ID: 1079080350

View in Genome Browser
Species Human (GRCh38)
Location 11:17409532-17409554
Sequence TCTTTGGGCCTTTTTTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 853
Summary {0: 1, 1: 0, 2: 3, 3: 66, 4: 783}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079080343_1079080350 25 Left 1079080343 11:17409484-17409506 CCTTCTGTATCTGTATATATATT 0: 1
1: 0
2: 7
3: 108
4: 1256
Right 1079080350 11:17409532-17409554 TCTTTGGGCCTTTTTTCTTTGGG 0: 1
1: 0
2: 3
3: 66
4: 783

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079080350 Original CRISPR TCTTTGGGCCTTTTTTCTTT GGG Intronic
900200513 1:1403126-1403148 TTTTTGTTCCTTTTTTTTTTTGG - Intronic
900654924 1:3752015-3752037 TCTTTTTTTCTTTTTTCTTTTGG + Intergenic
902179801 1:14679275-14679297 TTGTTGGGTCTTTTTTTTTTTGG + Intronic
903040429 1:20525575-20525597 TCTGTGGGCCTGTGTTCTTCAGG + Intergenic
903091225 1:20919578-20919600 TCTTTGATTATTTTTTCTTTTGG - Intronic
903097955 1:20997721-20997743 ACTGTGGGTTTTTTTTCTTTTGG - Intronic
903495230 1:23761863-23761885 TCTTTGGGGCTTTTTCTTTCTGG + Exonic
903582919 1:24385625-24385647 TATGTGGGCCTTATCTCTTTTGG - Intronic
904138738 1:28334937-28334959 TCTTGGGGTCTATTTTCTCTAGG - Exonic
905425470 1:37880292-37880314 CTTTTGGGGCTTTTTCCTTTGGG - Intronic
906341453 1:44984468-44984490 TCTTTTGACTTTTTTTTTTTGGG - Intronic
906799735 1:48726036-48726058 CCTCTGGGCCTTGTTTCTTCTGG - Intronic
906831679 1:49038519-49038541 TCTTTGGCTCATTTTTATTTGGG - Intronic
906976420 1:50577904-50577926 TCTTTTTGCCTTTTTTCTTGAGG - Intronic
907024509 1:51102405-51102427 TTATTGGGGCTATTTTCTTTGGG + Intronic
907588348 1:55641779-55641801 TCTTTGTGCCTTTGTGATTTGGG - Intergenic
908369876 1:63471088-63471110 TCTTTTGCCCATTTTTCTATTGG + Intronic
908473401 1:64467239-64467261 TCTTTGAGGCTTTTCTCTATTGG + Intergenic
908871584 1:68619434-68619456 TCTTTTGCACTTCTTTCTTTTGG - Intergenic
909060453 1:70873236-70873258 GCTATGTGCCTTCTTTCTTTAGG + Intronic
909602304 1:77473193-77473215 TCTTGGGGTTTTTTTTTTTTTGG + Intronic
909628560 1:77747016-77747038 TCTTTTGCCCTTTTTACTATTGG + Intronic
909733961 1:78932939-78932961 GCTCTGGGCTTTTTTTGTTTGGG - Intronic
909774525 1:79467270-79467292 TCTTTGGGTCTTTATTCCTGAGG - Intergenic
909848385 1:80428240-80428262 TCTTCGAGTCTTTTTTGTTTCGG + Intergenic
910289198 1:85583356-85583378 TCTCTAGGCTTTTTTCCTTTTGG + Exonic
910709524 1:90165392-90165414 TCTTTGTTTCTTTTTCCTTTGGG + Intergenic
910758030 1:90711769-90711791 TCTCATGACCTTTTTTCTTTTGG - Exonic
911150851 1:94595755-94595777 TCTTTTGTCCATTTTTCCTTTGG - Intergenic
911828839 1:102524446-102524468 TTTGTGGGTTTTTTTTCTTTTGG - Intergenic
912402166 1:109403460-109403482 TTTTTGGGGTTTTTTTTTTTTGG - Intronic
912614759 1:111086857-111086879 TTTTTGGGTCTTTTTTCTTTTGG + Intergenic
912696672 1:111847402-111847424 TCTTTTGGCCATTTTTATCTTGG - Intronic
913044087 1:115058636-115058658 TCTTTGGGGCATGTGTCTTTTGG + Intronic
913178448 1:116296724-116296746 TCTGTGGGAATTTTTTTTTTGGG - Intergenic
913549095 1:119898983-119899005 TCTCTGTACCATTTTTCTTTGGG + Intergenic
914282922 1:146193725-146193747 TCTTTTTGCCTTTTTTTTTTTGG - Intronic
914543952 1:148644443-148644465 TCTTTTTGCCTTTTTTTTTTTGG - Intronic
914822849 1:151118457-151118479 AATTTGGTCCTTTATTCTTTTGG - Exonic
915256488 1:154634727-154634749 TTTTTTGGCTTTTTTTTTTTCGG + Intergenic
915623965 1:157103292-157103314 TTTTGAGGCTTTTTTTCTTTTGG - Intergenic
915981548 1:160423510-160423532 TCCTTTGCCCTTTTTTCTCTAGG + Intronic
916593725 1:166221125-166221147 TTTTTGTTCCTGTTTTCTTTTGG + Intergenic
916923261 1:169490871-169490893 TATTTGCCCATTTTTTCTTTTGG + Intergenic
916973328 1:170048293-170048315 TATTTGGGTTTTTTTTTTTTTGG + Intronic
917120960 1:171644254-171644276 TTTTTAGGGCTTTTTTTTTTAGG + Intronic
917388283 1:174502302-174502324 TCTTTGGGATTCTTTTCCTTTGG - Intronic
917969510 1:180197816-180197838 TCTTTTGTCCTTTTTTATTTTGG + Exonic
918195501 1:182217946-182217968 CCTTTGTTCTTTTTTTCTTTAGG + Intergenic
920254940 1:204648400-204648422 GCTCTGGGCCTATTTTCTTGGGG - Intronic
921164648 1:212498089-212498111 TCTCTGGGCTTTGGTTCTTTTGG - Intergenic
921317013 1:213901738-213901760 TCTTTGTTTCTTTTTTCTTTTGG - Intergenic
921449181 1:215283553-215283575 TCTCTATTCCTTTTTTCTTTTGG + Intergenic
923298433 1:232617638-232617660 CCTTTGTTCCTTTTTTTTTTAGG - Intergenic
923602610 1:235416540-235416562 TATTTGGGGTTTTTTTTTTTTGG - Intronic
923812472 1:237334663-237334685 TCTTTGGCCCCGTTTTCTCTGGG + Intronic
924818555 1:247465084-247465106 TCTTTTAGCTTTTTTTTTTTTGG - Intergenic
924865780 1:247978458-247978480 TCTTTGGGACATTTGTATTTGGG + Intronic
924868941 1:248019115-248019137 TCTGAGGGTCTTATTTCTTTGGG + Intronic
1063332413 10:5174307-5174329 TCTTTGGTGGTTTTTTTTTTAGG - Intergenic
1063935371 10:11072144-11072166 TCTTTTGTCGTTTTTTCTTTAGG + Intronic
1064868123 10:19905298-19905320 TGTTTGGACCATGTTTCTTTTGG - Intronic
1065453972 10:25887367-25887389 TCCTTGGGCTTTTTGTCTCTGGG + Intergenic
1065895256 10:30157552-30157574 TCTTTTGCCCATTTTTCTATAGG + Intergenic
1066402810 10:35091614-35091636 TGTCTGGTCCTTTTTTTTTTTGG + Intergenic
1066637145 10:37515180-37515202 TCTTTCCCCCTTTTTTTTTTTGG - Intergenic
1066672429 10:37854393-37854415 TCTTTTGCCTATTTTTCTTTTGG - Intronic
1067277063 10:44845423-44845445 TCTTTCTGCCTTTTTTTTGTGGG - Intergenic
1067299532 10:44996193-44996215 GCTTTGGGCCTTGTTTCCATGGG - Intergenic
1067385661 10:45815886-45815908 TCTTTTGGCCATTTTTATGTTGG + Intronic
1067575302 10:47404844-47404866 TCTTTCAGCCTTTGGTCTTTTGG + Intergenic
1068854387 10:61782503-61782525 ACTTCGGGCATTTTCTCTTTTGG + Intergenic
1068901739 10:62277248-62277270 TCTATGGACTTCTTTTCTTTGGG - Intergenic
1069095335 10:64252420-64252442 TCTTTGAACCTTTATTCTTTAGG + Intergenic
1070224706 10:74490646-74490668 ACTTTGGGCCACTTTCCTTTAGG - Intronic
1070350676 10:75589423-75589445 TCCTTTGCCCATTTTTCTTTGGG + Intronic
1070424805 10:76275641-76275663 GCTTTGGTCTTTGTTTCTTTAGG + Intronic
1070614713 10:77960679-77960701 TCTCTGAGCCGTTTTTCTATAGG + Intergenic
1070671285 10:78379215-78379237 TCTTTCAGCCTTTTTTCTCGTGG + Intergenic
1070689561 10:78514538-78514560 TTTTTGGGCGTTTTTACTTCTGG + Intergenic
1071163024 10:82773407-82773429 CCTTTGTCCCTTTTTTCCTTGGG + Intronic
1071217228 10:83421162-83421184 TCTTTATGTTTTTTTTCTTTAGG - Intergenic
1071362351 10:84861749-84861771 TTTTTGGGTCATTTTTCTTCTGG - Intergenic
1071427170 10:85570913-85570935 TCTTTGGCCCTTTTTTCTGAAGG - Intergenic
1071588590 10:86849177-86849199 TCTTTATTCCTTTGTTCTTTAGG + Intronic
1071683733 10:87733758-87733780 TGTTTGGAGCTATTTTCTTTAGG + Intronic
1072115951 10:92370435-92370457 TCTTTGGCCCATTTTTCTGGTGG - Intergenic
1072455694 10:95573789-95573811 TCTTAGGGACATTTTTGTTTGGG - Intergenic
1072681313 10:97509004-97509026 TCTCTGTGCCTCTTTTCCTTTGG - Intronic
1072964263 10:99957205-99957227 TCTCTGCTCCTCTTTTCTTTAGG - Exonic
1072974720 10:100047620-100047642 TCTTTGGGCCTTCATTCTGAAGG + Intronic
1072989048 10:100172497-100172519 TCTTTTGCCCATTTTTCTGTTGG - Intronic
1072992167 10:100207545-100207567 TCTTTTTGCATTTGTTCTTTGGG - Intronic
1073353480 10:102835983-102836005 GCTTTGGACCCTTTTGCTTTGGG - Intronic
1073717080 10:106119933-106119955 TCTTTGGCCATTTTTTGATTTGG - Intergenic
1074750158 10:116578164-116578186 TCTTTGGGCCTTTGGTACTTTGG - Intergenic
1074865999 10:117544683-117544705 TTTTTGGGTTTTTTTTCCTTTGG - Intronic
1074937314 10:118194638-118194660 TTTTTGGAACTTTTTTCCTTAGG + Intergenic
1075012219 10:118883775-118883797 TCTTTGTTCCTTTTTTATTAGGG - Intergenic
1075432275 10:122396994-122397016 TCTTTGCTACTTTTTTATTTAGG + Intronic
1076172216 10:128329341-128329363 TCCTTAGCTCTTTTTTCTTTTGG - Intergenic
1076348671 10:129799507-129799529 TCTTTGGGCTTTTGTCCTTGGGG + Intergenic
1076939623 10:133593477-133593499 TTTTTTGCCCATTTTTCTTTTGG + Intergenic
1077003108 11:335057-335079 CTTTTGGGGTTTTTTTCTTTTGG + Intergenic
1077649193 11:3954128-3954150 CCTTTGGGCTTTCTTTGTTTGGG + Intronic
1077774464 11:5255922-5255944 TCTTTGGGATTTTTATTTTTTGG + Intronic
1078508218 11:11967432-11967454 TCATTGGGCCTTGCCTCTTTGGG - Intronic
1078984200 11:16575068-16575090 TCTTTTGCCCATTTTTCTATTGG - Intronic
1079080350 11:17409532-17409554 TCTTTGGGCCTTTTTTCTTTGGG + Intronic
1079359836 11:19761177-19761199 TCTGGAGGCCTTTTTTCTTGGGG + Intronic
1079435666 11:20446322-20446344 TATTTTGCCCATTTTTCTTTTGG + Intronic
1079790893 11:24738317-24738339 TCTTTGTGCCTTTTGCTTTTGGG + Intronic
1080141724 11:28929073-28929095 TTTTGGGGCCATTTTTGTTTTGG + Intergenic
1080401180 11:31937388-31937410 TCCTTTGCCCCTTTTTCTTTTGG + Intronic
1080508306 11:32940933-32940955 TCTTTTGCCCTTTATTCCTTGGG + Intronic
1080704085 11:34672235-34672257 TCTTTGGGAATTTTTTAGTTTGG + Intergenic
1080796958 11:35573788-35573810 TCTTTGGGTCTTTATTCTGAAGG - Intergenic
1081347495 11:42008093-42008115 TCTTTGGTCATTTCTTCCTTTGG + Intergenic
1081774971 11:45670646-45670668 TCTTTGGCCTTGTTTGCTTTTGG - Intergenic
1081797396 11:45830383-45830405 TCTTTTCGCTTTTTATCTTTTGG + Intergenic
1082072875 11:47953040-47953062 TCTCTGGGTCTGTTTCCTTTGGG + Intergenic
1082815919 11:57509111-57509133 TCTTTGTTTCTTTTTTTTTTTGG - Intronic
1083541541 11:63514864-63514886 CCTTTGTTCCTTTTTTTTTTTGG + Intronic
1084841121 11:71849215-71849237 TTTGTGGGGCTTTTTTGTTTAGG + Intergenic
1084856397 11:71990490-71990512 CCTTTGGGCCTTCTCGCTTTGGG + Intronic
1084870767 11:72097327-72097349 TGTTTGGTCTTTTTTTGTTTTGG - Exonic
1085141916 11:74152761-74152783 TCATTTGGATTTTTTTCTTTTGG - Intronic
1085439355 11:76544237-76544259 ACTTTGTGCCTTTTTTACTTAGG + Exonic
1085587490 11:77724071-77724093 TTTTTGTCCATTTTTTCTTTGGG - Intronic
1085796574 11:79546352-79546374 TCTTTATTCTTTTTTTCTTTGGG - Intergenic
1085842161 11:80024793-80024815 TCTTTTGGCCTCTAATCTTTTGG + Intergenic
1085870751 11:80346817-80346839 TCTGTGGGCCCTCTGTCTTTTGG + Intergenic
1086035432 11:82409282-82409304 TGTTTGGTCCTTTTTTGTTGGGG - Intergenic
1086725779 11:90182003-90182025 CCTTTGGCCCTTGTCTCTTTGGG - Intronic
1086889521 11:92240574-92240596 TTTTTGGGTTTTTTTTTTTTGGG - Intergenic
1086941861 11:92806746-92806768 TCTTTGGGTCTCTTATTTTTGGG - Intronic
1086999373 11:93398675-93398697 TCCTTTGCCCATTTTTCTTTTGG + Intronic
1087107578 11:94425728-94425750 TCTTTGTCCCTTTTTACTGTTGG - Intronic
1087126664 11:94634496-94634518 TCTTGGGCCCTTTTTTCTACTGG - Intergenic
1087190111 11:95245228-95245250 TCTTTTTGCCTTTTGTCTTCAGG + Intergenic
1087231123 11:95665857-95665879 TCTTTGGGATTATTTTATTTGGG - Intergenic
1087244629 11:95819977-95819999 TCTTTGCCCATTTTCTCTTTAGG + Intronic
1087812144 11:102620198-102620220 TGTTTGAGCTCTTTTTCTTTAGG + Intronic
1087832459 11:102834044-102834066 TATTTGGGCCTTTTGTATTGTGG + Intergenic
1088384000 11:109231746-109231768 TCTTTTGCCCACTTTTCTTTTGG - Intergenic
1088603669 11:111508358-111508380 TCCCTGGGCTTTTTTTTTTTTGG + Intronic
1088634283 11:111804630-111804652 TCTTTGGGCATTTTTTAATCCGG - Intronic
1089045430 11:115498179-115498201 TATTTGGGCCTTATTTTTGTGGG - Intronic
1089234862 11:117015138-117015160 TCTTTTGCACATTTTTCTTTTGG - Intronic
1091071963 11:132574237-132574259 TCTTTGTGTTTTTTTTTTTTTGG + Intronic
1091306954 11:134542417-134542439 TCTTTGGGTCTTCTTTCTGAAGG - Intergenic
1091568693 12:1665661-1665683 TCTTTTGCCCATTTTTCTTTGGG - Intergenic
1091898756 12:4125427-4125449 TCTTTGTGCCTCTTTTTTATTGG + Intergenic
1092485005 12:8895466-8895488 TCCTTTGCCCATTTTTCTTTTGG + Intergenic
1093241943 12:16687458-16687480 TCCTTGGGCCTTTTTTATGAGGG + Intergenic
1093627865 12:21371394-21371416 TCTTTTGATTTTTTTTCTTTTGG + Intronic
1093738580 12:22654094-22654116 TCTTTGGGCCTCTTTTATAAGGG - Intronic
1093882784 12:24424789-24424811 TCTTTGTGAGTTTTTTTTTTGGG + Intergenic
1093926436 12:24912954-24912976 TCTTTGGGTCTTCGTTCTGTAGG - Intronic
1094210737 12:27887585-27887607 TCTTTGCTCATTTTTTCTATTGG + Intergenic
1095129751 12:38526121-38526143 TCTTGGGTCCATTTTTCATTTGG + Intergenic
1095158254 12:38885297-38885319 TCTTTAAGTCATTTTTCTTTTGG - Intronic
1095507308 12:42911269-42911291 TCTTTGGGTCTTTGTTCTCAAGG - Intergenic
1096151797 12:49318368-49318390 CCTTTGTGCTTTTTTTATTTTGG - Intergenic
1096543674 12:52322674-52322696 ACTTTGGGCCCTTGTTCCTTTGG + Intergenic
1097385841 12:58949592-58949614 TTTTTGGTGGTTTTTTCTTTAGG + Intergenic
1097456473 12:59804458-59804480 TCTTAAGGCCATTTTGCTTTTGG + Intergenic
1097754397 12:63392857-63392879 TCTTTTGTCCATTTTTCTATTGG - Intergenic
1098500252 12:71183953-71183975 TTTTTAGGTCTTTTTTCCTTAGG - Intronic
1098519799 12:71421986-71422008 TTTATCTGCCTTTTTTCTTTAGG - Intronic
1098868174 12:75785761-75785783 CCCATGGGCCTTATTTCTTTTGG - Intergenic
1099285383 12:80709165-80709187 GCTTTGGGCTTTTATTTTTTTGG + Exonic
1099849985 12:88081551-88081573 TCTTTGAGGCTTCTTGCTTTTGG + Intronic
1100380996 12:94061714-94061736 TCTTTGCTCATTTTTTCATTAGG - Intergenic
1100521951 12:95383617-95383639 TCTTTGGGCCTTCTGTCTTTTGG + Intergenic
1100524509 12:95406953-95406975 TCTTGAGGCCTTTTTCATTTTGG + Intergenic
1101117421 12:101545623-101545645 TCATTTGTCCATTTTTCTTTTGG - Intergenic
1101480934 12:105096535-105096557 TGTTTGGCTCTTTTTTTTTTTGG + Intergenic
1101670264 12:106864655-106864677 TCATTCTGCCTTTTTACTTTGGG + Intronic
1102113722 12:110384810-110384832 TTTTTGGGCCTTTTCTGGTTGGG - Intronic
1102625405 12:114231681-114231703 TCTTTGTGGCTTCTTTGTTTGGG - Intergenic
1102628948 12:114259747-114259769 TCTTTATGCCTGATTTCTTTTGG - Intergenic
1103259014 12:119569495-119569517 TCTTTGGCTTTTTTCTCTTTTGG - Intergenic
1103283001 12:119775928-119775950 TCTATGGGGTCTTTTTCTTTGGG + Intronic
1104017424 12:124970421-124970443 GCCTGGTGCCTTTTTTCTTTTGG - Intronic
1105416096 13:20212615-20212637 TCTTTGGGTTTATTTTGTTTAGG - Intergenic
1105484320 13:20811862-20811884 CCTCTTGGCCTTTCTTCTTTTGG + Intronic
1105492372 13:20901723-20901745 TTTTTGGACTTTTTTCCTTTTGG - Intronic
1105794362 13:23835354-23835376 TATTTGGTCATTTTTTTTTTTGG - Intronic
1106083277 13:26518202-26518224 TCTTTTGTCCATTTTTCTTTTGG + Intergenic
1106092876 13:26614069-26614091 TCTTTCTTTCTTTTTTCTTTTGG + Intronic
1106751213 13:32770289-32770311 TCTTTGAGCCTCTTTTCCTCAGG - Exonic
1107249549 13:38342098-38342120 TCTTTGGGCCTTTTAAAGTTTGG - Intergenic
1107441543 13:40432085-40432107 TCCTTGGGCATTTTTTTCTTTGG - Intergenic
1108049094 13:46412375-46412397 TCTTTGGGTTTGTTTGCTTTTGG - Intronic
1108464670 13:50703111-50703133 TCTTTTGGCCATTTTTTATTAGG - Intronic
1108515413 13:51197387-51197409 TCTTTGAGTATATTTTCTTTTGG + Intergenic
1108641332 13:52385147-52385169 TCTTAGCTCCTTGTTTCTTTGGG - Intronic
1108783545 13:53867109-53867131 TCTTTGAGACTGTTTCCTTTGGG + Intergenic
1108882575 13:55138693-55138715 TCTGTTACCCTTTTTTCTTTTGG + Intergenic
1108987334 13:56609335-56609357 TATTTGGGCCCTTTTTTTTGGGG + Intergenic
1109074360 13:57815430-57815452 TGTTTTTGCCTTTTTTGTTTTGG - Intergenic
1109144586 13:58763028-58763050 TCTTTGTTCCTTTTTGCTATTGG + Intergenic
1109173447 13:59125000-59125022 TCATTGGCCCATTTTTCTATTGG - Intergenic
1109212698 13:59552394-59552416 TATTTGGGTCTTTTTTATTTTGG - Intergenic
1109214699 13:59575653-59575675 TAGTTGGGTCTTTTTTCCTTAGG - Intergenic
1109544289 13:63823781-63823803 TCTGTGGGGCTTTTTTTTTTTGG + Intergenic
1110461993 13:75755283-75755305 TCTTTGGGTAGTTTTTCTTATGG + Intronic
1110784702 13:79510391-79510413 TTTTTGACCCTTTTTACTTTTGG + Intronic
1111747492 13:92289087-92289109 TATTAGGGCTTTTTTTTTTTTGG - Intronic
1111973633 13:94942870-94942892 TCTTTTGCCCGTTTTCCTTTGGG + Intergenic
1114059254 14:19004191-19004213 TTTTTGGGGGTTTTTTCTTTTGG - Intergenic
1114103291 14:19397564-19397586 TTTTTTGGGGTTTTTTCTTTTGG + Intergenic
1114189145 14:20428037-20428059 CCTGTGTGCCTTCTTTCTTTTGG - Intergenic
1114207029 14:20581647-20581669 TCTTTGGCCCTTTTTAAATTGGG + Intergenic
1114309110 14:21450366-21450388 TCTTTGGGGATTATTTCTTTGGG - Intronic
1114766604 14:25379025-25379047 TCTTTATGTCTTATTTCTTTAGG + Intergenic
1114804822 14:25822879-25822901 TTTGTGGGCTTTTTTTGTTTGGG - Intergenic
1115149370 14:30266508-30266530 TCTTTGGAACTTCTTTCTTTGGG + Intergenic
1115714177 14:36084549-36084571 TCTTTTGCCCATTTTTCTATTGG - Intergenic
1116259471 14:42605182-42605204 TATTTTGGGCTTTTTTTTTTTGG - Intergenic
1116384677 14:44315952-44315974 TCTTTGGGTCTTTATTCTGAGGG - Intergenic
1116460726 14:45170088-45170110 TCTTTTGGACTCTTTTCATTTGG - Intronic
1116528925 14:45943029-45943051 TCTTTGGCCCATCTTTCTTTTGG + Intergenic
1117256458 14:53983091-53983113 TATTTGTGCCTCATTTCTTTGGG + Intergenic
1117312082 14:54536674-54536696 TCTTTTGCCCATTTTTCTATAGG + Intronic
1117542978 14:56766649-56766671 TCTTTGGACCATTTTCCTATTGG - Intergenic
1117549675 14:56821881-56821903 TCTTACTGCCTTTTTTATTTAGG - Intergenic
1117726110 14:58675897-58675919 TCTTTTGCCCATTTTTCTGTTGG + Intergenic
1117846312 14:59915097-59915119 TCTTTGGGCCTCTTTTATGAGGG - Intergenic
1118114268 14:62757610-62757632 TCTTTTGGTTTTTTTTTTTTTGG - Intronic
1118448803 14:65878011-65878033 TCTTTTTTCCTTTTTTTTTTAGG + Intergenic
1118570554 14:67190569-67190591 TCTTTGAGAATTTTTTCTTATGG - Intronic
1118576379 14:67245514-67245536 TATTTTTTCCTTTTTTCTTTAGG + Intronic
1119108689 14:71949797-71949819 CCTTTTAGCCTTTTATCTTTAGG + Intronic
1119284194 14:73437870-73437892 TTCTTGGTCCATTTTTCTTTTGG - Intronic
1119574062 14:75702505-75702527 CATCTGGGACTTTTTTCTTTTGG + Intronic
1120285982 14:82502388-82502410 ACTTTGATCCTGTTTTCTTTTGG - Intergenic
1120746277 14:88154867-88154889 TCTTTGTACCTGTATTCTTTAGG + Intergenic
1120791719 14:88590129-88590151 TTTTTTTGCCTTTTTTTTTTTGG - Intronic
1121164382 14:91777808-91777830 TCTTTGGGTCTTTTTTATAAAGG + Intronic
1121357435 14:93227576-93227598 TCTTGGGGCTTGTTTTCTCTAGG + Exonic
1121536774 14:94696314-94696336 TTTTTGGGGTTTTTTTGTTTTGG + Intergenic
1122244214 14:100390287-100390309 CCTTTGGTCTTTTTTTGTTTTGG + Intronic
1122304448 14:100753166-100753188 TCTATGGGCCTCTTTTCCTGGGG + Intergenic
1124131400 15:26990643-26990665 TCATTTGGCCATTTTTGTTTTGG + Intronic
1124176658 15:27431891-27431913 TCTTTGACCTTTTATTCTTTAGG + Intronic
1124719068 15:32096307-32096329 TCTTTTGCCCATTTTTCTATTGG + Intronic
1125872024 15:43110720-43110742 TCTTTCATCCATTTTTCTTTTGG - Intronic
1126070311 15:44860231-44860253 TCTTGGGGTCTTTTCTCTGTGGG + Intergenic
1126544380 15:49856763-49856785 TCTTTGAGCCTTTGTTCCCTTGG - Intergenic
1126611410 15:50533158-50533180 TCTTTGTTTCTTTTTTTTTTAGG - Intronic
1126619200 15:50619783-50619805 TAGTTGGACCTTGTTTCTTTAGG + Exonic
1126717780 15:51539209-51539231 TCTTTCTTCCTTTTTTTTTTTGG - Intronic
1126874261 15:53022545-53022567 TCTATATACCTTTTTTCTTTTGG - Intergenic
1127379403 15:58418211-58418233 TCTTTGACCCATTTATCTTTTGG - Intronic
1128486765 15:68099667-68099689 TTTTTGGGGGTTTTTTTTTTGGG + Intronic
1128586648 15:68858042-68858064 TCTCTGGGCTTATTCTCTTTGGG + Intronic
1129224969 15:74164012-74164034 TTTTTAGCCTTTTTTTCTTTAGG - Intergenic
1129497747 15:76002044-76002066 TCTTTGCTCCTTTTTTCATATGG - Intronic
1130151349 15:81314150-81314172 TCATAGGGCCTTTGTTCTTGGGG - Intronic
1130325386 15:82875404-82875426 TCTTTGGGCTGTTTTTCTGCAGG - Exonic
1131795485 15:96011697-96011719 TCTTTCTTCCTTTTTTTTTTTGG + Intergenic
1131805462 15:96117728-96117750 TTTTTGGGTTTTTTTTTTTTTGG - Intergenic
1131825386 15:96318208-96318230 TCCTTCTGCCTTTTTGCTTTTGG - Intergenic
1131917509 15:97285878-97285900 ACTCTTGGCCATTTTTCTTTTGG - Intergenic
1133000992 16:2851649-2851671 TTTTTGGGTTTTTTTTTTTTTGG - Intergenic
1133627914 16:7589497-7589519 TTTTTTGGTCTTTATTCTTTTGG + Intronic
1133884711 16:9815446-9815468 TCTTTTGGCCATTTTACATTTGG - Intronic
1134166786 16:11936641-11936663 CTTTTGAGCCTTTTTTCCTTTGG - Intronic
1134525849 16:14942815-14942837 CTTTTGAGCCTTTTTTCCTTTGG + Intronic
1134546557 16:15113546-15113568 CTTTTGAGCCTTTTTTCCTTTGG - Intronic
1134547042 16:15118029-15118051 CTTTTGAGCCTTTTTTCCTTTGG - Intronic
1134581269 16:15372818-15372840 CTTTTGAGCCTTTTTTCCTTTGG - Intronic
1134637123 16:15800839-15800861 TCTTTAGGCCTTTTGTCTTGAGG - Intronic
1134896009 16:17887268-17887290 TCTTTGGGTCTTCATTCTTAGGG + Intergenic
1135041148 16:19117722-19117744 TCTATAAGCCTTCTTTCTTTAGG + Exonic
1135190709 16:20352020-20352042 TCTTTCTGTCTTTTTTTTTTTGG - Intronic
1135312177 16:21414058-21414080 CTTTTGAGCCTTTTTTCCTTTGG - Intronic
1135365125 16:21846514-21846536 CTTTTGAGCCTTTTTTCCTTTGG - Intronic
1135446714 16:22524825-22524847 CTTTTGAGCCTTTTTTCCTTTGG + Intronic
1135559429 16:23464553-23464575 GATTTGGGCTTTTTTTTTTTTGG - Exonic
1136151348 16:28351978-28352000 CTTTTGAGCCTTTTTTCCTTTGG - Intronic
1136167580 16:28465819-28465841 CTTTTGAGCCTTTTTTCCTTTGG - Intronic
1136195396 16:28649196-28649218 CTTTTGAGCCTTTTTTCCTTTGG + Intronic
1136211734 16:28763312-28763334 CTTTTGAGCCTTTTTTCCTTTGG + Intronic
1136256455 16:29043263-29043285 CTTTTGAGCCTTTTTTCCTTTGG + Intronic
1136308880 16:29393049-29393071 CTTTTGAGCCTTTTTTCCTTTGG - Intronic
1136322297 16:29494580-29494602 CTTTTGAGCCTTTTTTCCTTTGG - Intronic
1136364616 16:29804038-29804060 TCTTCCGGCCTTTATTCTTCAGG - Exonic
1136436976 16:30234552-30234574 CTTTTGAGCCTTTTTTCCTTTGG - Intronic
1136925756 16:34372235-34372257 TCTCTGGGCCTGTTTCCTTGGGG + Intergenic
1136978818 16:35039571-35039593 TCTCTGGGCCTGTTTCCTTGGGG - Intergenic
1137286120 16:47017141-47017163 TCTTTTGGTCTTAGTTCTTTTGG + Intergenic
1137286121 16:47017156-47017178 TCTTTTGGTCTTAGTTCTTTTGG + Intergenic
1137941958 16:52696638-52696660 TCTTTGGGTCGTTTTTATTCTGG - Intergenic
1138708200 16:58939382-58939404 TCTCTGTGTCTTCTTTCTTTGGG - Intergenic
1138793319 16:59935576-59935598 TGTTTGGGCCTATTTAGTTTGGG - Intergenic
1138988018 16:62355085-62355107 TCTTTTGGCCTTTATTTTCTTGG - Intergenic
1139834247 16:69825423-69825445 TTTTTGGGGTTTTTTTTTTTTGG - Intronic
1140366146 16:74382577-74382599 CTTTTGAGCCTTTTTTCCTTTGG + Intronic
1140588006 16:76317277-76317299 TTTTTGGGTTTTTTTTTTTTTGG - Intronic
1140921939 16:79546775-79546797 TTTATGTGCCTTTTCTCTTTGGG - Intergenic
1141082733 16:81067076-81067098 TCTTTGATCAGTTTTTCTTTGGG - Intronic
1142757106 17:2023081-2023103 CCTTTTGGTCTTTTGTCTTTTGG - Intronic
1143088844 17:4436605-4436627 TGTTTTGGCTTTTTGTCTTTAGG - Intronic
1143933975 17:10462731-10462753 CCTTTGGGCTTTCTTACTTTTGG - Intronic
1144393765 17:14822479-14822501 TTTTTGTGGCTTTTTTTTTTAGG - Intergenic
1145070809 17:19805763-19805785 TCTTTTGGCCTTTTTTTTTGTGG - Intronic
1145783631 17:27580141-27580163 ACTTTGGGGCTTGTTTCCTTTGG + Intronic
1147002528 17:37374212-37374234 TCTTTGGTCTTGTTTTATTTTGG - Intronic
1148212902 17:45818948-45818970 TTGTTGGGCCTGCTTTCTTTCGG + Intronic
1148619974 17:49027078-49027100 TCTATCTGCCTTTCTTCTTTTGG - Intronic
1148694464 17:49550552-49550574 CCTGTGGGCCTTTGTTCTATTGG + Intergenic
1150010701 17:61500353-61500375 TCTTTTGCCCATTTTTCTATTGG - Intergenic
1152619454 17:81354902-81354924 TTTTTGGTCTTTATTTCTTTGGG - Intergenic
1152666573 17:81573724-81573746 TATTTGGACCATTTTTCTCTGGG - Intronic
1152770520 17:82165486-82165508 TCTTCGGCCTTTTTTTTTTTTGG - Intronic
1152895792 17:82910563-82910585 TCTTAGTGACTTTTTTTTTTTGG + Intronic
1153157777 18:2168374-2168396 TCTTTGGGTCTTCATTCTTACGG + Intergenic
1153597911 18:6747675-6747697 TATTTGGGTATTTTTTCTGTGGG - Intronic
1153891179 18:9516991-9517013 TCTTTATGCTTTTCTTCTTTGGG - Exonic
1153954469 18:10084628-10084650 ACTTTGGTCGTTTTTTGTTTTGG - Intergenic
1154118057 18:11628745-11628767 CTTTTGAGCCTTTTTTCCTTTGG - Intergenic
1154234399 18:12590487-12590509 TCCTTTGGGCTTTCTTCTTTAGG - Intronic
1154371628 18:13768502-13768524 TGGTTTGGCCTTGTTTCTTTAGG - Intergenic
1155868718 18:30998596-30998618 TCCTTAGCCCTTTTTTATTTTGG - Intronic
1156485454 18:37462801-37462823 TTTTTGCGATTTTTTTCTTTTGG + Intronic
1157015926 18:43712825-43712847 TCTTTGGGCCTCATTTCTGAAGG - Intergenic
1157137118 18:45067012-45067034 TCCTTTGACCTTTCTTCTTTGGG - Exonic
1157159501 18:45300436-45300458 TCTTAGGACTTTTTTTTTTTTGG - Intronic
1157680685 18:49603073-49603095 TCTTTGGGTCTTTATTCTGAAGG + Intergenic
1157885976 18:51366968-51366990 CCTTTGGGCCCTGTTTCCTTCGG + Intergenic
1158263388 18:55633875-55633897 GTTTTGTGCCTTTTTTGTTTTGG - Intronic
1158797273 18:60862088-60862110 TCTTTGGCCCATTTTTATTTGGG - Intergenic
1158827801 18:61243074-61243096 TCTTTGGGTCATTTATCTTTTGG - Intergenic
1158883674 18:61805361-61805383 TCTTTGGGTCTTATTTCTGAAGG + Intergenic
1158930289 18:62318044-62318066 TCTTTTGTCCATTTTTCTTTTGG - Intergenic
1159031292 18:63234999-63235021 TCCTTGGCCCGTTTTTCTATTGG - Intronic
1159249327 18:65853366-65853388 TTTTAGGGCCTTTCTTCTCTTGG + Intronic
1159457156 18:68674034-68674056 GCTTTGGGACCTTTTTATTTTGG - Exonic
1159979367 18:74758192-74758214 TCTTTATGCCTTTTTTGTTATGG + Intronic
1160070551 18:75624356-75624378 TCCTTGGGTCTTTTATCTTTGGG + Intergenic
1160563675 18:79773965-79773987 TCTTGGAGCTTCTTTTCTTTCGG - Intergenic
1161188658 19:2940360-2940382 TCTTTTAGCCTTTTTTTTTTTGG - Intronic
1161374937 19:3934546-3934568 TTTTTGGGGTTTTTTTTTTTGGG + Intronic
1162406844 19:10479845-10479867 TCTTTGGGCCTTCTATCTATGGG - Intergenic
1164163143 19:22643873-22643895 TCCTAGAGCCTCTTTTCTTTGGG + Intronic
1164299138 19:23944190-23944212 TCTTTTGACCATTTTTCTGTTGG + Intronic
1164834044 19:31345682-31345704 TGTTTGGTTTTTTTTTCTTTTGG + Intronic
1164944072 19:32275953-32275975 TCTTTGTAACTTTTTTTTTTAGG - Intergenic
1165213410 19:34253118-34253140 TCTTTGTGACTGGTTTCTTTTGG + Intergenic
1166162336 19:40964094-40964116 ACATTGTGCCTTTTTTTTTTTGG - Intergenic
1166414721 19:42586902-42586924 TCTTTTGTCCTTTTTTAGTTGGG - Intronic
1167614277 19:50523373-50523395 TCTTTTTCTCTTTTTTCTTTTGG - Intronic
1168232404 19:55041548-55041570 TCTTAGGGCCTTCTCTCTTATGG + Intronic
925319768 2:2953646-2953668 TTCTGGGGTCTTTTTTCTTTTGG - Intergenic
925367516 2:3320744-3320766 TCTTTTGGTCCTTTTTCTTTTGG - Intronic
925754318 2:7119278-7119300 ATGTTGGGCCTTTTCTCTTTTGG - Intergenic
926057794 2:9785801-9785823 TCTTTTGGGTTTTTTTTTTTTGG + Intergenic
926390802 2:12390619-12390641 TCAGTGGTCCTTTTTTCTTGTGG + Intergenic
926787526 2:16532927-16532949 TCTTTAAACCTTTATTCTTTTGG - Intergenic
926939673 2:18121720-18121742 TTTTGGGGGCTTTTTTTTTTTGG - Intronic
927486237 2:23490172-23490194 TTTTTGTGCCTTTTTACTTCTGG + Intronic
927644489 2:24868689-24868711 TCATTGCCTCTTTTTTCTTTGGG - Intronic
928114852 2:28539275-28539297 TCCTTTGGCCTCTGTTCTTTAGG - Intronic
928257154 2:29732705-29732727 CTTTTGGGCCTCTTTTCTGTGGG - Intronic
928691831 2:33807783-33807805 TCTTTGGGCCATTTTCCATTGGG + Intergenic
928703276 2:33920560-33920582 TCTTTGTGTCTTTGTTCCTTTGG - Intergenic
928734071 2:34265372-34265394 TTTTTGGGTTTTTTTTTTTTTGG - Intergenic
929016126 2:37497428-37497450 CCTTTGGGGCATTTTTCTTGTGG + Intergenic
929821704 2:45279381-45279403 TCCTTTGTCCATTTTTCTTTTGG + Intergenic
929891469 2:45922064-45922086 TCTATGGGACTATTTTCTTAAGG + Intronic
929892834 2:45933144-45933166 TCTTTTGCCCATTTTTCTATTGG + Intronic
930324061 2:49891193-49891215 TCTTTGGCCCATTTTTAATTAGG + Intergenic
930985125 2:57576392-57576414 CCTTTGGGCCTATTTTATGTGGG + Intergenic
931013056 2:57940885-57940907 TATTTGGGTCTTTTTTTTTTTGG - Intronic
931659269 2:64543205-64543227 TATTTTGGCCATTTTTCTGTTGG + Intronic
931705764 2:64944927-64944949 TCATTGTACCTTTTTTCTTGGGG - Intergenic
931752447 2:65341872-65341894 TCTTTGGTCTTTTTGTTTTTAGG - Intronic
932112785 2:69016387-69016409 TATTTGGATTTTTTTTCTTTAGG - Intronic
932165575 2:69503273-69503295 TCTTTCTGCCTGCTTTCTTTAGG - Intronic
933384155 2:81589081-81589103 TATTTGGTCCTTTTCTTTTTTGG - Intergenic
933505061 2:83166405-83166427 ACTTTGGGGTTTTTTTTTTTTGG + Intergenic
933873076 2:86589095-86589117 TCTTTTGCCCATTTTTCTATTGG - Intronic
933941433 2:87248226-87248248 TCTTTGGATCTTTTTTCCTGAGG + Intergenic
934111687 2:88749423-88749445 TCTTTTGCCCATTTTTCTATGGG + Intronic
935149976 2:100425076-100425098 TCTTTATGCTTTTCTTCTTTGGG - Intergenic
935317708 2:101853079-101853101 ACTTGGGGCCTTATTTCCTTTGG - Intronic
935450162 2:103200448-103200470 TCTTTGGGTCTTTGTTCTGAAGG - Intergenic
935503081 2:103866076-103866098 TCTTTAAGCCTCTTATCTTTGGG + Intergenic
936017634 2:108971841-108971863 TCTTCTGCCCTTTTTTCTGTTGG - Intronic
936253300 2:110886057-110886079 TTTTTGGGATTTTTATCTTTTGG + Intronic
936338791 2:111613365-111613387 TCTTTGGATCTTTTTTCCTGAGG - Intergenic
936583408 2:113727532-113727554 TCATTGGGACTTTTGTCTCTAGG - Intronic
936717146 2:115200895-115200917 TCTATGAGCATTATTTCTTTGGG - Intronic
936929598 2:117774043-117774065 TCTCTGGACCATTTTTCTTTTGG - Intergenic
936982591 2:118277961-118277983 TCTTTGGGCCTTTGTTCTGAAGG + Intergenic
937092194 2:119213810-119213832 TCTTTGTCGCTTTTTTCTTAGGG - Intergenic
938007962 2:127803971-127803993 TATTTGGCCCTTATTGCTTTTGG - Intronic
938171972 2:129086977-129086999 TCTTTAGCTCATTTTTCTTTTGG + Intergenic
938508346 2:131911292-131911314 TGTTTGGCCCTATTTTCTTAGGG - Intergenic
938685990 2:133738234-133738256 CCTCTTAGCCTTTTTTCTTTCGG - Intergenic
939089444 2:137761829-137761851 TATTTGGGCACTTTTTTTTTTGG - Intergenic
939177832 2:138770123-138770145 CATTTGGGCCTTTTTGTTTTGGG - Intronic
939297930 2:140294390-140294412 TCTTTGTTCCTTTGTTCATTTGG + Intronic
940194315 2:151076449-151076471 TCTTTTGGCCATTTGTCTTCAGG - Intergenic
940211353 2:151259137-151259159 TCTTTCTTCCTTTTTTTTTTTGG - Intronic
940797280 2:158093552-158093574 TCTTTGCCCGTATTTTCTTTTGG - Intronic
941885522 2:170523571-170523593 TCTTTGGACCTTTTGTCTCGAGG - Intronic
942049729 2:172128154-172128176 TCTTTGCACCTTTTTTTTTTTGG + Intergenic
942212570 2:173686311-173686333 TTTATGGGCCTTTTCTCTGTAGG - Intergenic
942214591 2:173706049-173706071 TCTCTGGGACTTGTTTCTTCTGG - Intergenic
942394167 2:175528655-175528677 ACTTGGAGGCTTTTTTCTTTTGG + Intergenic
942416692 2:175766930-175766952 TCATTAGGCCTTCTTTCTTTGGG - Intergenic
942763526 2:179427814-179427836 CCTTTGGGCCCTTCCTCTTTGGG + Intergenic
942874173 2:180772999-180773021 TCATAAGGCCTTTTTTTTTTAGG - Intergenic
943026070 2:182630034-182630056 TCTTTTGCCCATTTTTCTATTGG + Intergenic
943631726 2:190261234-190261256 TTTTTTTGCCTTTTTTCTCTAGG - Exonic
943815835 2:192253174-192253196 CCCTTGGGCCTTTTTTTTTTTGG - Intergenic
945007101 2:205420345-205420367 TCATTTAGCCTTTTTCCTTTGGG + Intronic
945130329 2:206564044-206564066 TCTTTGTGACTTGTTTGTTTAGG + Intronic
945215174 2:207425741-207425763 TCTTTTGCCCATTTTTCTATTGG + Intergenic
945364749 2:208938242-208938264 TCTTATGGACTTTTTTTTTTAGG + Intergenic
945934201 2:215886523-215886545 TCTTTGTGGCTTTCTTATTTAGG - Intergenic
946211944 2:218154375-218154397 TCTTTGGGTCTTTTTTTTTTGGG + Intergenic
947107087 2:226678926-226678948 TGTTTGGTAATTTTTTCTTTTGG - Intergenic
947320044 2:228907222-228907244 CCTTTGTGCATTTTTTCATTGGG - Intronic
947526931 2:230883182-230883204 TCTTTGGCCTATTTTTCTATTGG + Intergenic
1169177795 20:3533693-3533715 TCTTTGGGTTTTTTTTATCTTGG + Intronic
1169451589 20:5716515-5716537 TCTAAGGGTCTTTTTTTTTTGGG + Intergenic
1169870942 20:10247554-10247576 CCTCTTGGCCTATTTTCTTTTGG + Intronic
1169874748 20:10284592-10284614 ACTTTCTCCCTTTTTTCTTTTGG + Intronic
1170274036 20:14563273-14563295 TCTTGTGTCTTTTTTTCTTTTGG - Intronic
1170993803 20:21331829-21331851 TCTTTGGGATTTGCTTCTTTTGG + Intronic
1171215999 20:23352703-23352725 GCTTTTGGACTTTTTTATTTGGG + Intronic
1171402210 20:24881377-24881399 TCTGTTGGACTTTTGTCTTTGGG - Intergenic
1172042317 20:32053988-32054010 TTTATGGTCCTTTTTTTTTTAGG + Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172454572 20:35058542-35058564 TCTTTGGCCCATTATTATTTAGG - Intronic
1172622021 20:36324042-36324064 TCTTTGGGTGTATTTTCTTTTGG + Intronic
1173784417 20:45782352-45782374 TTTTGGGGGCTTTTTTGTTTTGG + Intronic
1174870252 20:54174491-54174513 TTTTTTTGCCTTTTTTTTTTTGG + Intergenic
1176785147 21:13247271-13247293 TGTTTGGCCCTATTTTCTTAGGG + Intergenic
1176995251 21:15547989-15548011 TCTTTTGTCCATTTTTCTATAGG - Intergenic
1177073048 21:16535067-16535089 TAGTTGGGTCTTTTTTTTTTTGG + Intergenic
1177816579 21:25984412-25984434 ACTTTCGGCCTTTTTTATGTGGG - Intronic
1178547411 21:33504021-33504043 TCTTTTAGCAGTTTTTCTTTTGG + Exonic
1178792460 21:35712898-35712920 TCTCTGAGTCTTTTTTTTTTTGG - Intronic
1178859627 21:36277953-36277975 TCTTAGGGCCTTGTTCTTTTAGG + Exonic
1179333610 21:40429262-40429284 TTTTTGTGCTTTTTTTTTTTTGG + Intronic
1179339913 21:40496809-40496831 TCTTTGGCCATTTTTTAATTAGG - Intronic
1179634269 21:42697220-42697242 ACTTTGGGCCCTTTGTCTGTAGG - Intronic
1179668378 21:42928122-42928144 TCTTTGTACCTGTTTTATTTAGG + Intergenic
1180477736 22:15726805-15726827 TTTTTTGGGGTTTTTTCTTTTGG - Intergenic
1184163165 22:42711138-42711160 TCTTTGGCCCATTTTGTTTTGGG - Intronic
1184819214 22:46896186-46896208 CCTTTTGCCCATTTTTCTTTTGG + Intronic
1184941418 22:47768540-47768562 TCTTTGGGCTTATTGTCTCTGGG - Intergenic
1185007227 22:48288040-48288062 TCTTTTCGCCGTTTTCCTTTTGG - Intergenic
949381578 3:3452137-3452159 TATTTTGTCCATTTTTCTTTTGG + Intergenic
950616368 3:14162731-14162753 TCTTTTGTTCTTTTTGCTTTTGG - Intronic
950894500 3:16436225-16436247 TCATTGGGCTTTTTTTCTATTGG + Intronic
951350429 3:21600786-21600808 TCTCAGAGCTTTTTTTCTTTTGG - Intronic
952274156 3:31860849-31860871 TTTTTGGGGTTTTTTTTTTTGGG + Intronic
952988468 3:38809646-38809668 TCTTTGGGCATCTTCTCTTCTGG + Intergenic
953334563 3:42083275-42083297 TCCTTTGCCCATTTTTCTTTTGG + Intronic
953676215 3:45004728-45004750 TCTTTTGTCCATTTTTCTGTTGG + Intronic
953707156 3:45240057-45240079 TCTGTGATCCTTTTTTCTGTTGG - Intergenic
954280687 3:49575013-49575035 TCTTCTGGAATTTTTTCTTTTGG + Intronic
954503099 3:51039641-51039663 TCTTTTGTCTATTTTTCTTTTGG + Intronic
954592068 3:51791449-51791471 TCTTTTGGCCATTTTTCTATTGG + Intergenic
954731648 3:52667944-52667966 TCTTTTGCCCATTTTTCTCTTGG - Intronic
954763332 3:52893370-52893392 TCTTTATGCTTTTTTTTTTTTGG - Intronic
955359664 3:58262455-58262477 TCTTTGGGGCTTTTCTATTTAGG + Intronic
955489010 3:59463849-59463871 TCTTTGGGTCTTTATTCTGAAGG + Intergenic
955645540 3:61133654-61133676 TCTTTGAGCCTCTTTTCTTCTGG - Intronic
955907561 3:63823577-63823599 TATTTGGGCAATTTGTCTTTGGG + Intronic
956634658 3:71351846-71351868 TCTTTGAGTCATTTTTCTCTGGG - Intronic
957697840 3:83665734-83665756 TCTCTGTGACTTTTTTTTTTAGG - Intergenic
957711869 3:83871401-83871423 TCTTTGGCCCATTTTTAATTAGG - Intergenic
958501909 3:94921868-94921890 GCTATGTGCCTTTTCTCTTTGGG + Intergenic
958611631 3:96433928-96433950 CCTTAGGGCATTTTTCCTTTTGG - Intergenic
959728050 3:109567943-109567965 TCTTTGGGCTTGTTCTGTTTGGG + Intergenic
959740906 3:109718594-109718616 TCTTTCTTCTTTTTTTCTTTTGG - Intergenic
959747053 3:109787748-109787770 TCTCTGGTCCTTTTTGTTTTAGG + Intergenic
960635395 3:119780165-119780187 TCTTTGGGTCTCTTTTCCTTTGG - Intergenic
960865814 3:122199335-122199357 TCTTTGGGCATTTTATCCTAAGG + Intronic
961866467 3:129956957-129956979 TTTTTGAGCCTGTTTTCTTGTGG + Intergenic
961939317 3:130621171-130621193 TCTTAAGGCTTTCTTTCTTTAGG + Intronic
961987111 3:131146854-131146876 TCTTTTGCCCATTTTTCTATTGG + Intronic
962094366 3:132278124-132278146 TCTTTGGGTCTTCATTCTGTAGG + Intronic
962223949 3:133588789-133588811 TCTTGGGGGTTTTTTTTTTTTGG + Exonic
962373132 3:134837690-134837712 TCTTTTGGACTTCGTTCTTTTGG - Intronic
962757981 3:138482132-138482154 TCTTTTGCCCATTTTTCTATTGG - Intergenic
963190010 3:142459419-142459441 ACTTTGCCCCTTTTTTCATTTGG - Intronic
964077502 3:152709463-152709485 TTTTTGGGGTTTTTTTTTTTTGG - Intergenic
964479568 3:157128126-157128148 CCTTTGCTCCTTTTATCTTTTGG + Intergenic
964943922 3:162195203-162195225 GCTTTGGGTCTTTCTTCATTTGG + Intergenic
965151768 3:164986601-164986623 TCTTTGGGCCTTTATTCTGAAGG + Intronic
965823484 3:172708088-172708110 TCATTGTGCTTTTTTTCCTTGGG - Intronic
966043322 3:175518914-175518936 TCTTTGGGTCTTTATTCTGAAGG - Intronic
966313584 3:178621378-178621400 TCTTTGTTCATTATTTCTTTGGG + Intronic
966313586 3:178621431-178621453 TCTTTGTTCATTATTTCTTTGGG + Intronic
966313592 3:178621498-178621520 TCTTTGTTCATTATTTCTTTGGG + Intronic
966354727 3:179067923-179067945 TCTTTGGGACTTCTTTCCTTTGG + Intronic
966474036 3:180323496-180323518 TCTTTATGCTTTTCTTCTTTGGG - Intergenic
966751749 3:183328847-183328869 TCTTTTGCCCTTTTTTAATTGGG - Intronic
967154758 3:186682254-186682276 TCTTTGGGCCTTCATTCTGAAGG - Intergenic
967156347 3:186696055-186696077 TCTTTGGGCCTTCATTCTAAAGG - Intergenic
967483119 3:189997966-189997988 CTTTTGAGCATTTTTTCTTTAGG - Intronic
967722791 3:192833032-192833054 CCTTTAGACCTTTTTTTTTTTGG + Intronic
967870772 3:194227112-194227134 TCTTTTGGCCTTGTTAATTTTGG - Intergenic
968638403 4:1695772-1695794 TCTGTTGGCTTTTTTTTTTTGGG - Intronic
968846100 4:3042298-3042320 ACTTGGGGTCTTTATTCTTTGGG + Intergenic
969782217 4:9415241-9415263 TTTGTGGGGCTTTTTTGTTTAGG + Intergenic
970083802 4:12322009-12322031 TTTTTTGTTCTTTTTTCTTTTGG + Intergenic
970530665 4:16979029-16979051 TCTTTTTTTCTTTTTTCTTTCGG - Intergenic
971568020 4:28169903-28169925 TAAGTGGGCCTTTTTTATTTTGG + Intergenic
971813114 4:31453343-31453365 TCTTTTTTCCTTTTTTCTTAAGG + Intergenic
972037680 4:34547206-34547228 ACTTTGGGTATTTTTCCTTTGGG + Intergenic
972513028 4:39787108-39787130 TCACTGGGCCTTTTCTCTTTGGG + Intergenic
972655824 4:41062712-41062734 ACTTTGTGCCTTTTTTCTGGTGG - Intronic
972865547 4:43227869-43227891 TCTTTGGGGCTTTATCCTTTCGG + Intergenic
973144533 4:46808301-46808323 TCTTAGGGTCTTTTTTAGTTAGG + Intronic
973232887 4:47862792-47862814 TCCTTGGGCATTGTTTCTCTTGG - Intronic
973596123 4:52492089-52492111 TATTTGGGTCTTCTTTTTTTTGG - Intergenic
974180494 4:58378957-58378979 TTTTTATTCCTTTTTTCTTTTGG + Intergenic
974227396 4:59064638-59064660 TCTTTGGCCCTTTTATGTTTGGG - Intergenic
974302959 4:60093331-60093353 TCTTTTGTCCTTTTTTAATTAGG - Intergenic
974493138 4:62592209-62592231 TCATTGGGGTTTTTTTTTTTTGG + Intergenic
975771134 4:77724096-77724118 TATTTGAGGGTTTTTTCTTTTGG - Intronic
976698498 4:87943776-87943798 TCTGTATGCCTTTTTTCTTCAGG - Intergenic
976796415 4:88938925-88938947 TCTTTTGTCTCTTTTTCTTTTGG - Intronic
976817746 4:89169752-89169774 TCTTTTGTCCATTTTTCTGTTGG - Intergenic
977105641 4:92880718-92880740 TCTTTCTTCCTTTTTTATTTTGG + Intronic
977258879 4:94773316-94773338 TCTTTGTATCTTTTTTCTTCTGG + Intronic
978253403 4:106661412-106661434 GCTTTGGGGTTTTTTTGTTTTGG - Intergenic
978288479 4:107108287-107108309 GCTTTGGGCTTGTTTTCTCTTGG - Intronic
978569096 4:110117025-110117047 TCTGTGGACCTCTTCTCTTTTGG + Intronic
978744862 4:112181325-112181347 ACTTTGCTCCTTTTTTTTTTTGG - Intronic
979186908 4:117808083-117808105 TCTTTGGGTCTTTATTCTGAAGG + Intergenic
979266292 4:118706901-118706923 TCTTTGGCCCATTTTTTATTTGG + Intronic
979544624 4:121925870-121925892 TCTTTGATCCTTTGGTCTTTTGG - Intronic
979762243 4:124420494-124420516 TCTTTGGGCCTTTGTTCTGAAGG + Intergenic
980008819 4:127572128-127572150 TCATTGGCCCATTTTTCTGTTGG + Intergenic
980165362 4:129220099-129220121 TCTTTGAGACTTTTTTCCATAGG - Intergenic
980449531 4:132951673-132951695 TTTTTGGTCCTTCTTTCTGTTGG - Intergenic
980890014 4:138804693-138804715 TCTTAGGGTCTTGTTTCTCTTGG - Intergenic
981411427 4:144436594-144436616 TCTTTGGGTTGTTTTTCTTGAGG - Intergenic
981736732 4:147961362-147961384 TCTTTTGCCCTTTTGTCTGTTGG + Intronic
981829909 4:148987401-148987423 TCCTTTGACCTTTTTGCTTTGGG - Intergenic
981834075 4:149034855-149034877 TCTTTTTGCCTATTTTCTGTTGG - Intergenic
982925126 4:161327483-161327505 TCTTGGGACATTTTATCTTTTGG - Intergenic
983300349 4:165917408-165917430 TCTTTGAGCCTTTTTTTCCTTGG + Intronic
983347037 4:166539985-166540007 TTTTTGATACTTTTTTCTTTGGG - Intergenic
984443340 4:179801381-179801403 TCTTTGGTCATTTTATCTTTAGG - Intergenic
984555810 4:181212721-181212743 TAATTGGGCTTTTTTTTTTTAGG + Intergenic
985105439 4:186494819-186494841 TCTGTGTGCCTTTTTTTTTCTGG - Intronic
985715339 5:1455714-1455736 TCTTTGGTTCTGTTTTCTATGGG + Intergenic
986301032 5:6478615-6478637 TCTTTCGGTTTTTTTTTTTTTGG + Intronic
986376159 5:7133770-7133792 TCTTTTGCCCATTTTTCTATTGG + Intergenic
986481364 5:8191285-8191307 TCTTAGGGCCTCTTTTCATCTGG - Intergenic
986570581 5:9160500-9160522 TATGTGGTCCTTGTTTCTTTAGG - Intronic
986581174 5:9267391-9267413 TCTTTGGTCCACTTTACTTTAGG + Intronic
986634096 5:9802532-9802554 TCTTTGGACCTATGATCTTTTGG - Intergenic
986892981 5:12331593-12331615 ACTTTGTGAATTTTTTCTTTGGG - Intergenic
987136055 5:14900688-14900710 CCTCTGGGCTTATTTTCTTTTGG + Intergenic
987259502 5:16189160-16189182 TCTTTAGGCCTTTATTCTAAAGG - Intergenic
987306933 5:16645877-16645899 TCTTTAGGCCTTTATTCTAAAGG + Intergenic
987489698 5:18563015-18563037 TATTTAGGCTGTTTTTCTTTTGG + Intergenic
987503626 5:18744041-18744063 TCTTTGGGTCTGGTTCCTTTTGG + Intergenic
987857841 5:23444177-23444199 TCTTTGGCCAGTTTTTCATTTGG - Intergenic
988464898 5:31480147-31480169 TCTTTTGCCCGTTTTTCTATTGG + Intronic
988961042 5:36372137-36372159 TCTTTGGGTCTTTATTCTGAAGG - Intergenic
989146293 5:38253452-38253474 TCTTTTGCCCATTTTTCTATTGG - Intergenic
989417088 5:41191784-41191806 TTCTAGGGCCTTTTTTTTTTTGG + Intronic
989490802 5:42050060-42050082 TATTTGGGACTTTAATCTTTTGG + Intergenic
989640655 5:43579369-43579391 CCTTTCTGCCTTTTTTCTTTGGG - Intergenic
989667205 5:43868505-43868527 TATGTGGGCCTTCTTTATTTTGG - Intergenic
989701361 5:44268978-44269000 TCTTTGGGTCTTACTTTTTTGGG - Intergenic
990420971 5:55632936-55632958 TCTTTGGGTCTTCTTTCTAAAGG + Intronic
990614149 5:57489939-57489961 TCTATGGTCCTTTTTCTTTTGGG + Intergenic
990726312 5:58758848-58758870 TCCTTGGACTTTTTTTTTTTTGG + Intronic
991281091 5:64914451-64914473 TCTCTTGCCCGTTTTTCTTTGGG - Intronic
991388728 5:66119040-66119062 TCTCTGGGCATCTTTTATTTTGG + Intergenic
991905836 5:71509906-71509928 CCTCTGGGCCATTTTTCTGTGGG - Exonic
992189638 5:74278753-74278775 TCTTTGGGTTTATTCTCTTTGGG + Intergenic
992628459 5:78656975-78656997 TCTTTTGGCATTTATTCTTCTGG - Intronic
992705054 5:79381884-79381906 TCTTTGTACTTTTTTTTTTTTGG - Intronic
992794763 5:80245421-80245443 GCTTTGCACCTTTTATCTTTTGG - Intronic
992817598 5:80460300-80460322 TCTTTTGCGCTTTTTTCTATTGG + Intronic
993943295 5:94088043-94088065 TCTTTGGGACATATTTCTTAGGG + Intronic
994023159 5:95051330-95051352 TCTATGGGACTTCATTCTTTGGG - Intronic
994861819 5:105205660-105205682 TCTTTCAGCATTTTCTCTTTTGG + Intergenic
995148363 5:108811768-108811790 TTTTTGGGCCTTCTTACTCTGGG - Intronic
995795161 5:115933411-115933433 TCTTTGGGATTTTTTACTTGGGG - Intergenic
995892237 5:116967481-116967503 TCATTGGGACTTTTTGTTTTTGG + Intergenic
996836379 5:127797895-127797917 TATTTGTGTGTTTTTTCTTTGGG + Intergenic
996918745 5:128742264-128742286 TCTTTGTACCTTTTATTTTTAGG + Intronic
997184542 5:131868497-131868519 TCTTTGGCCCATTTTTCACTGGG + Intronic
998356287 5:141539388-141539410 TATCTGGGCCTTTTCTTTTTGGG + Intronic
998518223 5:142775424-142775446 TCTTTTGCCCATTTTTATTTGGG + Intronic
998618468 5:143767859-143767881 TCTATGGTCTTTTTTTCTTGGGG - Intergenic
998905110 5:146896679-146896701 TCTTTCTTCCTTTTTTTTTTCGG + Intronic
999663028 5:153885285-153885307 GCTGTGGGGTTTTTTTCTTTGGG - Intergenic
999808316 5:155104577-155104599 TCTCTGGGCCTTAGTTCTCTTGG + Intergenic
999966733 5:156818488-156818510 TCTTTGGGTCTTCATTCTTTAGG + Intergenic
1000700948 5:164449041-164449063 TCTTTGGTCAGTTTTTTTTTGGG + Intergenic
1000967375 5:167674334-167674356 TCTTTGAACGTTTATTCTTTAGG + Intronic
1000980206 5:167808676-167808698 TCTTTCAGCCTTTGTTATTTTGG + Intronic
1001094128 5:168762938-168762960 TCTGTGGGCCCTTATGCTTTTGG + Intronic
1001630408 5:173170852-173170874 TCTTTGGGCCTCTTTTATAAGGG - Intergenic
1003451135 6:6232986-6233008 TCCTTTGGTCTTTTTTCTGTAGG - Intronic
1003745001 6:8990913-8990935 TCTTTGGGCTTTTTTACATATGG - Intergenic
1003978731 6:11369342-11369364 TCTTTTGACCATTTTTGTTTTGG - Intronic
1004099109 6:12590903-12590925 TCTTTTGCCCATTTTTCTATTGG - Intergenic
1004146535 6:13072721-13072743 TATTTGTACTTTTTTTCTTTGGG + Intronic
1004231071 6:13833875-13833897 CCTTTTTGTCTTTTTTCTTTGGG + Intergenic
1004361569 6:14975977-14975999 TCTTTCTTCCTTTTTTTTTTTGG + Intergenic
1004987822 6:21102601-21102623 TCTTTCGGCCCTTTTGCCTTAGG + Intronic
1005125620 6:22443401-22443423 TTTTTTGGGTTTTTTTCTTTGGG + Intergenic
1005625704 6:27660403-27660425 TCTTTGGCCATTTTTTCATGGGG - Intergenic
1006047547 6:31309733-31309755 TCTTTAGGTCCTTTTTCTTGAGG + Intronic
1006229601 6:32572136-32572158 TCTTTGGATTTCTTTTCTTTTGG + Intronic
1006237269 6:32644886-32644908 TCTTTATGCCTGTTTACTTTGGG + Intronic
1006291480 6:33140907-33140929 TCTTTGGGCTTCGTTTCTGTAGG - Intergenic
1006747979 6:36358371-36358393 TCAAAGGCCCTTTTTTCTTTTGG + Intronic
1006891045 6:37428881-37428903 TCTTTGGGCATTTACTGTTTGGG + Intergenic
1006979736 6:38137561-38137583 TCTTGGTGCTTTTATTCTTTAGG + Intronic
1007234837 6:40383236-40383258 TTCTTGGGGCTTTTTTCTTGAGG - Intergenic
1007343078 6:41205307-41205329 TCTTTGGGCTTATTATATTTGGG + Intergenic
1007364331 6:41380496-41380518 TCTCTGGGCCTTTTTTATAAGGG + Intergenic
1007582945 6:42969987-42970009 TCATTGGGCCTTTTTCCTGCAGG - Exonic
1008005190 6:46402801-46402823 TCTTTGGGTCTTTATTCTGAAGG + Intronic
1008279315 6:49576972-49576994 TCTTTGGGTCTTCTTTCTGAAGG + Intergenic
1008867731 6:56234835-56234857 TCTTTTGGCCTTTTGGTTTTTGG + Intronic
1009241492 6:61191708-61191730 TCTTTGGGTCTTCTTACTCTTGG + Intergenic
1009443797 6:63715301-63715323 ACTTTGGTCCACTTTTCTTTTGG + Exonic
1010462834 6:76132747-76132769 TCTTGGGGCCTTTTCTATTCAGG + Intergenic
1010599487 6:77806098-77806120 TCCTTAGTCCTCTTTTCTTTTGG - Intronic
1010696641 6:78982899-78982921 TCTTTGGGCTTCTTTTTCTTTGG + Exonic
1010765555 6:79774451-79774473 TCTCTGGGCCTCTTTTATTTGGG + Intergenic
1011837400 6:91450360-91450382 TCTTTGGGTCTTGTTTCTGAAGG + Intergenic
1011994825 6:93572635-93572657 CCTTTTGGCCTTTGTTCTCTAGG - Intergenic
1012082335 6:94776302-94776324 TATTTAGGTCTTTTTTATTTTGG + Intergenic
1012122998 6:95390350-95390372 TCTTTGGCCCATTTTTCATTGGG + Intergenic
1013840966 6:114393272-114393294 TTTTTCTGGCTTTTTTCTTTTGG + Intergenic
1014296413 6:119623841-119623863 TATTTAGGCCTTCTTCCTTTAGG - Intergenic
1014640414 6:123902358-123902380 TTTTTTAGCCTTTTTTATTTTGG - Intronic
1014711992 6:124817234-124817256 TTTTTTGGCATTTTTTTTTTTGG + Intronic
1014827993 6:126068126-126068148 TCTTTGGCTCATTTTTCTATTGG + Intergenic
1014930014 6:127324739-127324761 ACTTTGGGTCTTTGGTCTTTGGG + Intronic
1015331285 6:131982130-131982152 TCTTTGGGACTTATTTATTAGGG + Intergenic
1015588113 6:134796790-134796812 TCTCTGGGCCTTTTGGCTTATGG - Intergenic
1015910048 6:138161349-138161371 TCTCTGGGCCTGGTTTCCTTGGG + Intergenic
1016565904 6:145453485-145453507 TGTTTGGTTTTTTTTTCTTTTGG - Intergenic
1016617954 6:146074692-146074714 TCTTTGGCCCCTTTTGCTTTTGG + Intronic
1017456775 6:154607723-154607745 CCTTGGGGCCTCCTTTCTTTAGG + Intergenic
1017555746 6:155565043-155565065 TCTTTGGCCCATTTTTCAATTGG + Intergenic
1017739232 6:157391697-157391719 GCTATTGGCCTTTTTTCTCTTGG + Intronic
1018020003 6:159753238-159753260 TGTTTGGGCACTTTTTGTTTAGG + Intronic
1018090858 6:160346611-160346633 TCTTTGGGCCTTCCTTCTGAAGG - Intergenic
1018188051 6:161285208-161285230 TCTTTGGGATTTAATTCTTTGGG - Intergenic
1018859607 6:167701407-167701429 TTTTTGAGTCTTTTTTCTTTAGG - Intergenic
1019111480 6:169719983-169720005 TCTTTGTCCATTTTTTATTTGGG - Intronic
1020647449 7:10832123-10832145 TGTTTGTGTCTTTTTTTTTTGGG - Intergenic
1020793490 7:12655430-12655452 TCTTTTGGCCATTTTTCCATTGG - Intergenic
1021213804 7:17890109-17890131 TGTTTGGTAGTTTTTTCTTTAGG - Intronic
1021566930 7:22025527-22025549 TCTTTGGGCCTATATGATTTGGG - Intergenic
1021969495 7:25951876-25951898 TCTTTGGCCTCTTTTTATTTGGG - Intergenic
1022169406 7:27809901-27809923 CTTTTGTGCCTTTTTTTTTTTGG + Intronic
1022176032 7:27872763-27872785 TCTTTGGGGCTTTCTTCTTCAGG + Intronic
1023037501 7:36146040-36146062 TCTTTTTTTCTTTTTTCTTTTGG - Intergenic
1023120844 7:36906777-36906799 TCTAAGCGCCTTTTTTTTTTGGG - Intronic
1023202141 7:37710177-37710199 TGTTTGGATTTTTTTTCTTTTGG + Intronic
1023756343 7:43421595-43421617 TCTTTGTTCCATTTTTCTGTTGG - Intronic
1023846558 7:44123989-44124011 GCCTTGGGCCTTCTTTCTGTTGG - Intronic
1024292918 7:47818554-47818576 CCATTGGGCCTTTTGGCTTTGGG - Intronic
1024653112 7:51425704-51425726 TTTTTTGGCATTTTTTTTTTTGG + Intergenic
1024769515 7:52703123-52703145 TCTATTGACATTTTTTCTTTTGG - Intergenic
1024844415 7:53625115-53625137 TCTCTACTCCTTTTTTCTTTGGG + Intergenic
1025295571 7:57773216-57773238 CCTGTGGGGCTTTTGTCTTTGGG - Intergenic
1025778598 7:64579590-64579612 TGTTTGGGTTTTTTGTCTTTGGG - Intergenic
1026071613 7:67126305-67126327 TCTTTGGCCCATTTTTAATTGGG + Intronic
1026385756 7:69846090-69846112 TATTTGGGATTTTTTTTTTTTGG + Intronic
1026410905 7:70121500-70121522 TCTTTGCCCATTTTTGCTTTAGG - Intronic
1026425042 7:70282523-70282545 TCCTAGGGCCTTTTTTCTAAAGG + Intronic
1026705282 7:72685958-72685980 TCTTTGGCCCATTTTTAATTGGG - Intronic
1027553441 7:79631923-79631945 TATTTGGGATTTTTTTTTTTTGG + Intergenic
1027968964 7:85052160-85052182 TCTTTGTTCCTGTTATCTTTAGG + Intronic
1028125107 7:87104061-87104083 TCTCTTGGCCTTCTTTCTTGGGG + Intergenic
1028350846 7:89845710-89845732 TCTTTGGGACATCTTTATTTAGG - Intergenic
1028616196 7:92770075-92770097 TCTTTGGGTCTGTTTACTTGTGG - Intronic
1028843988 7:95459772-95459794 TCTTGGGGGCTATTTTCTGTCGG + Intergenic
1028861595 7:95658163-95658185 TGTTTGTGCTTTTTTTTTTTGGG + Intergenic
1029718165 7:102344572-102344594 TTTTTGGTCTTTTTTTTTTTGGG - Intergenic
1029830973 7:103258787-103258809 TCCCTGGGCTTTTTTTTTTTGGG + Intergenic
1030750123 7:113222234-113222256 CCTTTGGCCCATGTTTCTTTTGG + Intergenic
1031172761 7:118312643-118312665 TCTTTGGGTCTTTATTCTGCAGG - Intergenic
1031604586 7:123753081-123753103 TCTTTGGGGCTTTCTTTTTTAGG + Intergenic
1031700834 7:124924155-124924177 CCTTTGGGTTTTTTTTTTTTTGG - Intronic
1032301764 7:130694197-130694219 TATTTGGGCTTTGGTTCTTTGGG + Intergenic
1032405293 7:131651478-131651500 TCTTTCTTTCTTTTTTCTTTGGG + Intergenic
1032699576 7:134367075-134367097 TCTGTTTGCCTTTTCTCTTTAGG - Intergenic
1032771143 7:135058391-135058413 TGTTTGACCCTTTTTTCTTGAGG + Intronic
1032774776 7:135100661-135100683 TCTTTGGGCCTACTTTCACTTGG + Intronic
1032849182 7:135778704-135778726 TATTTGGGTTTTTTTTTTTTTGG - Intergenic
1033713137 7:143970114-143970136 TCTTTGCCCATTTTTCCTTTGGG + Intergenic
1034056867 7:148044554-148044576 TCCTTGGGCCTCTTTTGTCTGGG - Intronic
1034249117 7:149674177-149674199 TCTTAGGGGCGTTTTTCCTTTGG - Intergenic
1034383107 7:150716280-150716302 TCTCTGGGCCTATTTTATATGGG + Intergenic
1034395573 7:150821855-150821877 TCTTTGGCAATTTTTTCTGTTGG - Intergenic
1034420488 7:150988108-150988130 TCTCTGGGGTTTTTTTCTTAAGG + Intergenic
1035750917 8:1995635-1995657 GCTGTGGGCCTGTTTTCATTTGG + Intronic
1035810771 8:2489229-2489251 TCTTTGGGCCTTCATTCTGAAGG + Intergenic
1035814009 8:2519047-2519069 TTTTTGTTCTTTTTTTCTTTTGG + Intergenic
1036836913 8:12079202-12079224 TTTGTGGGGCTTTTTTGTTTAGG - Intergenic
1036858705 8:12325448-12325470 TTTGTGGGGCTTTTTTGTTTAGG - Intergenic
1037021678 8:13979335-13979357 GGTTTTGGCTTTTTTTCTTTTGG - Intergenic
1037116933 8:15237899-15237921 TTTTTTTTCCTTTTTTCTTTTGG - Exonic
1037243894 8:16808644-16808666 TCTTTAGGCATTTCTGCTTTTGG - Intergenic
1037298291 8:17424387-17424409 TCTTTGGGGTTTTTGTTTTTTGG - Intergenic
1037338218 8:17812875-17812897 TCTTTGGGTCTTTATTCTAAAGG - Intergenic
1037378905 8:18263304-18263326 TCTTTCTGCTTTTTCTCTTTTGG + Intergenic
1037749168 8:21668878-21668900 TCTTTGGGTCTTTATTCTGAAGG + Intergenic
1038086536 8:24203770-24203792 TCTTTGGACCTTGTGTCATTAGG + Intergenic
1038129653 8:24715745-24715767 TCTTTGGGCTCTTCTTCTTCTGG - Intergenic
1038323964 8:26557367-26557389 TCTTTGGCCCACTTTTCTATTGG - Intronic
1039078945 8:33717238-33717260 TTTTTGGGCTTTTTGTTTTTTGG - Intergenic
1039333286 8:36562326-36562348 TCTTTGGGCCTTCATTCTGAAGG + Intergenic
1039380677 8:37081990-37082012 TCTTTCTGCTTTTTTTCTTGTGG - Intergenic
1039841492 8:41296484-41296506 TCTTTGGCCATTTGTTCTTCTGG + Intronic
1040671801 8:49700628-49700650 TCTTTTTTACTTTTTTCTTTTGG - Intergenic
1041122242 8:54598954-54598976 TCTTTGGGTTTTTTGTCCTTGGG + Intergenic
1041337631 8:56805027-56805049 TCTTTGGGCTTCTCTTGTTTGGG - Intergenic
1041405268 8:57492017-57492039 TCTTTGGGATTTGTCTCTTTTGG - Intergenic
1041514081 8:58681260-58681282 TGTTTGGGTTTTTTTTTTTTTGG - Intergenic
1041523059 8:58776229-58776251 TATTTGGGCTTTTTTTGTTGGGG - Intergenic
1041685924 8:60644547-60644569 TTTTTGGGTTTTTTTTTTTTTGG + Intergenic
1042219372 8:66458443-66458465 TCTGTGTCCCTTTTCTCTTTCGG + Intronic
1042583077 8:70303911-70303933 TGTTGGGGCCTTTTTACTTGAGG - Intronic
1042602135 8:70509239-70509261 TCTTTTGCCCATTTTTCTATTGG + Intergenic
1042639496 8:70918135-70918157 TCTTTGGGTATTTTTTCTTGTGG + Intergenic
1043090006 8:75888826-75888848 TATTTTGGCATTTTGTCTTTAGG + Intergenic
1044858618 8:96499753-96499775 TCTCTTGGCCTTTTTTTTTTTGG + Intronic
1044943403 8:97366605-97366627 TCTTTTAATCTTTTTTCTTTCGG - Intergenic
1045133268 8:99182516-99182538 TTTTCAGTCCTTTTTTCTTTAGG - Intronic
1045274552 8:100691300-100691322 CCTTTTGGCCATTTTTCTATTGG - Intronic
1045562247 8:103275864-103275886 TCTTTTGGACTTGTTTCTTCTGG + Intergenic
1045616846 8:103924565-103924587 CCTTTGGACATTTTTGCTTTTGG + Intronic
1045945620 8:107792297-107792319 TATTTGGGTCTTCTTTCTTTTGG - Intergenic
1046111134 8:109726629-109726651 TATTTGGACTTTTTTTTTTTTGG - Intergenic
1046761550 8:118026688-118026710 TTTTTGGTTCTTTTATCTTTGGG + Intronic
1048113664 8:131496038-131496060 TTTTTGGCCCTTTTTTGGTTTGG - Intergenic
1048744994 8:137604557-137604579 TCTTCTGGCCTGATTTCTTTGGG - Intergenic
1049295543 8:141832873-141832895 TATTTGGGCCATTTTTTCTTGGG + Intergenic
1050198633 9:3115791-3115813 TCCTTGGCCCATTTTTATTTGGG + Intergenic
1050201695 9:3151709-3151731 TCATCCGGCCTTTTTTGTTTTGG + Intergenic
1050908007 9:11029005-11029027 GCTTTGGGCCTTATATATTTGGG - Intergenic
1051115674 9:13691603-13691625 TCTTTTGCCCATTTTTATTTGGG + Intergenic
1051297115 9:15608609-15608631 ATTTTTTGCCTTTTTTCTTTTGG + Intronic
1051448871 9:17172494-17172516 TCTTTGGGCTATTTTGCTTATGG + Intronic
1051535388 9:18151751-18151773 GTTTTGGGCCTTTTGTGTTTTGG - Intergenic
1051766678 9:20532556-20532578 TCTCTTGGCCTTCTTTCCTTTGG - Intronic
1051817972 9:21132102-21132124 CCTTGGGGCCTGTTCTCTTTGGG - Intergenic
1052148669 9:25083683-25083705 TTTTTGGTCATTTATTCTTTGGG + Intergenic
1052279068 9:26712452-26712474 TCCTGGTGCCTTATTTCTTTGGG + Intergenic
1052310932 9:27068395-27068417 TCTTAGAGCCTTTTTTGGTTTGG - Intergenic
1052419231 9:28220856-28220878 TGTTTGGGTTTTTTTCCTTTGGG - Intronic
1052456179 9:28700978-28701000 TCTTTTGCCCACTTTTCTTTGGG + Intergenic
1052810889 9:33058941-33058963 TCTTTTGCCCATTTTTCTGTTGG - Intronic
1053248344 9:36553740-36553762 TCTGTGGGTTTTTTTTTTTTTGG - Intergenic
1054734247 9:68734445-68734467 GCTTTGAGCCTTTGTTCTTATGG - Intronic
1055487323 9:76768539-76768561 TCTCTGGGTCTCTTATCTTTGGG + Intronic
1055724032 9:79208291-79208313 TCATTGGCTCTTTTTTCCTTTGG - Intergenic
1055815801 9:80204180-80204202 TCTATGAGGCATTTTTCTTTTGG + Intergenic
1056121330 9:83492078-83492100 TCTATGGGACTTTTTCCCTTGGG - Intronic
1056352615 9:85766127-85766149 ACTTTGGGTTTTTTTTTTTTTGG - Intergenic
1056674062 9:88658248-88658270 CCTTTTGGTTTTTTTTCTTTAGG + Intergenic
1057318702 9:93991781-93991803 TCTTTGGGCCTTCATTCTAAAGG - Intergenic
1058101298 9:100920301-100920323 TAATTGGGACTTTTTTTTTTAGG + Intergenic
1058254982 9:102750453-102750475 TATTTGTGCCTTTTATGTTTTGG - Intergenic
1058593771 9:106593077-106593099 GCATTGGGCCTTATTCCTTTTGG - Intergenic
1058917499 9:109581747-109581769 TCTTTGGGACTTCTTTATTAAGG + Intergenic
1059266154 9:113033270-113033292 TTCTTGGTCCTTTTTTCTATTGG - Intergenic
1059714771 9:116903793-116903815 TTTTTGGACCTCTTTCCTTTGGG - Intronic
1059787775 9:117605283-117605305 TATTTGGGCCTTATTTTTGTTGG - Intergenic
1059909547 9:119027114-119027136 TCTTAGGGCTTTTTTTGGTTTGG + Intergenic
1061066675 9:128282552-128282574 TCGTTGGGCGCTTTCTCTTTGGG + Intronic
1061206912 9:129169794-129169816 TATATGTGCATTTTTTCTTTTGG + Intergenic
1061643549 9:131979883-131979905 TCTATGGGACTTCTTTCCTTAGG + Intronic
1061798720 9:133102960-133102982 TCTCTGGGTCTTTGTTCTTGGGG + Intronic
1062167097 9:135113317-135113339 TCTTATGGCCTTCTTCCTTTGGG + Intronic
1062200668 9:135301093-135301115 TCTTTGGGACTTTTGACTTGAGG - Intergenic
1062248113 9:135580316-135580338 TCTTTGGGCCTGTTATTTTCTGG - Intergenic
1185924008 X:4126397-4126419 ATTTTGGCCCTTTTTTCTATAGG + Intergenic
1186078405 X:5905070-5905092 TCTTTTGGTTTTTTTTTTTTTGG - Intronic
1186185362 X:7015220-7015242 TCTTTGGGCCTTCATTCTAAAGG - Intergenic
1186443036 X:9602347-9602369 TCTTTCTTCCTTTTTTTTTTTGG + Intronic
1186568060 X:10685733-10685755 TCTTTGGGCCTTCCTTCTGAAGG + Intronic
1186706023 X:12139531-12139553 ACTTTCAGCCTTTTTTTTTTTGG + Intronic
1186732816 X:12428480-12428502 TCTTGGGTATTTTTTTCTTTAGG + Intronic
1187619479 X:21034681-21034703 TCTTTGTCCTTTTTTTCCTTGGG - Intergenic
1188279942 X:28254889-28254911 ACTTTTAGCCTCTTTTCTTTTGG - Intergenic
1188594297 X:31878690-31878712 TCTTTTGTCCAATTTTCTTTTGG - Intronic
1189418328 X:40833717-40833739 TCATTTGGCCTCTTTTGTTTGGG + Intergenic
1189479463 X:41381628-41381650 CCTCGTGGCCTTTTTTCTTTAGG + Intergenic
1189525492 X:41815710-41815732 TTTTTGGGCTTTATTTCTTTAGG - Intronic
1189630908 X:42952392-42952414 TCTTTCTGCTTTTTCTCTTTTGG - Intergenic
1189649431 X:43173375-43173397 TCTTTGGGTCTTTATTCTGATGG + Intergenic
1189990984 X:46594746-46594768 TCTTTGAGCTTTTCTTCTTTGGG + Intronic
1190507430 X:51139891-51139913 TCTGTGGGCCTTTCTTCCTGAGG - Intergenic
1190512524 X:51188092-51188114 TCTTTTGCCCTTTTTTAATTGGG - Intergenic
1190804645 X:53823878-53823900 TATTTGGGTCTTTTTTTTTTTGG + Intergenic
1191022881 X:55881414-55881436 CCTTTGGGTTTCTTTTCTTTTGG - Intergenic
1191023896 X:55892865-55892887 TCTTTGGGCTTTTCATGTTTGGG + Intergenic
1191164674 X:57375730-57375752 TATTTGGCCCTTTTTTAATTGGG + Intronic
1191732040 X:64347013-64347035 TCTCTGAGCCTGTTTTCTTATGG - Intronic
1191764753 X:64685300-64685322 TCCTTGGAACTTTTTTCCTTAGG - Intergenic
1192062364 X:67841030-67841052 TCTGTGTGTCTTTTTTTTTTTGG - Intergenic
1192327170 X:70142810-70142832 TCTTTGTGTTTTTTTTGTTTTGG - Intronic
1192841427 X:74860348-74860370 TCTTTGTTCGTTTTTTGTTTGGG - Intronic
1193142850 X:78046887-78046909 TTCTTGGGCCTTTTTTTTTTTGG - Exonic
1193649370 X:84110612-84110634 TCTTTTGGCTTTGTTTCTATAGG - Intronic
1194044323 X:88983181-88983203 CCTTTTTGCTTTTTTTCTTTTGG + Intergenic
1194088756 X:89560515-89560537 TCTTTGGGTCTTTATTCTGAAGG + Intergenic
1194121553 X:89969845-89969867 TCTTTAAGATTTTTTTCTTTGGG + Intergenic
1194287415 X:92026944-92026966 TCTTTTGCCCTGTCTTCTTTGGG + Intronic
1194452057 X:94056163-94056185 TCTTTCATCCATTTTTCTTTGGG - Intergenic
1194844879 X:98792890-98792912 GAGCTGGGCCTTTTTTCTTTGGG - Intergenic
1195407528 X:104532654-104532676 TCTTTGGGCTTATTCTCTTGGGG + Intergenic
1195819342 X:108926444-108926466 CCTTTGGGCCTCTTTTATTAGGG - Intergenic
1195854264 X:109313412-109313434 TCTACTGGCCTTTTTGCTTTAGG - Intergenic
1196208065 X:112963671-112963693 TCTTTGTTCTTTTTTTCTTTTGG + Intergenic
1196208341 X:112966956-112966978 TCTTTGGGTCTTTATTCTGAAGG - Intergenic
1196227385 X:113182248-113182270 TCTTGAGCCCTTTTATCTTTGGG + Intergenic
1196714911 X:118801293-118801315 TCTCTTGGCCTCTTTTCTCTTGG + Intergenic
1196869843 X:120102347-120102369 TCTTTTGGTCTTTTTTCCATTGG + Intergenic
1197216578 X:123872325-123872347 TTTTTCGTCCTTTTTTTTTTTGG + Intronic
1197686889 X:129449828-129449850 TGTTTGGACTTTTTTTTTTTTGG - Intronic
1198367976 X:135962037-135962059 TTTTTTGGGCTTTTTTTTTTTGG - Intergenic
1198491974 X:137150852-137150874 TCTTTGGGTCCATTTTGTTTGGG + Intergenic
1198641603 X:138761932-138761954 TCTTCTTGCCTTTTTTCTCTAGG + Intronic
1198646631 X:138814520-138814542 GCTTTGCTCATTTTTTCTTTTGG - Intronic
1199397062 X:147350962-147350984 TCTGAGGGCCTCTTTTCTTTTGG + Intergenic
1199919616 X:152384914-152384936 TCTTTTGTCCATTTTTCTATTGG - Intronic
1200441432 Y:3216566-3216588 TCTTTGGGTCTTTATTCTGAAGG + Intergenic
1200474409 Y:3627297-3627319 TCTTTAAGATTTTTTTCTTTGGG + Intergenic
1200604952 Y:5251509-5251531 TCTTTTGCCCTGTCTTCTTTGGG + Intronic
1200840758 Y:7779206-7779228 TCATTGGACCTTTTTTCTATTGG + Intergenic
1202244164 Y:22799863-22799885 TATTTATGCCTTTTTTCTTTTGG + Intergenic
1202397152 Y:24433613-24433635 TATTTATGCCTTTTTTCTTTTGG + Intergenic
1202473629 Y:25236479-25236501 TATTTATGCCTTTTTTCTTTTGG - Intergenic