ID: 1079073401

View in Genome Browser
Species Human (GRCh38)
Location 11:17367707-17367729
Sequence CTGAGGATAAGGGGCTATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079073392_1079073401 -9 Left 1079073392 11:17367693-17367715 CCTACCCGTGTTCCCTGAGGATA 0: 1
1: 0
2: 1
3: 7
4: 80
Right 1079073401 11:17367707-17367729 CTGAGGATAAGGGGCTATCAGGG 0: 1
1: 0
2: 0
3: 10
4: 120
1079073386_1079073401 23 Left 1079073386 11:17367661-17367683 CCTGCCAGTTGCTAGGGGAATGG 0: 1
1: 0
2: 0
3: 10
4: 119
Right 1079073401 11:17367707-17367729 CTGAGGATAAGGGGCTATCAGGG 0: 1
1: 0
2: 0
3: 10
4: 120
1079073390_1079073401 19 Left 1079073390 11:17367665-17367687 CCAGTTGCTAGGGGAATGGGGAC 0: 1
1: 0
2: 1
3: 23
4: 204
Right 1079073401 11:17367707-17367729 CTGAGGATAAGGGGCTATCAGGG 0: 1
1: 0
2: 0
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079073401 Original CRISPR CTGAGGATAAGGGGCTATCA GGG Intronic
900204551 1:1426470-1426492 CTGAGGACAAGGGGCAATTCTGG - Intronic
903490264 1:23723050-23723072 CTGAAGTCAAGGGGCTATCCTGG - Intergenic
905779419 1:40694713-40694735 ATGGGTATAAGGGGCTAACATGG - Intronic
906038423 1:42767293-42767315 GGGAGGATAAGGCGCTGTCATGG + Exonic
906100288 1:43255951-43255973 CTGGGGATGAGGGGCCAGCAGGG + Intronic
906256193 1:44352519-44352541 CTCAGGATAATGGGCTATTCTGG + Intronic
907179491 1:52557089-52557111 CTGAAGTTAATGGGCAATCATGG + Intergenic
909251610 1:73364136-73364158 CTGAGGATGAGGGGTTAAGAGGG - Intergenic
909253349 1:73386334-73386356 GTGAGGATGAGGGGCAATGAGGG - Intergenic
911832895 1:102577236-102577258 CTGAGAATATTGGGCTAGCAAGG - Intergenic
913660735 1:121004532-121004554 CTGAGGCCAAAGGGCTAGCAAGG + Intergenic
914012098 1:143787688-143787710 CTGAGGCCAAAGGGCTAGCAAGG + Intergenic
914165733 1:145173446-145173468 CTGAGGCCAAAGGGCTAGCAAGG - Intergenic
914650729 1:149696351-149696373 CTGAGGCCAAAGGGCTAGCAAGG + Intergenic
917081736 1:171262758-171262780 ATGAGGATAGGGGCCTGTCAGGG - Intronic
918626256 1:186659135-186659157 CTGAGGAGAAGGTGGTATGATGG - Intergenic
1062801574 10:385050-385072 CTGAGGAGAAGCAGCTCTCAGGG + Intronic
1067950164 10:50727937-50727959 CTGAGGATGAGAGGCTAGCAGGG - Intergenic
1070885488 10:79893143-79893165 CTGAGGAGGAGAGGCTAGCAGGG - Intergenic
1071562504 10:86655161-86655183 CTGAGGACAAGGGGCTGGAATGG + Intronic
1071956711 10:90768294-90768316 CTGAGGATAATGGGTTAGGAAGG - Intronic
1073488378 10:103836242-103836264 CTGATCATAGGGGGCTCTCAAGG + Intronic
1077662554 11:4082646-4082668 CTGGGGCAAAAGGGCTATCAAGG + Intronic
1079073401 11:17367707-17367729 CTGAGGATAAGGGGCTATCAGGG + Intronic
1079812143 11:25008481-25008503 CAGCGAATAAGGGCCTATCACGG + Intronic
1083855216 11:65389884-65389906 CTGAGGACAAGGTGAAATCATGG - Intronic
1089588342 11:119524052-119524074 CTGAGGACAAGGGGGCATCCTGG + Intergenic
1089820650 11:121223035-121223057 ATGAGGACAAGGGGGTGTCATGG - Intergenic
1090560813 11:127930018-127930040 CTGGGGTTAAGGGGCTGTCCCGG - Intergenic
1090970451 11:131637974-131637996 CTGAGGACATGGGGCTATGGAGG - Intronic
1093959535 12:25257064-25257086 GTGAGGATAAGGGTCTTGCATGG - Intergenic
1094030745 12:26009155-26009177 GTTAGGATAAGGGACTATCTGGG + Intronic
1097269932 12:57767653-57767675 TTGAGGATAAGGGGGTCTCTTGG + Intronic
1102415581 12:112759703-112759725 CTCAGTATCAGGGGCTATGAAGG + Intronic
1105787436 13:23763350-23763372 CTGATGATAAGCGTCTCTCAGGG + Intronic
1105836866 13:24219928-24219950 CTCAGGATATGGGACTTTCAGGG - Intronic
1106602723 13:31200744-31200766 CTGAGGATAAGCGGCCAGCTCGG + Intronic
1114875749 14:26715932-26715954 CTGAGGATGCGGGGCTTTCTAGG - Intergenic
1115548459 14:34484118-34484140 CTGAAGCTCAGGGGCTAGCACGG - Intergenic
1117164824 14:53022873-53022895 CTGAGGATAAGGGATGATCAGGG - Intergenic
1118208718 14:63747309-63747331 CTGAGGATAGGAGGCCTTCAGGG - Intergenic
1134271649 16:12737996-12738018 CTGGGGATAAGTGGTTAACACGG + Intronic
1134813804 16:17189303-17189325 CTGAGGTCCAGGGGCTAGCATGG + Intronic
1142171971 16:88627715-88627737 CTGAGGACACGGGGCTAGCCAGG - Exonic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1143173285 17:4942540-4942562 CAGAGGACAAGGAGCCATCATGG - Intronic
1144511782 17:15883124-15883146 CTAAGGATAAGAGGTTAACAGGG + Intergenic
1146481325 17:33207130-33207152 CTGAGGAGAAGGGCTTATAAAGG + Intronic
1146771088 17:35569187-35569209 CTGAGTAAAAGGCGCTTTCATGG - Intergenic
1148046398 17:44747637-44747659 CTGAGGATAAGGGGAAAGGAAGG - Intronic
1148624833 17:49061431-49061453 ATGAGCATGAGGGGCTTTCAGGG - Intergenic
1151170511 17:72241871-72241893 CTGAGTTTGAGGGGCTTTCACGG - Intergenic
1155326399 18:24669286-24669308 CAGAGGAGAAGAGGCTATAATGG - Intergenic
1156683937 18:39621752-39621774 CTCAGGAGAAGGGGCAATCAAGG - Intergenic
1160100897 18:75918125-75918147 CTGTGGACCAGGGGCTCTCAAGG + Intergenic
1160435321 18:78847650-78847672 CTGAGGAGAAGGTTCTAGCAAGG - Intergenic
1160697873 19:493427-493449 CTGAGGGGAAGGGGCTGTGAGGG - Intronic
1162740879 19:12772913-12772935 CTGGGGAGAAGGGGGTGTCAGGG + Intronic
1165897281 19:39150379-39150401 CTGAGGATGAGGTGGTGTCAAGG - Intronic
1165944969 19:39436470-39436492 CTGAGGGGAAGGGGCTCTGAGGG - Intronic
1167771180 19:51519914-51519936 CTGAGAACAAGGTGTTATCAGGG - Exonic
925215825 2:2095211-2095233 CTGGGGAAAAGGGGCTTTCTGGG + Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
934071546 2:88389000-88389022 CTGATGATAATGGGCTAGAAGGG + Intergenic
936010892 2:108924688-108924710 CTGAGGATAAAGGGCTTTGAGGG - Intronic
936532446 2:113285855-113285877 CTGGGGAGAAGGGGCAATGAGGG + Intergenic
936707231 2:115088984-115089006 CTGAGGATGAGGGGCCAACCTGG - Intronic
938990018 2:136618159-136618181 GTGAGGAAAAGGGGCTGTCCTGG - Intergenic
939095525 2:137829412-137829434 CTGAGGAGAAGGAGCCTTCAGGG - Intergenic
941036426 2:160574058-160574080 CTGAGGATAAGGCTCTTTCGAGG - Intergenic
942822269 2:180128262-180128284 CTGTGGATAAAATGCTATCAAGG - Intergenic
943878333 2:193102596-193102618 CTGGGGATAAGGGGCCTTCCTGG + Intergenic
1172929814 20:38578230-38578252 CTCAGGAAAAGAGGCTGTCATGG - Exonic
1173050195 20:39551943-39551965 CTGATGAAAAGGGGCTATGGTGG - Intergenic
1173578144 20:44126485-44126507 CTGGGGATGAGGGGCTATTTTGG - Intronic
1174516837 20:51099093-51099115 CTGAGGATGAGGCTCCATCAGGG + Intergenic
1174768126 20:53272912-53272934 CTGAGAATGAGGGGCTACCAAGG + Intronic
1178213592 21:30567780-30567802 TTGCTGATAAGGGGCCATCAAGG + Intergenic
1180044710 21:45299950-45299972 CTCAGGACAAGGGGCTCTTATGG + Intergenic
1182281150 22:29218398-29218420 CTGTGGAGAAGGGGCTAGAATGG + Intronic
1183380210 22:37486797-37486819 CAGAGGTTAAGAGGTTATCACGG - Intergenic
953741816 3:45544993-45545015 CAGAGGACAGGGGGCTACCAGGG + Intronic
960026059 3:113011486-113011508 CTGAAAATAAATGGCTATCAAGG + Intronic
960227999 3:115189672-115189694 GTAAGGATCAGGGACTATCATGG + Intergenic
963484174 3:145915525-145915547 CTGAGGATAAGTGGCAATATGGG - Intergenic
964653728 3:159043126-159043148 CTGAGAATAAGGGGCAACAAGGG + Intronic
965053173 3:163678264-163678286 CTGAGGATAAGCTGATATGATGG + Intergenic
968836929 4:2972000-2972022 CTGAGGGTTAGGGGCTAACTGGG + Intronic
969422388 4:7104874-7104896 CTGAGGACAAGGGCCTGTCAGGG + Intergenic
969459136 4:7318680-7318702 CTGTGGATAAGGGGCTGTGTGGG - Intronic
971444785 4:26731554-26731576 CTGAGGATACTGGGCTTTTAAGG + Intronic
973700016 4:53527755-53527777 CAGGGGAAAAGGGGCTACCAGGG + Intronic
976017034 4:80568805-80568827 CTGAGGGTTGAGGGCTATCAAGG + Intronic
977938566 4:102833459-102833481 CTTAGTATAAGTGGGTATCAAGG + Intronic
980873366 4:138635493-138635515 CTGAGAATATGCAGCTATCATGG - Intergenic
983702638 4:170616518-170616540 CTGAGTATAATGGGAAATCATGG - Intergenic
986018550 5:3779599-3779621 CCTAGGAAAAGGGGCTACCACGG - Intergenic
986452764 5:7882476-7882498 CTGTGGATAAGTGGCTATATGGG - Intronic
986739248 5:10691679-10691701 CTGAGGATATGGGGCGGGCAGGG - Intronic
990380086 5:55214278-55214300 ATGAGGATAAAGGGCTAACAAGG + Intergenic
995494175 5:112723994-112724016 CAGAGGATGAGGAGCTATCTGGG + Intronic
995732666 5:115262819-115262841 CTGAGGATGAGAGGCTAGCAGGG - Exonic
997136214 5:131329166-131329188 CTGTGGCTAAGGGGCAATCAAGG + Intronic
997829789 5:137140013-137140035 CTGGGGAAAAGAGGATATCAGGG + Intronic
998249201 5:140538947-140538969 CTGAGGATGAGAGGGTATTATGG - Exonic
999016105 5:148107204-148107226 CTGAGACTCAGGGGCGATCATGG - Intronic
1000189505 5:158896174-158896196 TTGAGGATAAAGAGCTTTCAAGG + Intronic
1004349156 6:14875959-14875981 CTGAGTTTAAGGGGCTTTCCTGG - Intergenic
1005267624 6:24128725-24128747 CTGTGGAAAAGTGGCTATAATGG + Intronic
1006104837 6:31710329-31710351 CTGGGGAGAAGGAGCCATCAGGG - Intronic
1010033262 6:71291014-71291036 GGGAAGATAAGGGGTTATCAAGG + Intronic
1012083697 6:94794580-94794602 GTGAGGAGTAGGGGCAATCAAGG + Intergenic
1022904895 7:34846237-34846259 CTGATGATAAAGGGCTATGCAGG - Intronic
1023465225 7:40447403-40447425 CTGAAGATAAGAGACTTTCATGG + Intronic
1024032581 7:45476088-45476110 CAGAGGTTGGGGGGCTATCAGGG + Intergenic
1024230472 7:47359928-47359950 CAGAGGAGAAGGTGCTATCTGGG - Intronic
1024296402 7:47846431-47846453 CTGAAGATGAGGGACTCTCAGGG + Intronic
1034233103 7:149548027-149548049 CTGAGGATAAGGGTTAATGAGGG - Intergenic
1040602921 8:48902262-48902284 CTGAGGGTGAGGGGCCATCCGGG - Intergenic
1041381029 8:57254527-57254549 ATGAGGTTGAGGGGCTATAAGGG - Intergenic
1045167331 8:99621301-99621323 ATAAGGATGAAGGGCTATCAAGG + Intronic
1048805307 8:138235693-138235715 CAGAGGAGAAGGGGCTGTCATGG + Intronic
1051516224 9:17933274-17933296 CAGAGGAGAAGGTGCTATAAAGG - Intergenic
1058400785 9:104616682-104616704 CTGAGTATTTGGGACTATCAAGG - Intergenic
1061284453 9:129614082-129614104 CTGGCCATAAGGAGCTATCATGG - Intronic
1187161257 X:16767444-16767466 CTGAGGAAAAGTTGGTATCAGGG + Intergenic
1192675545 X:73192226-73192248 TTGAGGCTCAGGGGATATCATGG - Intergenic
1196738946 X:119007251-119007273 CTGATGATAAGGGAACATCAGGG - Intronic
1198550889 X:137743737-137743759 CTGAGGATAATCAGATATCAAGG + Intergenic
1200231681 X:154446917-154446939 GTGAGAACAAGGGGCTGTCAGGG + Intronic
1201227657 Y:11833878-11833900 CTGAGGTAAAGCGGCTAACAAGG + Intergenic