ID: 1079079601

View in Genome Browser
Species Human (GRCh38)
Location 11:17405109-17405131
Sequence CAAGGTAAACTCCCTGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079079597_1079079601 13 Left 1079079597 11:17405073-17405095 CCTTTATTATAGGCACGTATCTC 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1079079601 11:17405109-17405131 CAAGGTAAACTCCCTGAGGTAGG 0: 1
1: 0
2: 1
3: 24
4: 170
1079079594_1079079601 23 Left 1079079594 11:17405063-17405085 CCTTGCTCTCCCTTTATTATAGG 0: 1
1: 0
2: 0
3: 20
4: 147
Right 1079079601 11:17405109-17405131 CAAGGTAAACTCCCTGAGGTAGG 0: 1
1: 0
2: 1
3: 24
4: 170
1079079596_1079079601 14 Left 1079079596 11:17405072-17405094 CCCTTTATTATAGGCACGTATCT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1079079601 11:17405109-17405131 CAAGGTAAACTCCCTGAGGTAGG 0: 1
1: 0
2: 1
3: 24
4: 170
1079079592_1079079601 28 Left 1079079592 11:17405058-17405080 CCCGGCCTTGCTCTCCCTTTATT 0: 1
1: 1
2: 2
3: 40
4: 476
Right 1079079601 11:17405109-17405131 CAAGGTAAACTCCCTGAGGTAGG 0: 1
1: 0
2: 1
3: 24
4: 170
1079079593_1079079601 27 Left 1079079593 11:17405059-17405081 CCGGCCTTGCTCTCCCTTTATTA 0: 1
1: 0
2: 2
3: 28
4: 386
Right 1079079601 11:17405109-17405131 CAAGGTAAACTCCCTGAGGTAGG 0: 1
1: 0
2: 1
3: 24
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079079601 Original CRISPR CAAGGTAAACTCCCTGAGGT AGG Intronic
901768981 1:11521074-11521096 GAATGTGAACTCCCTGAGCTTGG - Intronic
902797029 1:18806689-18806711 GAAGGTAAGCTCCGTGAGGGAGG - Intergenic
903300881 1:22378076-22378098 CAAGGGAAACTCCCTGGAGGGGG - Intergenic
905392914 1:37649735-37649757 GAAGGTAAACTCCATGAGGGCGG - Intergenic
909103568 1:71380790-71380812 CAAGTTCAAATACCTGAGGTGGG + Intergenic
910185425 1:84534425-84534447 TAAAGGAAACTCCATGAGGTAGG + Intergenic
912496095 1:110092685-110092707 CAGGACAAAGTCCCTGAGGTGGG - Intergenic
912797029 1:112699609-112699631 GAAGGCAAGCTCCCTGGGGTAGG + Intronic
914434524 1:147648227-147648249 GAAGGTAATACCCCTGAGGTGGG - Exonic
915286018 1:154852863-154852885 CAAGGTGAAGGCCCTGAGGGGGG - Intronic
915721808 1:157991452-157991474 AAAGGCAAAAACCCTGAGGTAGG - Intergenic
917118869 1:171628459-171628481 GAATGTAAACTCCATGGGGTAGG - Intergenic
918405893 1:184211769-184211791 AAAGTTAAACTCCCAGAGTTGGG + Intergenic
920435621 1:205944992-205945014 CACCGTGAACTCCCTGAGGAGGG + Intergenic
920570428 1:207012596-207012618 CAAGGTAGAGTCCCAGAGCTGGG + Intronic
921224614 1:213005842-213005864 CAAGGGAAAGGCCCTGAGGTTGG - Intronic
924853629 1:247855467-247855489 CAAGGTAAACTTCAGCAGGTGGG - Intergenic
1065856851 10:29838300-29838322 AAAAGTAAACTCCTTGAGGAAGG - Intergenic
1069410264 10:68146204-68146226 CAATGTAGACAGCCTGAGGTGGG - Intronic
1069612065 10:69780520-69780542 CAAGGTGAACTCCAGAAGGTGGG + Intergenic
1070497586 10:77038472-77038494 AAACACAAACTCCCTGAGGTTGG - Intronic
1072756644 10:98025913-98025935 CAAAGTGAAAACCCTGAGGTGGG + Intronic
1074866906 10:117549789-117549811 CAAACTAAACTCCCTCAGGAGGG - Intergenic
1075718877 10:124573667-124573689 TAAGGTACAGTCCCTGAAGTGGG + Intronic
1076144902 10:128110374-128110396 CAACCAAAACTCTCTGAGGTGGG + Exonic
1079069311 11:17329230-17329252 CAAGCTGCACTGCCTGAGGTTGG + Intronic
1079079601 11:17405109-17405131 CAAGGTAAACTCCCTGAGGTAGG + Intronic
1079364072 11:19793829-19793851 CAAGGCAAAGGCCCTGAGGTGGG - Intronic
1080687455 11:34527030-34527052 GAAGGTAAGCTCCATGAGTTGGG + Intergenic
1081137357 11:39454983-39455005 CAATATAAACTCCTTGAGGGTGG - Intergenic
1081718782 11:45271012-45271034 GATGGTAAACTCTCTGAGGGTGG - Intronic
1082931363 11:58609867-58609889 CAATGGAAACTTCCTGAGGGAGG - Exonic
1083446242 11:62709628-62709650 TACGGTAAACTCCGTGACGTGGG - Intronic
1084945482 11:72636060-72636082 CAAGGCCAACTCCCTTAGGGTGG + Intronic
1085376826 11:76071333-76071355 AAGGGCAAAGTCCCTGAGGTAGG + Intronic
1085470336 11:76753533-76753555 CAAAGGCAACTCCCTGAGGAGGG + Intergenic
1085925843 11:81019574-81019596 TAAGGTAAATTCACAGAGGTTGG + Intergenic
1086221594 11:84451698-84451720 CAATGTAAGCTCCATGAGGTAGG - Intronic
1086830502 11:91556665-91556687 GAAGGTAAACTCCTGGAGATTGG - Intergenic
1088408806 11:109510750-109510772 AAAGTTAAAGTCACTGAGGTTGG + Intergenic
1088562982 11:111134647-111134669 AAAGGCAAACTTCATGAGGTAGG - Intergenic
1089238500 11:117053605-117053627 TAAGTTAAAATCCCTGAGTTTGG - Intronic
1089458401 11:118638998-118639020 AAAGGTAGGGTCCCTGAGGTTGG + Exonic
1089559846 11:119338312-119338334 GAAGATAAACTTCCTGAGTTGGG + Intergenic
1090056955 11:123431539-123431561 CTACGCAAACTCTCTGAGGTAGG + Intronic
1090651321 11:128809196-128809218 CAAGGTAAACTCACCAGGGTTGG - Exonic
1093522468 12:20066993-20067015 CAAGCTAAGCTCCCTGTGCTGGG + Intergenic
1103173440 12:118842252-118842274 CAAGGCAACCTCCATGAGGCAGG + Intergenic
1105699976 13:22928230-22928252 GATGGGACACTCCCTGAGGTGGG + Intergenic
1105852780 13:24350414-24350436 GATGGGACACTCCCTGAGGTGGG + Intergenic
1106608998 13:31260162-31260184 TAATGCAAAGTCCCTGAGGTGGG - Intronic
1109914275 13:68960129-68960151 CAAGGAAAACTCCATGAGAATGG - Intergenic
1109958577 13:69602097-69602119 GACTGTAAACTCCCTGAGATTGG + Intergenic
1113928348 13:113953273-113953295 CACGGAAATCTCCCTGAGGTAGG + Intergenic
1120310733 14:82824441-82824463 CAAGATAAACACTGTGAGGTAGG + Intergenic
1124785543 15:32676183-32676205 CAAGAAACACTCACTGAGGTAGG - Intronic
1125775090 15:42205463-42205485 AAATGTAAAGGCCCTGAGGTGGG + Intronic
1130091795 15:80827370-80827392 CATGTTAAACTTCCTGAAGTGGG + Intronic
1130993742 15:88892591-88892613 CAAGTTAAACTCATTGAGGTTGG + Intronic
1131380246 15:91957550-91957572 AAATGTAAAGGCCCTGAGGTGGG - Intronic
1132818929 16:1851477-1851499 GAGGGTAAACTCCATGAGGGTGG + Intronic
1134207690 16:12251104-12251126 CAAGGCAAACTTCCTGGGTTGGG + Intronic
1141093462 16:81146513-81146535 GAATGTAAACTCCGTGAGGTGGG - Intergenic
1142006696 16:87692651-87692673 CAGGGTAAAGTCCCTTAGGATGG + Intronic
1142308152 16:89297081-89297103 CAAGGCAGAGACCCTGAGGTTGG + Intronic
1147776709 17:42907055-42907077 CAATGCAAAAGCCCTGAGGTGGG + Intronic
1148757948 17:49984399-49984421 CGAGGTGAACTGCCTGGGGTGGG + Intergenic
1149315247 17:55432317-55432339 CAAGTTAAAAGCCCTGGGGTAGG - Intergenic
1154153909 18:11928908-11928930 CAAGGTAAAATCCCTGGAGAAGG + Intergenic
1156544646 18:37951908-37951930 CAAGGTAAGAACCCTGACGTGGG + Intergenic
1160761857 19:789509-789531 AAAGGCAAACTCCCCGGGGTGGG - Intergenic
1161644527 19:5444807-5444829 CCATGTAAAGGCCCTGAGGTAGG - Intergenic
1163410739 19:17152779-17152801 CAAAGCAAACGTCCTGAGGTCGG + Intronic
1164287594 19:23833903-23833925 CAATATAAACTCACTGATGTTGG - Intergenic
1164647929 19:29873040-29873062 CCAGGTGATCTCCCCGAGGTGGG + Intergenic
1166007338 19:39916544-39916566 CAATGCAAAGGCCCTGAGGTGGG - Intronic
926178329 2:10617026-10617048 GAAGGTAAGCTCCTTGAGGGTGG - Intronic
926600506 2:14839298-14839320 CAATGTAAAAACCCTGAGTTGGG - Intergenic
928104689 2:28461172-28461194 AAATGTAAAGTCCCTGAGGCAGG + Intronic
928810126 2:35213872-35213894 GAATATACACTCCCTGAGGTTGG - Intergenic
929790973 2:45022713-45022735 CAAGGTAAAAGCCTAGAGGTGGG - Intergenic
930327698 2:49941127-49941149 CAAGGTAAATTCCATGAAGCAGG - Intronic
932121053 2:69100475-69100497 CTTCCTAAACTCCCTGAGGTGGG + Intronic
932268421 2:70387871-70387893 CCAGGTCTACTCCCTGCGGTTGG - Intergenic
933771588 2:85748083-85748105 CAATGCAAAGGCCCTGAGGTGGG + Intergenic
933839336 2:86273868-86273890 CATTGTAAGCTCCCTGAGGGTGG + Intronic
935975760 2:108576892-108576914 CAGGGAGAACTCCCTGAGGTAGG + Intronic
936597184 2:113859314-113859336 CAAGGTAACCTCTCTAAGTTAGG - Intergenic
936731627 2:115388134-115388156 AAATGTAAACCCCGTGAGGTGGG + Intronic
937956743 2:127426075-127426097 CAAGGGAACTTCACTGAGGTAGG - Exonic
938012678 2:127841432-127841454 CAATGTAAACTTCCCGAGGGAGG + Intergenic
940255639 2:151725448-151725470 CAAGATCAACTCAGTGAGGTGGG - Exonic
940414660 2:153405573-153405595 GAATTTAAACTCCCTGAGGTTGG - Intergenic
943845045 2:192634830-192634852 CAAGTTGTACTCCTTGAGGTTGG - Intergenic
945660891 2:212683960-212683982 CAAGGCAAACACCCTGAGGCAGG + Intergenic
946788094 2:223269345-223269367 GAAGGTAAACTTCTTGAGGATGG + Intergenic
947421977 2:229949293-229949315 TAGGGTAAATTCCCTGAGGTGGG - Intronic
948857958 2:240739161-240739183 CAAGGTCACTTCCCTGAGGCTGG - Intronic
1171104963 20:22424037-22424059 AAAGGTGTGCTCCCTGAGGTGGG + Intergenic
1172634665 20:36401892-36401914 CAATGTGAACGCCCTGAGGGAGG + Intronic
1173069147 20:39744684-39744706 CAAGCTACACACCCTGAAGTGGG + Intergenic
1174396899 20:50252212-50252234 AAAGGTAAGGGCCCTGAGGTGGG + Intergenic
1175136650 20:56829277-56829299 AAGGGTAAACGCCCTGAGGTGGG - Intergenic
1175219590 20:57409185-57409207 CACGCTCAGCTCCCTGAGGTAGG - Exonic
1175873131 20:62217657-62217679 CAAGGTAAACGCCATCAGGCTGG - Intronic
1176117815 20:63440658-63440680 CAGGGTAAACTCCCCAAGGTGGG - Intronic
1178096767 21:29223390-29223412 CATGGCAAACACCCTGAAGTGGG + Intronic
1178749219 21:35284498-35284520 CAGGGCAAAGACCCTGAGGTGGG - Intronic
1178804507 21:35827497-35827519 CAAGGTGAACTCCCTTGGGTGGG + Intronic
1178881016 21:36450114-36450136 CAAGCTCAACTGCCTGAGGGTGG - Intergenic
1181601059 22:23952158-23952180 CCAGGTGAACCCCCTGAGGAAGG + Intergenic
1181607450 22:23989168-23989190 CCAGGTGAACCCCCTGAGGAAGG - Intergenic
1181888498 22:26040720-26040742 CAATGCAAAGGCCCTGAGGTAGG + Intergenic
1182303822 22:29354145-29354167 CTAGTCAAACTCTCTGAGGTTGG - Intronic
1183788935 22:40049226-40049248 CATGGTGAAATCCCTAAGGTCGG - Intronic
950640863 3:14347173-14347195 CAGTGTAAAGGCCCTGAGGTGGG + Intergenic
951932252 3:27981678-27981700 CAAGGTAATCTCCCTGTTGGAGG + Intergenic
952624253 3:35384486-35384508 CAAGCTAAACTCTGTGAGGTCGG - Intergenic
953170276 3:40500862-40500884 CAGGGTAAATTCTCTGATGTTGG - Intergenic
955029390 3:55201587-55201609 TAAGGTAACCTCTCTGAGTTTGG + Intergenic
955487630 3:59450549-59450571 GACGGTAAACTCCATGAGGCAGG + Intergenic
957420387 3:79960518-79960540 CAAGGTAAGAGGCCTGAGGTTGG - Intergenic
960044374 3:113181842-113181864 AAATGCAAACTCCCTGAGGCTGG + Intergenic
961601410 3:128065050-128065072 CCATGGAAACTCCCTGGGGTTGG - Intronic
962079689 3:132124633-132124655 ATAGGCAAAGTCCCTGAGGTGGG + Intronic
962557055 3:136564237-136564259 CAAGGTAAAATCCCAGAAGTAGG + Intronic
963608319 3:147433483-147433505 AAAGGTAAAGGCCCTGGGGTGGG + Intronic
964011818 3:151900648-151900670 CAGGCTAAACATCCTGAGGTTGG - Intergenic
966340739 3:178923219-178923241 CAAGGGAAACTCCCTGACCCGGG + Intergenic
966970203 3:185038683-185038705 CAAGGAAAAATCTCTGAGCTGGG + Intronic
969364386 4:6685730-6685752 CAAGGTCAACACCCTGGGGTGGG - Intergenic
971134810 4:23856722-23856744 AAAGGTAAATTCCATGAGGGAGG - Intronic
971595858 4:28527444-28527466 CAAGGTCAAATCCCTGAGGTTGG - Intergenic
974926524 4:68305517-68305539 CAAGGTAAAATAGCTGAGGTAGG + Intergenic
975270677 4:72428990-72429012 CATGGAAAAGTCTCTGAGGTTGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977244523 4:94615210-94615232 CATTATAAACTACCTGAGGTTGG - Intronic
980084072 4:128373592-128373614 CATGGAACACTCCCTGGGGTTGG - Intergenic
980752958 4:137116117-137116139 CAAGCTGCACTACCTGAGGTTGG - Intergenic
983827758 4:172285644-172285666 TCAGGGAGACTCCCTGAGGTGGG - Intronic
985658524 5:1144161-1144183 CCAGGTCCCCTCCCTGAGGTTGG - Intergenic
987492957 5:18604349-18604371 CAGAGCAAAATCCCTGAGGTGGG + Intergenic
987772911 5:22330054-22330076 CAAGCTGAAGTGCCTGAGGTTGG - Intronic
989128844 5:38084015-38084037 CAAGGGAAAATACCTGTGGTTGG - Intergenic
989531286 5:42510920-42510942 AAAGGAAAAATCCCTGAAGTTGG - Intronic
989744654 5:44814046-44814068 CAAGTAAAAGTCCCTGAGGTGGG + Intronic
991934060 5:71784377-71784399 GAATGTAAACTCCATGAGGAGGG + Intergenic
992940947 5:81760725-81760747 CAAGGCAAAGGCCCTGAGGCTGG - Intergenic
995335647 5:110996130-110996152 CAAGGTAAACTACAGGAGGTTGG - Intergenic
996571760 5:124939503-124939525 AATGGTAAACTCCCTCAGATGGG - Intergenic
996628066 5:125594295-125594317 CAAGGCAAAGGCCCTGAGGCAGG + Intergenic
996903123 5:128566748-128566770 CAAGGTAAAATCCCTGGAGATGG - Intronic
997189669 5:131919365-131919387 CAAGGTAGATTTCCAGAGGTAGG - Intronic
998119184 5:139561812-139561834 CAAGGTAAGCGGCCGGAGGTCGG + Exonic
998900461 5:146847756-146847778 TCAGGAAAACTCCCTAAGGTAGG + Intronic
1001146935 5:169193154-169193176 TCAGGTAAATTCCCTGAGGTGGG - Intronic
1001845327 5:174916816-174916838 CAAGCTGCACTGCCTGAGGTTGG - Intergenic
1003167481 6:3693418-3693440 CACGCTCAGCTCCCTGAGGTAGG - Intergenic
1006166602 6:32069057-32069079 CACTGTCAACTCCCCGAGGTGGG + Intronic
1014795904 6:125724083-125724105 CAAGGTAAATTCCTAGAAGTAGG - Intergenic
1014828531 6:126074427-126074449 CAAGGTAGACTTCTTGGGGTAGG + Intergenic
1014890264 6:126835706-126835728 GAAGGAAAACACACTGAGGTGGG - Intergenic
1016792212 6:148077882-148077904 CAGGGGAAACACCCTGAAGTAGG + Intergenic
1016811403 6:148264668-148264690 AAATGAAAAGTCCCTGAGGTGGG - Intergenic
1017704212 6:157106049-157106071 CAGGGAAAATTCCCTGAAGTGGG - Intronic
1020407143 7:7849655-7849677 AATGGTAAACTCCATGAGGCAGG - Intronic
1022782381 7:33599351-33599373 CAAGATAAAGTCCCTAAGGTGGG - Intronic
1023119047 7:36890949-36890971 CAGGGCAAAGGCCCTGAGGTTGG - Intronic
1025062370 7:55821399-55821421 CAAGGTAAAATCTCTGAGGCAGG - Intronic
1025810855 7:64874681-64874703 CTAGGTAAAATGCCTGAGGGGGG - Intronic
1034639420 7:152590843-152590865 CAAGGTAAAATCCCTGGAGAAGG - Intergenic
1037493867 8:19420491-19420513 GAAGGTAAAGTTCCTGAAGTTGG + Exonic
1037770994 8:21799746-21799768 CAAGCTAATCCCCCTGAAGTGGG + Intronic
1038650644 8:29400132-29400154 TAAGGTAAACTCCCTTTGGAAGG - Intergenic
1039531897 8:38269585-38269607 GAAGCTACACTACCTGAGGTTGG + Intronic
1045929365 8:107604607-107604629 GAACGTAAACTCCATGAGCTAGG - Intergenic
1048705118 8:137145445-137145467 CAAGGAAAACTTCCTGGGGAAGG + Intergenic
1052564446 9:30129554-30129576 CAAGGTAAAAGGTCTGAGGTAGG + Intergenic
1056486599 9:87064458-87064480 CAAGGTTGACACCCTGAGATAGG - Intergenic
1056988908 9:91391292-91391314 CAGGGTCAGCTCCCAGAGGTGGG + Intergenic
1057321387 9:94016252-94016274 CAAAGTAAAGTCCCAGAGGAGGG - Intergenic
1058028369 9:100167677-100167699 TAATATAAACTCCCTGAAGTTGG + Intronic
1059210549 9:112510918-112510940 CAGTATAAAATCCCTGAGGTGGG + Intronic
1059635145 9:116163139-116163161 GAATATAAACTCCCTGAGGGCGG - Intronic
1062645021 9:137543482-137543504 CACGTCAAACTCCGTGAGGTCGG + Exonic
1186305612 X:8253947-8253969 CAAGGTTAAGTCCCCGAAGTGGG - Intergenic
1187410811 X:19049092-19049114 AAAGGCAAAGGCCCTGAGGTGGG - Intronic
1189874407 X:45420815-45420837 CAAGTTAAGCTGCCTGGGGTAGG + Intergenic
1190346566 X:49342678-49342700 CACAGTAACCTCCCTGTGGTTGG + Intronic
1190472252 X:50794102-50794124 CAAGTTAGACACCCTGAGGTAGG + Intronic
1192134998 X:68588868-68588890 CAAGCTGCACTCCCTGTGGTTGG - Intergenic
1192425760 X:71074715-71074737 CATTGTAAACTCCCTAAGGGAGG + Intergenic
1193335641 X:80285398-80285420 CATGCTATACTGCCTGAGGTTGG - Intergenic
1195312230 X:103642954-103642976 CAAGCTGAGCTACCTGAGGTAGG - Intergenic
1197180194 X:123526942-123526964 CAAGGTGATCTGGCTGAGGTCGG - Intergenic
1199106282 X:143873094-143873116 CAAACTGAACTGCCTGAGGTTGG - Intergenic