ID: 1079073855

View in Genome Browser
Species Human (GRCh38)
Location 11:17371166-17371188
Sequence TTCTACTGGACAGCATATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079073851_1079073855 21 Left 1079073851 11:17371122-17371144 CCAATGAATTTAAGCATTCCCTC 0: 1
1: 0
2: 2
3: 17
4: 179
Right 1079073855 11:17371166-17371188 TTCTACTGGACAGCATATTATGG 0: 1
1: 0
2: 1
3: 9
4: 98
1079073850_1079073855 22 Left 1079073850 11:17371121-17371143 CCCAATGAATTTAAGCATTCCCT 0: 1
1: 0
2: 6
3: 33
4: 348
Right 1079073855 11:17371166-17371188 TTCTACTGGACAGCATATTATGG 0: 1
1: 0
2: 1
3: 9
4: 98
1079073853_1079073855 2 Left 1079073853 11:17371141-17371163 CCTCTATGAGACAAACTAGTTTT 0: 1
1: 0
2: 2
3: 15
4: 198
Right 1079073855 11:17371166-17371188 TTCTACTGGACAGCATATTATGG 0: 1
1: 0
2: 1
3: 9
4: 98
1079073852_1079073855 3 Left 1079073852 11:17371140-17371162 CCCTCTATGAGACAAACTAGTTT 0: 1
1: 0
2: 2
3: 17
4: 163
Right 1079073855 11:17371166-17371188 TTCTACTGGACAGCATATTATGG 0: 1
1: 0
2: 1
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079073855 Original CRISPR TTCTACTGGACAGCATATTA TGG Intronic
902245499 1:15118029-15118051 TACTACTGCACAGCACTTTATGG + Exonic
908257260 1:62313293-62313315 TACTACTGTACTGCATTTTATGG + Intronic
913575180 1:120165302-120165324 TTCTCCTGGACTGTAAATTAAGG - Intronic
913824552 1:123128748-123128770 TTCTTCTGTCCAGCATAATATGG - Intergenic
918756932 1:188349871-188349893 CTCTAGTGTACAGAATATTAAGG - Intergenic
918822266 1:189270196-189270218 TTCTGCTGGGAAGCATATTGTGG - Intergenic
920173420 1:204085422-204085444 CTCTTCTTGAGAGCATATTAAGG + Intronic
923053665 1:230407396-230407418 TCCTCCTGGAAACCATATTACGG + Intronic
1066779061 10:38923117-38923139 TTATACTGCACATCATATAAAGG - Intergenic
1068234444 10:54215321-54215343 TTCTACTGGGCAGTAAATGAGGG + Intronic
1070120990 10:73576880-73576902 TTCTCTTGGACTGCATGTTAAGG - Intronic
1072527965 10:96290834-96290856 TTTAACTGCACAGCATATTATGG + Intergenic
1073846279 10:107558851-107558873 GTCATCTGGACAGCATCTTATGG - Intergenic
1078128522 11:8592933-8592955 TACTACTGGACAACAGATCATGG + Intronic
1078696648 11:13639755-13639777 TTGTACTGGACAGTATAGTCAGG - Intergenic
1078851080 11:15164613-15164635 ATTTACTGGAAAGCATAGTATGG - Intronic
1078874207 11:15377574-15377596 TTCTAGAGGACATAATATTAAGG + Intergenic
1079073855 11:17371166-17371188 TTCTACTGGACAGCATATTATGG + Intronic
1096737795 12:53669461-53669483 TTCTACTTGCCAGCATTTTAGGG - Intronic
1098540969 12:71657297-71657319 TTTGGCTGAACAGCATATTAAGG + Exonic
1099625750 12:85071338-85071360 TTTTACTTAACAACATATTATGG + Intronic
1100401687 12:94236089-94236111 TTATACTTGACTGCATTTTATGG - Intronic
1100866636 12:98864732-98864754 TTTTACTGGACACAGTATTAGGG - Intronic
1102526681 12:113517141-113517163 TTGTACTGTACAGTATATAAAGG - Intergenic
1107059149 13:36136792-36136814 TTCTATTTGAAAGCATTTTAGGG - Intergenic
1107966451 13:45602525-45602547 TTCTACATGACAGCCTTTTAAGG + Intronic
1111404369 13:87783374-87783396 TCCACCTGTACAGCATATTATGG + Intergenic
1112205995 13:97323988-97324010 TACTATTTGACAGCATAATAGGG - Intronic
1116514250 14:45786696-45786718 CTCTGCTGGGCAGCATATTATGG + Intergenic
1118244223 14:64093046-64093068 TTATTCTGGAAAGCATTTTATGG - Intronic
1118588636 14:67382305-67382327 TTCTACAGGACAGTAATTTAGGG - Intronic
1120672258 14:87376026-87376048 TTCTGCTGGGCCACATATTATGG + Intergenic
1125885731 15:43227839-43227861 TGCTAATGGACAGGATATCAGGG + Intergenic
1127664100 15:61127997-61128019 TTCTACTGGACTGCATAATTAGG - Intronic
1147207889 17:38851761-38851783 ATCTACTGGACAGCATCGTGGGG + Intronic
1147348136 17:39818077-39818099 TTAGACTGTACAGCATGTTATGG + Intronic
1149298535 17:55283483-55283505 TTCTACTGGGCAGCAGATCAAGG + Intronic
1155044578 18:22092802-22092824 TTATCCTGGACAGCTTATGATGG + Intronic
1156937033 18:42722102-42722124 GTCTCCTGAACAGCATCTTAGGG - Intergenic
1158545489 18:58392757-58392779 TTCTACTGGCCTCCATATGAAGG + Intronic
924966877 2:85484-85506 TTCTACTGAACAGAATCTTGGGG + Intergenic
929012987 2:37465370-37465392 TTCTTCTAGACAGTATATAATGG + Intergenic
931447905 2:62342289-62342311 ATCCACAGGACAGCATACTATGG + Intergenic
931928737 2:67105004-67105026 TTCTACTGAACAGCATAAAAAGG + Intergenic
933296796 2:80500131-80500153 TTCTTCTGGGCTGCATAATATGG - Intronic
936808742 2:116370300-116370322 TTTTAATGCACAGAATATTATGG + Intergenic
939501116 2:142986100-142986122 TCCTATTGGATAGCATCTTAAGG - Intronic
939555583 2:143669227-143669249 TTCTACTGGGCAGCTGAATAAGG - Intronic
940698998 2:157018115-157018137 TTCATCTAGACAGCATATAATGG + Intergenic
943288659 2:186040748-186040770 AGCTGCTGGAGAGCATATTAAGG - Intergenic
945996395 2:216440174-216440196 TTCCTATGGAAAGCATATTAAGG - Intronic
947037690 2:225877992-225878014 TTCTATTGGAATGCATCTTAAGG - Intergenic
1170362637 20:15563363-15563385 CTCTACTGGACTGGATATTAAGG - Intronic
1170598244 20:17821505-17821527 TTGTAGTGGACAGCACATGAAGG + Intergenic
1170736024 20:19014916-19014938 TTCTAGTTGACAGCCTGTTATGG - Intergenic
1170749046 20:19128865-19128887 TACTATTGGTCAGCATATAATGG + Intergenic
1183850955 22:40587564-40587586 GTCTACAGGTCATCATATTAAGG - Intronic
955190783 3:56759484-56759506 TTCTACTTGACAGTATCTTGAGG + Intronic
956911003 3:73816892-73816914 TCCTGCTGGACAGGATATGAGGG + Intergenic
957190195 3:76998168-76998190 TTATACTGGCCTACATATTAGGG + Intronic
957877610 3:86169477-86169499 TTGTCCTGATCAGCATATTAAGG - Intergenic
958887885 3:99748710-99748732 CTCTATTTGACAGCATCTTAGGG - Intronic
959855471 3:111150732-111150754 TTCAACTAAACAACATATTACGG + Intronic
965100407 3:164291444-164291466 TTAAACTGAACAGCATATTTTGG + Intergenic
966369620 3:179235056-179235078 TTCTTCTGGACAGTATTTAAAGG + Exonic
966515080 3:180810891-180810913 TTCTCATAGACAGCATATTATGG + Intronic
968406075 4:339987-340009 TTCTACTTGAGAGCTAATTATGG + Intronic
970184733 4:13438885-13438907 TTCTACTGGACAATATATGAGGG + Intronic
972336001 4:38107460-38107482 TTCTTCTGGCCAGAATATGAAGG - Intronic
978003735 4:103590778-103590800 TTGTACTGGTCAGCACATGAAGG - Intronic
981438063 4:144749664-144749686 CTCTACCTGACAGCATATTCTGG + Intergenic
982143171 4:152350325-152350347 TTCTTCTGGATAAAATATTAGGG - Intronic
982828875 4:160034889-160034911 TTCTACTGTATTGCATATTTTGG + Intergenic
984311686 4:178068510-178068532 TTCTACTGAAAAAAATATTAAGG + Intergenic
991313124 5:65268341-65268363 TGTTACTGAACAGGATATTAAGG - Intronic
993686547 5:90944826-90944848 TTCTTCTTGACAGCATTTAAAGG - Intronic
994037653 5:95221066-95221088 CTATGCTGGACAGCATATTTCGG - Intronic
996175152 5:120347341-120347363 GTCTCCTGGACAGCAGATAATGG + Intergenic
998563864 5:143198450-143198472 TTCAACAGGAAAGAATATTAAGG + Intronic
999547191 5:152642612-152642634 TTCCACTGGTCAGTATTTTAGGG + Intergenic
1002678492 5:180939288-180939310 TTCTTCTGGGCACCATATAATGG - Intronic
1016482914 6:144501866-144501888 TTCTACTTGACATCATGTTTTGG + Intronic
1017838883 6:158205249-158205271 TGCTACTGGACAGCACGTTTAGG + Intergenic
1019111658 6:169722410-169722432 TTTTACTGGTGAGCATTTTAAGG + Intronic
1020634375 7:10678650-10678672 TTCTACTAGTCAACATTTTAGGG - Intergenic
1023216256 7:37866339-37866361 TTCTACTGGACATCACTTTGTGG + Intronic
1023462340 7:40412377-40412399 TTGTATTGGACAGCACATTTTGG - Intronic
1027454384 7:78370294-78370316 TTCTACTTAACAGAATATCAAGG + Intronic
1027554022 7:79640365-79640387 TAATTCTGGAGAGCATATTAGGG - Intergenic
1028115355 7:86990899-86990921 TTCAACTGCAAAGCATCTTATGG + Intronic
1028382621 7:90215416-90215438 TTCAGCTGGACAGCCTCTTAAGG - Intronic
1028743616 7:94303730-94303752 TTCTTCTGAAAAGCATATAAAGG - Intergenic
1032810549 7:135410926-135410948 TTGTACAGAAAAGCATATTAAGG + Intronic
1041813810 8:61943321-61943343 TTCTAATAAATAGCATATTATGG - Intergenic
1041853329 8:62418922-62418944 TTCTGCTAGAGAACATATTAAGG - Intronic
1042068024 8:64900231-64900253 TCATACTGGACAGCAAATTCAGG + Intergenic
1042198500 8:66255732-66255754 TTCAAGTAGACAGCATATTTGGG + Intergenic
1042667185 8:71220155-71220177 CTCTACTGAACACCAAATTAGGG - Intronic
1043376819 8:79658887-79658909 ATCTACTGGACAGCTCTTTAAGG + Intronic
1044731810 8:95234689-95234711 TTTTACTAAACAGCATATCATGG - Intergenic
1048883203 8:138887112-138887134 TACTATTTGACAGCATAATAGGG - Intronic
1049847463 8:144810110-144810132 TTCTGCTGGGCAGTGTATTAGGG - Intronic
1054885550 9:70194120-70194142 TTCTACAGTACAGCATGGTATGG + Intronic
1058220199 9:102290271-102290293 ATCTACTTGAAAGCACATTAGGG - Intergenic
1058555054 9:106158358-106158380 TTCTTCTGGACAGCACATCCTGG - Intergenic
1060022445 9:120143667-120143689 TTGTACTGGTCAGCATATTATGG - Intergenic
1192965754 X:76174824-76174846 TACTACTGAATAGCAAATTAAGG - Intronic
1197130004 X:122994402-122994424 TTCCACATGACAGCATATTTGGG + Intergenic
1202128691 Y:21591003-21591025 CTCTACTGGACATCATTTTCAGG + Intergenic