAACCAAGTAGGAGGG - Intronic
1042181475 8:66091959-66091981 ATAGGTAAATCCAAAGAGGCGGG + Intronic
1042817623 8:72894871-72894893 ATAGATAGACCCCAGATGGAAGG + Intronic
1045937056 8:107692152-107692174 ATAAATAAACTGAAAGAGGAAGG + Intergenic
1046614922 8:116465585-116465607 ATAAATAAACTGAAGCAGGAGGG + Intergenic
1047054313 8:121147175-121147197 TTAGGTAAACTGAAGGAGGAAGG - Intergenic
1047183535 8:122612000-122612022 GTAGATTAAAACAAGGAGGAGGG - Intergenic
1047587408 8:126288509-126288531 ATAGATAAGACAATGGAGGATGG + Intergenic
1048015972 8:130498336-130498358 ATAAATAAATAAAAGGAGGAGGG - Intergenic
1048172490 8:132121122-132121144 AGAGACAAACCCAGGGAGCAAGG + Exonic
1048342968 8:133555021-133555043 GTAGAAAAACCCAAGTAGGCTGG - Intronic
1048724572 8:137368232-137368254 ATATATAATCCCAAGTAGAAAGG - Intergenic
1049357541 8:142196167-142196189 AAAGCCAAACCCAAGGATGAAGG + Intergenic
1049400819 8:142426469-142426491 ATAGCTAAACCCAAGGCTGGCGG - Intergenic
1049782294 8:144434559-144434581 AAAGTCAAACCCAAGGAGGAGGG - Intronic
1050574035 9:6974016-6974038 ATTGAAAAACCCAAAGAGGCTGG + Intronic
1051099538 9:13505314-13505336 AAAAACAAAGCCAAGGAGGAAGG + Intergenic
1051872538 9:21755114-21755136 ATAATGAAAACCAAGGAGGAGGG - Intergenic
1054153142 9:61621439-61621461 ATAGCCAAATCCAAGAAGGAAGG + Intergenic
1055783512 9:79845811-79845833 ATAGGAAAACCCAAGGAGAGGGG + Intergenic
1056500503 9:87203964-87203986 GTAGAGGAACCAAAGGAGGATGG + Intergenic
1056691300 9:88810863-88810885 AAAGAAAAAAACAAGGAGGAAGG - Intergenic
1056724728 9:89104730-89104752 ATAGATAAACTGAGGAAGGATGG - Intronic
1057394482 9:94667535-94667557 ACAGAGAAACCAAAAGAGGACGG + Intergenic
1058874212 9:109228875-109228897 ATAGATAATCCGAAAGAGAAAGG - Intronic
1059243345 9:112827404-112827426 AAAGATAAACCCAGGAAGCATGG + Intronic
1060241686 9:121909340-121909362 GTAGATAATCTCAAGGAGCACGG - Intronic
1060880293 9:127113307-127113329 AAAGAGAAGCCCAAGGAGCATGG - Intronic
1061013371 9:127968214-127968236 GTTGATTCACCCAAGGAGGAAGG + Intronic
1061676997 9:132223188-132223210 AGAGAAGACCCCAAGGAGGAAGG + Intronic
1061894498 9:133640119-133640141 AGAGAGAAAGCCAAGGAGGATGG + Intronic
1186456873 X:9716645-9716667 AAAAAAAATCCCAAGGAGGAGGG - Exonic
1186629405 X:11333147-11333169 TTAAATAAATCCAAGTAGGATGG + Intronic
1187622708 X:21076246-21076268 ACAGGTAAATCTAAGGAGGAGGG - Intergenic
1187740466 X:22350000-22350022 AAAGATAATACCAAAGAGGATGG - Intergenic
1189023328 X:37365323-37365345 GTAGATAACCTCAAGGAGCATGG + Intronic
1189992659 X:46609402-46609424 ATAGTAAAACCCACGGAGGCTGG + Intronic
1191690851 X:63936307-63936329 AGAGAAAATCCCAAGGAGAAGGG - Intergenic
1191877180 X:65808991-65809013 ATAACTCAACCCATGGAGGATGG + Intergenic
1192985166 X:76391147-76391169 ATAGATAAACGAAAGAAAGAGGG - Intergenic
1194650308 X:96506376-96506398 ATAATTAAACCCAATGAGGGAGG + Intergenic
1194922720 X:99787092-99787114 ATAAATAAACACATAGAGGAGGG - Intergenic
1197712504 X:129681635-129681657 AGAGATAAAGCAAAGGAGGTGGG + Intergenic
1200158295 X:153990023-153990045 GTAGAGAAACACAAGGAGGCTGG - Intergenic
1200748039 Y:6919568-6919590 ATAGATAAAGACCAAGAGGAAGG - Intronic
1201556128 Y:15266052-15266074 ATACAAAAACCCTAGGAGGTGGG + Intergenic