ID: 1079076800

View in Genome Browser
Species Human (GRCh38)
Location 11:17389368-17389390
Sequence CCCGACCTGCACCGGAGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079076796_1079076800 -10 Left 1079076796 11:17389355-17389377 CCGCCAGGGGGAGCCCGACCTGC No data
Right 1079076800 11:17389368-17389390 CCCGACCTGCACCGGAGCGCAGG No data
1079076795_1079076800 -3 Left 1079076795 11:17389348-17389370 CCGGGGACCGCCAGGGGGAGCCC No data
Right 1079076800 11:17389368-17389390 CCCGACCTGCACCGGAGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079076800 Original CRISPR CCCGACCTGCACCGGAGCGC AGG Intergenic
No off target data available for this crispr