ID: 1079076795

View in Genome Browser
Species Human (GRCh38)
Location 11:17389348-17389370
Sequence GGGCTCCCCCTGGCGGTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079076795_1079076810 9 Left 1079076795 11:17389348-17389370 CCGGGGACCGCCAGGGGGAGCCC No data
Right 1079076810 11:17389380-17389402 CGGAGCGCAGGGGGCGGGGCCGG No data
1079076795_1079076802 -2 Left 1079076795 11:17389348-17389370 CCGGGGACCGCCAGGGGGAGCCC No data
Right 1079076802 11:17389369-17389391 CCGACCTGCACCGGAGCGCAGGG No data
1079076795_1079076804 0 Left 1079076795 11:17389348-17389370 CCGGGGACCGCCAGGGGGAGCCC No data
Right 1079076804 11:17389371-17389393 GACCTGCACCGGAGCGCAGGGGG No data
1079076795_1079076803 -1 Left 1079076795 11:17389348-17389370 CCGGGGACCGCCAGGGGGAGCCC No data
Right 1079076803 11:17389370-17389392 CGACCTGCACCGGAGCGCAGGGG No data
1079076795_1079076800 -3 Left 1079076795 11:17389348-17389370 CCGGGGACCGCCAGGGGGAGCCC No data
Right 1079076800 11:17389368-17389390 CCCGACCTGCACCGGAGCGCAGG No data
1079076795_1079076807 4 Left 1079076795 11:17389348-17389370 CCGGGGACCGCCAGGGGGAGCCC No data
Right 1079076807 11:17389375-17389397 TGCACCGGAGCGCAGGGGGCGGG No data
1079076795_1079076808 5 Left 1079076795 11:17389348-17389370 CCGGGGACCGCCAGGGGGAGCCC No data
Right 1079076808 11:17389376-17389398 GCACCGGAGCGCAGGGGGCGGGG No data
1079076795_1079076806 3 Left 1079076795 11:17389348-17389370 CCGGGGACCGCCAGGGGGAGCCC No data
Right 1079076806 11:17389374-17389396 CTGCACCGGAGCGCAGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079076795 Original CRISPR GGGCTCCCCCTGGCGGTCCC CGG (reversed) Intergenic