ID: 1079076803

View in Genome Browser
Species Human (GRCh38)
Location 11:17389370-17389392
Sequence CGACCTGCACCGGAGCGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079076795_1079076803 -1 Left 1079076795 11:17389348-17389370 CCGGGGACCGCCAGGGGGAGCCC No data
Right 1079076803 11:17389370-17389392 CGACCTGCACCGGAGCGCAGGGG No data
1079076796_1079076803 -8 Left 1079076796 11:17389355-17389377 CCGCCAGGGGGAGCCCGACCTGC No data
Right 1079076803 11:17389370-17389392 CGACCTGCACCGGAGCGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079076803 Original CRISPR CGACCTGCACCGGAGCGCAG GGG Intergenic