ID: 1079076797

View in Genome Browser
Species Human (GRCh38)
Location 11:17389358-17389380
Sequence GGTGCAGGTCGGGCTCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079076797_1079076806 -7 Left 1079076797 11:17389358-17389380 CCAGGGGGAGCCCGACCTGCACC No data
Right 1079076806 11:17389374-17389396 CTGCACCGGAGCGCAGGGGGCGG No data
1079076797_1079076808 -5 Left 1079076797 11:17389358-17389380 CCAGGGGGAGCCCGACCTGCACC No data
Right 1079076808 11:17389376-17389398 GCACCGGAGCGCAGGGGGCGGGG No data
1079076797_1079076804 -10 Left 1079076797 11:17389358-17389380 CCAGGGGGAGCCCGACCTGCACC No data
Right 1079076804 11:17389371-17389393 GACCTGCACCGGAGCGCAGGGGG No data
1079076797_1079076807 -6 Left 1079076797 11:17389358-17389380 CCAGGGGGAGCCCGACCTGCACC No data
Right 1079076807 11:17389375-17389397 TGCACCGGAGCGCAGGGGGCGGG No data
1079076797_1079076810 -1 Left 1079076797 11:17389358-17389380 CCAGGGGGAGCCCGACCTGCACC No data
Right 1079076810 11:17389380-17389402 CGGAGCGCAGGGGGCGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079076797 Original CRISPR GGTGCAGGTCGGGCTCCCCC TGG (reversed) Intergenic